ID: 906306779

View in Genome Browser
Species Human (GRCh38)
Location 1:44724663-44724685
Sequence CTGGAGGTGCGCGCGGCGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 248}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906306770_906306779 11 Left 906306770 1:44724629-44724651 CCACAGCAACAGCCAGCGGCTGG 0: 1
1: 0
2: 1
3: 20
4: 254
Right 906306779 1:44724663-44724685 CTGGAGGTGCGCGCGGCGGCTGG 0: 1
1: 0
2: 2
3: 25
4: 248
906306768_906306779 27 Left 906306768 1:44724613-44724635 CCATGGGCAACACGGACCACAGC 0: 1
1: 0
2: 1
3: 11
4: 139
Right 906306779 1:44724663-44724685 CTGGAGGTGCGCGCGGCGGCTGG 0: 1
1: 0
2: 2
3: 25
4: 248
906306772_906306779 -1 Left 906306772 1:44724641-44724663 CCAGCGGCTGGCCAGCCTCACGC 0: 1
1: 0
2: 1
3: 11
4: 189
Right 906306779 1:44724663-44724685 CTGGAGGTGCGCGCGGCGGCTGG 0: 1
1: 0
2: 2
3: 25
4: 248
906306767_906306779 30 Left 906306767 1:44724610-44724632 CCGCCATGGGCAACACGGACCAC 0: 1
1: 0
2: 1
3: 12
4: 187
Right 906306779 1:44724663-44724685 CTGGAGGTGCGCGCGGCGGCTGG 0: 1
1: 0
2: 2
3: 25
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906306779 Original CRISPR CTGGAGGTGCGCGCGGCGGC TGG Exonic
900119211 1:1041392-1041414 CTTGTGGTGAGCGCGGCGGCGGG + Exonic
900465734 1:2824681-2824703 CTGGAGGTGGGGCCGGCGGGAGG - Intergenic
900475891 1:2876171-2876193 GCGGAGGTGCGGGCGGCCGCCGG - Intergenic
900572128 1:3363859-3363881 CTGGAGGTGGGAGCTGCAGCGGG - Intronic
900610556 1:3542863-3542885 CTGGAGGTGAGCTCGGGGCCAGG + Intronic
901570888 1:10159534-10159556 ATGGTGGTGGGCGCGGTGGCGGG + Intronic
901633062 1:10657252-10657274 CTGGCGGTGGCGGCGGCGGCTGG - Intronic
902451437 1:16499172-16499194 CTGGGGGTGCGCGCGTGCGCGGG - Intergenic
902770083 1:18640821-18640843 CTGGAGGGGCGCGCCGGGCCGGG + Intronic
902770923 1:18645225-18645247 CTGGAGTGGCCCGCGTCGGCGGG + Intronic
903004707 1:20290985-20291007 CTGGAGGTGCGGTCCGGGGCTGG - Exonic
903142212 1:21345490-21345512 CTGGAGCTGAGCGCGCCGCCTGG - Intronic
904142538 1:28365158-28365180 CTGGGGGTGTGCGCGGTGGATGG + Intergenic
904760470 1:32800263-32800285 CTGGAGCTGGGCGCAGTGGCTGG - Intronic
906051859 1:42880935-42880957 CTGGAGGTGGCCGAGGCGGCAGG + Intergenic
906206944 1:43991987-43992009 CTGGAGCTGCGGGCGGAGGTGGG + Exonic
906263127 1:44407811-44407833 GCGGTGGTGCGCGCGGCGGCGGG + Intronic
906306779 1:44724663-44724685 CTGGAGGTGCGCGCGGCGGCTGG + Exonic
906365602 1:45206731-45206753 TTGGAGGTGCGCGGGCGGGCGGG - Intronic
907091450 1:51729609-51729631 CGGGAGGGGTGCGCAGCGGCGGG - Intronic
910916954 1:92299285-92299307 CAGGAGGTGCGGACGGCGGTGGG - Intronic
920394161 1:205631799-205631821 CGGGAGATGCGGGCGGCTGCGGG - Exonic
924289615 1:242524404-242524426 CTGGAGGAGCGAGCGGGCGCGGG + Exonic
924362290 1:243254777-243254799 CTGGAGCTCCGGGGGGCGGCGGG + Intronic
1064443122 10:15371122-15371144 ATGGAGGGGGGCGCGGCGCCCGG - Intergenic
1067669645 10:48307057-48307079 CGGGCGGGGCTCGCGGCGGCAGG - Intronic
1072169758 10:92848312-92848334 CTGGGGCTACGGGCGGCGGCCGG - Intronic
1072169884 10:92848739-92848761 CAGGTGGTGCGCGCGGGGGCGGG + Intronic
1073498814 10:103918108-103918130 CTGGAGCTGCAGGCGGCGGGAGG - Exonic
1074771530 10:116737965-116737987 CTGGGGGTGCCCGCAGTGGCAGG + Intronic
1076735859 10:132458656-132458678 GTGGAGGTGGGCACGGCAGCGGG - Intergenic
1076806793 10:132862800-132862822 CTGGAGGGGGACGGGGCGGCCGG + Intronic
1077048444 11:556116-556138 CTGGAGGGGCGTGGAGCGGCGGG + Intronic
1077143507 11:1035038-1035060 CTGGACGAGCACGAGGCGGCAGG + Intronic
1077231956 11:1461671-1461693 CTGGTGGGGCGCGGGGGGGCTGG + Exonic
1077505716 11:2929221-2929243 CTTGGGGCGCGCGCGGGGGCTGG + Exonic
1078604933 11:12766919-12766941 CTGGAGGTGGGGGTGGCTGCAGG - Intronic
1078699593 11:13668393-13668415 CGGGAGGTGGGCCCTGCGGCCGG - Intergenic
1078987208 11:16607614-16607636 CAGGAGGTGCGCGCGGAGCGGGG + Intronic
1080910704 11:36594910-36594932 CTGGAGGTGCTTGGGGCGGGAGG + Exonic
1083048275 11:59755469-59755491 CTGGAGGCGCAGGCGGCGGCGGG - Exonic
1084184564 11:67464786-67464808 CTGGAGGTGCGAGCGGGCACCGG - Exonic
1084190265 11:67495452-67495474 CTGGTGGTGCTGGGGGCGGCTGG + Exonic
1084336444 11:68460654-68460676 CTGGAGCTGGGGGCGGGGGCAGG + Intergenic
1084412087 11:69011142-69011164 CGGGAGGAGTGCGCGGCGGGCGG - Intronic
1086993529 11:93330915-93330937 CTGGAGGGGCGCGTGGCGCGGGG + Intronic
1087634447 11:100687152-100687174 CTGGGTGGGAGCGCGGCGGCGGG + Intergenic
1095532142 12:43201215-43201237 GTGGTGGTGGGCGCGGTGGCGGG + Intergenic
1097231596 12:57515252-57515274 CTGGAGGTGGGAGCTGCAGCTGG - Exonic
1101850045 12:108394433-108394455 CTGGAGCTGCTCGAGGCAGCTGG - Intergenic
1103309090 12:119989938-119989960 ATGGAGCTGCCCGCCGCGGCCGG + Exonic
1104682539 12:130761532-130761554 CTGGAGGTGAGCACTGCGGTGGG + Intergenic
1105296410 13:19090843-19090865 CTGGTGATGAGCGCAGCGGCAGG + Intergenic
1105578551 13:21674156-21674178 CTGGAGGCGCGCGCAGCGGCAGG + Intronic
1107011278 13:35673636-35673658 CTAGGGGGGCGCGGGGCGGCAGG - Intergenic
1108340651 13:49495972-49495994 CTGCAGCTGCGGGTGGCGGCCGG - Exonic
1108396605 13:49996845-49996867 CCGGAGGTGCAGGCGGAGGCGGG + Intronic
1110318615 13:74135598-74135620 CGGGCGGGGCGCGCGGCGGACGG + Intergenic
1112080740 13:95967446-95967468 TTGGGGGTGCGCGTGGGGGCTGG - Intronic
1113805736 13:113109312-113109334 CAGGAGGTGCCCTGGGCGGCAGG - Intronic
1114635238 14:24183439-24183461 CTGGAGGTGAGCGGGCCGGCGGG - Exonic
1115852664 14:37599864-37599886 CGGGAGACGCGCGCGGCCGCGGG - Intronic
1117913202 14:60653470-60653492 CGGGAGCCGCGCGGGGCGGCAGG - Intronic
1121338796 14:93092930-93092952 CTGGAGGCACGCGCCGTGGCTGG - Intronic
1122115556 14:99525670-99525692 CTGGGGGTGCGGGTGGAGGCAGG + Intronic
1122975258 14:105168338-105168360 GTGCAGGTGAGCGGGGCGGCGGG - Exonic
1123035478 14:105470152-105470174 GTGGCGGTGGCCGCGGCGGCAGG - Exonic
1123716692 15:23039118-23039140 TTGCAGGCGCGCGCGCCGGCCGG + Intronic
1124712957 15:32030437-32030459 GTGGAGAGGCGCGCGGGGGCGGG + Intergenic
1126649635 15:50908251-50908273 CCGGAGCCGCGCGCGGCGCCGGG + Intergenic
1129672426 15:77614626-77614648 CCGGATGCGGGCGCGGCGGCAGG + Exonic
1130063544 15:80586727-80586749 ATGGTGGTGCGCGCTGAGGCAGG + Intronic
1132552824 16:560399-560421 CGGGAGGTGCGAGCGGCGTCGGG + Intergenic
1132560209 16:590080-590102 CTGGTGGTGCGGGAAGCGGCGGG + Intronic
1132568435 16:633743-633765 CTGGAGGAGCCCGAGGCCGCCGG + Exonic
1132841026 16:1978635-1978657 CAGGGGGTGGGGGCGGCGGCCGG - Exonic
1132843503 16:1989846-1989868 TGGGAGGTGGGCGCGGCGGAGGG + Intronic
1134134025 16:11668275-11668297 CGGGGGCTGCGCGCGGCGGGCGG - Intergenic
1134406948 16:13969395-13969417 CTGGAGCTGCGTGGGGCTGCAGG - Intergenic
1134521242 16:14920078-14920100 CTGGAGGTGTGCGGGGGGCCAGG + Intronic
1134656146 16:15949728-15949750 CCGGTGGCGCGGGCGGCGGCGGG - Exonic
1134708917 16:16318729-16318751 CTGGAGGTGTGCGAGGGGCCAGG + Intergenic
1134716127 16:16358763-16358785 CTGGAGGTGTGCGAGGGGCCAGG + Intergenic
1134950688 16:18349916-18349938 CTGGAGGTGTGCGAGGGGCCAGG - Intergenic
1134958626 16:18393396-18393418 CTGGAGGTGTGCGAGGGGCCAGG - Intergenic
1135517612 16:23148928-23148950 CGGGAGAGGCGGGCGGCGGCGGG + Exonic
1136028006 16:27482246-27482268 CTGGAGGGGAGTGTGGCGGCAGG + Intronic
1138023110 16:53502762-53502784 CTGGAGGGGCCCGCGGCTCCCGG - Intronic
1139390564 16:66604642-66604664 CTGGAGGAGCGGGTGGGGGCGGG + Intronic
1141790029 16:86228074-86228096 CAGGAGGAGGGCGCGGGGGCGGG - Intergenic
1142185640 16:88693549-88693571 CTGCAGGTGTGCGCGGTGGCCGG - Intergenic
1142623702 17:1179858-1179880 CGGGAGGAGCGCGGGGCGGCCGG + Exonic
1142986024 17:3695796-3695818 CTGGAGAAGGACGCGGCGGCTGG + Intronic
1144021048 17:11240701-11240723 CCGGGAGAGCGCGCGGCGGCTGG - Intergenic
1147310316 17:39592230-39592252 CTGGAGGTGGGGGAGGCAGCGGG - Intergenic
1147971357 17:44220250-44220272 CCGGAGGTGCCCCCGGCGTCCGG + Intronic
1149604739 17:57916681-57916703 CTGGGGGTGGGCGAGGCTGCTGG - Intronic
1150216930 17:63476473-63476495 CTGGAGGGGCTCAGGGCGGCCGG - Intergenic
1150249954 17:63699831-63699853 CTGGCGGGGCTCGCGGCGTCGGG - Intronic
1150790893 17:68199497-68199519 CTGGATGTGCCCGCGGCCCCTGG + Intergenic
1151153801 17:72110424-72110446 CTGTGTATGCGCGCGGCGGCGGG + Intergenic
1151660678 17:75516528-75516550 GTGGCGGCGCGCGCAGCGGCAGG + Exonic
1152114779 17:78378803-78378825 CAGGAGGTGAGAGGGGCGGCCGG + Exonic
1152197275 17:78925134-78925156 CGGGCGCTGCTCGCGGCGGCGGG + Exonic
1152621414 17:81366766-81366788 CTGGAGGCGCCCGGGGAGGCGGG + Intergenic
1152655558 17:81517754-81517776 CTGGAGGGGGGGGGGGCGGCCGG - Intronic
1152904603 17:82963329-82963351 CTGGAGGTTCGCGCTGGGGATGG - Intronic
1154452684 18:14489716-14489738 CTCGAGGTTCCCGCGGCGGGAGG + Intergenic
1157222417 18:45837548-45837570 CCCGAGGTGAGCGCGGAGGCAGG + Exonic
1160008905 18:75088975-75088997 CTGGAGATGGGAGCGGAGGCTGG + Intergenic
1160265493 18:77338529-77338551 GTGGAGGTGCCCGAGGTGGCAGG + Intergenic
1160508678 18:79441339-79441361 CTGGAGGTGCACATGGCTGCTGG + Intronic
1160659277 19:290913-290935 CGGGAGGTGGGGGCGGCCGCGGG - Intronic
1160831934 19:1108302-1108324 CTGGGGGAGGGCGCGGGGGCGGG - Exonic
1160904468 19:1445938-1445960 CTGGGGGGGCCCGAGGCGGCGGG - Intergenic
1160904519 19:1446096-1446118 CTGGGGGTGCTCGCGGGGGCTGG - Intergenic
1161133888 19:2608410-2608432 CTGGAGGTGGGCGCCCCAGCAGG + Intronic
1161241915 19:3227577-3227599 CTGGAGGTGCACCCGGCTCCTGG + Intronic
1161288625 19:3481013-3481035 CTGCAGGTGCCCGCCGCGCCTGG - Intergenic
1161461560 19:4400573-4400595 CCGGGGGCGCGCGCGGGGGCCGG - Intergenic
1161461569 19:4400592-4400614 CCGGGGGCGCGCGCGGGGGCCGG - Intergenic
1162019660 19:7862797-7862819 AGGGAGGTGCGGGCGGGGGCGGG - Intronic
1163402502 19:17102552-17102574 CTGGAGGTGAGCGGGGAAGCTGG + Exonic
1163849479 19:19655125-19655147 CTGGTGGTGCGCGGTGTGGCCGG - Exonic
1165058744 19:33194786-33194808 ATGGAGAAGCGCGCGGCCGCGGG + Exonic
1165067177 19:33236020-33236042 GTGGGGCTGCGCGCTGCGGCGGG + Intergenic
1165129335 19:33622257-33622279 CTGGAGGCGCCCGCGGCCTCGGG + Intronic
1165349824 19:35269373-35269395 CTGCAGCTGGGCGCGGGGGCGGG + Intronic
1165914154 19:39247727-39247749 CTGGAGCTGCTGGCGGCCGCGGG - Intergenic
1166852061 19:45765829-45765851 CTGGAGGTGGTGGCAGCGGCGGG + Exonic
1166882981 19:45940291-45940313 CGGGAGGCGGGGGCGGCGGCGGG + Exonic
1166949389 19:46416515-46416537 CGGGGGCTGAGCGCGGCGGCTGG - Intergenic
1167110393 19:47457319-47457341 CTGGATGACCTCGCGGCGGCTGG + Exonic
1167148212 19:47694942-47694964 GTGGAGGTCTGCGGGGCGGCAGG - Exonic
1167380089 19:49133537-49133559 CTGGAGGTTTGCGCGGGGGACGG + Intronic
1167488289 19:49776199-49776221 CTGAGGATGCGGGCGGCGGCGGG - Intronic
1167577766 19:50325933-50325955 CTGCAGCTGCGCACTGCGGCGGG - Intronic
1168309367 19:55452768-55452790 CTGGGCGTGCGCGCGCCGGCTGG + Intergenic
1168354515 19:55692888-55692910 CTGGAGGTGGGGGCTGAGGCGGG + Intronic
925609927 2:5693862-5693884 CTGGGGGGCGGCGCGGCGGCCGG + Exonic
926163203 2:10502345-10502367 GTGGAGGGGGGCGTGGCGGCGGG - Intergenic
927552179 2:24010187-24010209 CGAGAGGTGAGCGGGGCGGCGGG + Exonic
927997646 2:27497160-27497182 CTGGAGGTGGGAGTGGCAGCAGG - Intronic
928998614 2:37324445-37324467 TTGGGGGAGCGCGCGGCGGGAGG - Intronic
928998767 2:37324917-37324939 CGGGAGGTGGCCGCGGCGGGAGG + Intergenic
929033606 2:37671483-37671505 CTGGATCTGCGCACAGCGGCAGG - Exonic
932329450 2:70889364-70889386 CTGGGGGTGCGAGCGCGGGCTGG - Intergenic
932735844 2:74254054-74254076 CTGGCGGTGCTTGCGGCTGCAGG - Intronic
933666925 2:84971480-84971502 CGGGAGGTGCGGGTGGGGGCGGG - Intronic
934655865 2:96116607-96116629 CTGGAGGCGGGCGCGGGAGCGGG + Intergenic
934754641 2:96816626-96816648 CTGGCGGTGCGCGTGGAGCCGGG + Exonic
934993295 2:98936262-98936284 GGGGAGGTGCGCGCGGCGGCCGG - Intergenic
936038190 2:109129146-109129168 CAGGAAGTGCGGGCAGCGGCCGG - Intergenic
936104780 2:109614638-109614660 CTTGAAGTGCGCGCGGGCGCGGG - Exonic
937119461 2:119431782-119431804 CTGGAGGCGGGCGGGGCGGGAGG - Intronic
938034703 2:128027101-128027123 CGGGCGGTGCGGGCGGCGGGCGG - Exonic
938319961 2:130356059-130356081 CTCGCCGCGCGCGCGGCGGCCGG + Exonic
939980808 2:148778532-148778554 CTGGTGGTGGGCGGGGGGGCAGG - Intronic
941111770 2:161424248-161424270 CTGGGGGTCCGGGCCGCGGCGGG - Exonic
942151107 2:173076308-173076330 CTGGAGGCGCGGGCGCAGGCCGG + Intronic
942360709 2:175168520-175168542 CTGGAGGAGGGCGCGGGTGCAGG + Intergenic
942505608 2:176638253-176638275 CGCGGCGTGCGCGCGGCGGCGGG + Intergenic
942678191 2:178450745-178450767 CTGGCGGCGCGCGGGGCGGGCGG - Intronic
1168757100 20:325510-325532 GGGGTGGTGCGCGCGCCGGCGGG + Exonic
1169073748 20:2749540-2749562 CTGGCTGGGCCCGCGGCGGCCGG - Intronic
1169075141 20:2755674-2755696 CTGGTGGTGGGGGCAGCGGCCGG - Exonic
1169191400 20:3660927-3660949 CTGCAGGTGCGCGCGGGCGGCGG - Exonic
1170500950 20:16974887-16974909 CTGGAGGGGGCCGAGGCGGCAGG - Intergenic
1172245638 20:33443562-33443584 CTGGAGCTGCGCGCCGGGGCGGG - Exonic
1174524069 20:51157284-51157306 CTGGAGGTGTGAGCTGAGGCAGG - Intergenic
1175215993 20:57391938-57391960 CGGCAGGTGCGGGCGCCGGCTGG - Intronic
1176008511 20:62879798-62879820 CTGGAGGAGAGCGCGGAGGGCGG + Exonic
1178152449 21:29811076-29811098 CTGGTGGTGCTCGCTGCTGCTGG + Intronic
1178942983 21:36923046-36923068 CTGGCGGTGGGTGCGGCGGTGGG - Intronic
1179088018 21:38237595-38237617 ATGGAGGTGAGCGGGGGGGCAGG + Intronic
1179605655 21:42513863-42513885 CAGGAAGCGCCCGCGGCGGCCGG + Intronic
1180074421 21:45455495-45455517 CTGGAGCTGCGGGCGGCGGGAGG - Exonic
1180190695 21:46161197-46161219 CCGCAGGTGCGGGCAGCGGCGGG + Exonic
1180231064 21:46426961-46426983 CTGGAGGGGCGAGCGGAGGCGGG - Intronic
1180620578 22:17159175-17159197 CGGGCGGCGCGCGCGGCTGCGGG - Exonic
1180801524 22:18634197-18634219 CTGGTGGAGCGTGCGGGGGCCGG + Intergenic
1180852758 22:19029737-19029759 CTGGTGGAGCGTGCGGGGGCCGG + Intergenic
1180969544 22:19807968-19807990 CTGGAGGTGGGCGCCTCAGCAGG - Intronic
1181028648 22:20139644-20139666 CTGGGGGAGCGCGGGGCAGCAGG - Intronic
1181220198 22:21361064-21361086 CTGGTGGAGCGTGCGGGGGCCGG - Intergenic
1182555592 22:31126855-31126877 CTGAAGGTGGGCGCGAGGGCGGG + Intronic
1184510233 22:44929040-44929062 GTGGCTGTGCGCGTGGCGGCTGG - Intronic
1184955887 22:47885655-47885677 CTGGAGCTGCCAGAGGCGGCTGG + Intergenic
1185422922 22:50744991-50745013 CTGGAGGTGGGGGTGGGGGCGGG - Exonic
950583544 3:13878367-13878389 CTGAATGTGCGCGGGGCGGCGGG + Intronic
953464358 3:43105914-43105936 CTGGCGCTGGGGGCGGCGGCGGG - Exonic
953748249 3:45591381-45591403 CTGGAGGGGGCCGAGGCGGCAGG + Intronic
954110191 3:48429270-48429292 CGGGATGTGCGCGCCGAGGCGGG + Exonic
954621802 3:52000684-52000706 GTGGCGGTGCTCGCGGGGGCTGG + Intergenic
956675044 3:71725333-71725355 CCGGCGGGGGGCGCGGCGGCCGG + Exonic
962317975 3:134370714-134370736 CTGGAAGTGCGGGCTGCCGCGGG + Exonic
966181861 3:177196466-177196488 GGGGAGGGGCGCGCGGCAGCCGG - Exonic
967806616 3:193719723-193719745 CTGGAGGTGGGTGGGGCAGCAGG + Intergenic
968593298 4:1470410-1470432 CTGGAGGAGGGGGCTGCGGCTGG + Intergenic
968674508 4:1870672-1870694 CCGGAGCTGGGCGCGGCTGCGGG - Intergenic
968746823 4:2364756-2364778 CTTGACGAGGGCGCGGCGGCGGG - Intronic
969262499 4:6042970-6042992 CTGGGGGTGAGCACGGAGGCAGG + Intronic
970967853 4:21948794-21948816 CTGCAGGTGCGGGCGGAGGCCGG + Exonic
971310384 4:25521096-25521118 CTGGGGATGCGCGCGGTGGATGG + Intergenic
978741818 4:112145647-112145669 CTGGCGGAGCGGGAGGCGGCAGG + Exonic
980075128 4:128287175-128287197 CTGGAGGTGCCCGTAGCTGCGGG + Intronic
981504225 4:145482168-145482190 CTGGGGGCGCGGGCAGCGGCGGG + Intronic
983577058 4:169271169-169271191 CGGGAGGCCGGCGCGGCGGCGGG - Intergenic
984973419 4:185209910-185209932 CTTCAGGGGCGAGCGGCGGCCGG + Intronic
985871997 5:2564371-2564393 CTGCAGGGGAGCACGGCGGCTGG + Intergenic
985996985 5:3602591-3602613 CTGGGGGTGCGAGCGGAGGACGG - Intergenic
993463228 5:88211619-88211641 GTGGCGGCGGGCGCGGCGGCGGG + Intronic
995512448 5:112922322-112922344 GAGGAGGGGCGCGCGGCGGCCGG - Exonic
999270925 5:150295990-150296012 ATGGAGGCGCGCTAGGCGGCAGG + Intergenic
999462914 5:151772173-151772195 CCGCAGGCGCGCGCGGCGGACGG + Intronic
999768411 5:154756939-154756961 CTTGAGGGGCGTGTGGCGGCGGG + Intronic
1001035130 5:168291939-168291961 CGGGAGGAGCGGGCGGCGCCGGG + Intronic
1003087124 6:3068923-3068945 CCCGGGGTGCGCGCGGCGGGCGG + Intronic
1004203883 6:13574281-13574303 CGGGAGGCGGGCGCGCCGGCTGG - Intergenic
1004614961 6:17281086-17281108 CGGGCGGGGGGCGCGGCGGCGGG - Intergenic
1006228090 6:32557899-32557921 CGCGAGGTGAGCGCGGCGGGGGG - Intronic
1007435366 6:41806581-41806603 CCTGAGGAGCGCGCTGCGGCAGG + Exonic
1014230075 6:118893890-118893912 CTGGAGGGGCGGGCGTCGGCCGG + Intronic
1016982164 6:149863770-149863792 CTGGAGCTGCGCGCGGGCGGCGG - Exonic
1017891598 6:158644270-158644292 CTGGAGCGGGGCGCGGCGGCCGG - Intronic
1018312805 6:162528076-162528098 CGGGAGGGGTGCGGGGCGGCGGG + Intronic
1019184376 6:170212603-170212625 CTGGAGGTGCGGGAGGAGGCAGG - Intergenic
1019190022 6:170246327-170246349 CTGGAGCTGGGGGCGGCTGCAGG - Intergenic
1019190114 6:170246567-170246589 CTGGAGCTGGGGGCGGCTGCAGG - Intergenic
1019190179 6:170246739-170246761 CTGGAGCTGGGGGCGGCTGCAGG - Intergenic
1019190295 6:170247049-170247071 CTGGAGCTGGGGGCGGCTGCAGG - Intergenic
1019190308 6:170247083-170247105 CTGGAGCTGGGGGCGGCTGCAGG - Intergenic
1019190320 6:170247117-170247139 CTGGAGCTGGGGGCGGCTGCAGG - Intergenic
1019198558 6:170296333-170296355 CTGGAGGTGGTGGCGGCGCCAGG + Intronic
1019448401 7:1083226-1083248 CTGAAGGCGCGTGCGGCTGCTGG - Intronic
1019529919 7:1498336-1498358 CTGGAGGGGCACGTGGCGTCTGG - Intronic
1020034886 7:4958915-4958937 AGGGAGGGGCGCGCGGCGGCGGG - Intronic
1021162921 7:17298625-17298647 CAGCCGGTGCGCGCGGCGGCGGG + Exonic
1022391831 7:29950306-29950328 CTGGAGAAGCCCGAGGCGGCAGG - Intronic
1022530650 7:31064931-31064953 CTCCAGGTGAGCGGGGCGGCAGG + Exonic
1023703137 7:42912042-42912064 CAGGAGGTGCCCGAGGCGGCGGG - Exonic
1023948150 7:44819945-44819967 GTGGTGGTGGGCGCGGGGGCGGG + Intronic
1024561850 7:50651336-50651358 CTGGAGGTTCTGGCGGCTGCTGG + Intronic
1029414760 7:100435937-100435959 CTGGAGCTGCGGGCCGCAGCCGG - Exonic
1029896382 7:103989274-103989296 CTGAGGGCGCGCGCGGCGGCTGG - Exonic
1032081026 7:128858541-128858563 CTGGAGGTGGGGGCTGAGGCTGG - Exonic
1032091223 7:128912620-128912642 CTGGAGGTGGGGGCTGAGGCTGG + Intergenic
1033033143 7:137846534-137846556 CTGGACGAGCCCGCGGCCGCCGG - Exonic
1034224864 7:149474494-149474516 CAGGAGGTGCGGGCGGCGTCGGG + Exonic
1034275130 7:149820701-149820723 CTGGAGGTCTGAGCAGCGGCGGG - Intergenic
1036617976 8:10403522-10403544 CTGGAGGTGCTCGCTGGGGAAGG + Intronic
1036731778 8:11271822-11271844 TTGAAGATGCGGGCGGCGGCGGG + Intergenic
1037828966 8:22177179-22177201 CTGGAGGTGGGGGCTGGGGCGGG - Intronic
1038450029 8:27633921-27633943 CGGGAAGCGCGGGCGGCGGCGGG + Intronic
1041693709 8:60714422-60714444 CTGGCGGTGTGCGGGGCGGGGGG - Intronic
1046962347 8:120124880-120124902 CCCCAGGTGCGCGCGGCAGCCGG - Intronic
1049791089 8:144473046-144473068 CTGCAGGTGGGCGCCGGGGCGGG + Exonic
1055069234 9:72149466-72149488 CTGCAGCTGCGGGCGGCTGCCGG - Exonic
1055722700 9:79193686-79193708 CCGCAGGTGAGGGCGGCGGCGGG + Intergenic
1056154110 9:83817722-83817744 GCGGAGGTGAGCGCGGCTGCAGG + Exonic
1060208915 9:121698917-121698939 AGGGAGGTGAGCGGGGCGGCCGG + Intronic
1061408571 9:130406007-130406029 GGTGAGGTGCACGCGGCGGCGGG - Intronic
1061490134 9:130939897-130939919 CGGGAGGGGAGCGCGGCGTCGGG - Intergenic
1061975881 9:134067884-134067906 CGGGCGGCGCGGGCGGCGGCGGG - Intronic
1062017286 9:134297185-134297207 GAGGAGGAGCGCGCGGGGGCTGG + Intergenic
1062489813 9:136799647-136799669 CTGGAGGAGCCAGCGGCTGCGGG + Intronic
1203787092 EBV:134126-134148 CTGAACGTGCCCGGGGCGGCGGG + Intergenic
1185749686 X:2600828-2600850 CTGGAGGTGGGCCTGGTGGCAGG + Intergenic
1185779105 X:2829728-2829750 AAGCAGGTGCGCGGGGCGGCGGG + Intronic
1187506129 X:19879928-19879950 GTGGTGGTGCGGGGGGCGGCTGG + Intronic
1187933090 X:24311649-24311671 CTGGTGGGGCGCCCGGCAGCTGG + Intergenic
1189037106 X:37505068-37505090 GTGGAGGGGCGCGCGCCGTCGGG - Intronic
1190745906 X:53321472-53321494 CAGGTGGGGCGCGCGGGGGCGGG - Intergenic
1195265031 X:103171812-103171834 CTGGAGGGTTGCACGGCGGCCGG + Intergenic
1198533287 X:137565590-137565612 TTGGAGGTGGACGCAGCGGCTGG + Intergenic
1200873646 Y:8128779-8128801 CTGGAGGTGGCCGGGCCGGCTGG + Intergenic