ID: 906307086

View in Genome Browser
Species Human (GRCh38)
Location 1:44726261-44726283
Sequence CCGGTTGTTACAGACATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906307079_906307086 6 Left 906307079 1:44726232-44726254 CCAGAACACCCTACCTACCTGGT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 906307086 1:44726261-44726283 CCGGTTGTTACAGACATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 55
906307077_906307086 9 Left 906307077 1:44726229-44726251 CCTCCAGAACACCCTACCTACCT 0: 1
1: 0
2: 2
3: 16
4: 174
Right 906307086 1:44726261-44726283 CCGGTTGTTACAGACATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 55
906307074_906307086 23 Left 906307074 1:44726215-44726237 CCTATGCACCCTTTCCTCCAGAA 0: 1
1: 0
2: 1
3: 25
4: 239
Right 906307086 1:44726261-44726283 CCGGTTGTTACAGACATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 55
906307076_906307086 14 Left 906307076 1:44726224-44726246 CCTTTCCTCCAGAACACCCTACC 0: 1
1: 0
2: 1
3: 34
4: 291
Right 906307086 1:44726261-44726283 CCGGTTGTTACAGACATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 55
906307083_906307086 -7 Left 906307083 1:44726245-44726267 CCTACCTGGTTTTTCTCCGGTTG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 906307086 1:44726261-44726283 CCGGTTGTTACAGACATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 55
906307080_906307086 -2 Left 906307080 1:44726240-44726262 CCCTACCTACCTGGTTTTTCTCC 0: 1
1: 0
2: 6
3: 33
4: 372
Right 906307086 1:44726261-44726283 CCGGTTGTTACAGACATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 55
906307081_906307086 -3 Left 906307081 1:44726241-44726263 CCTACCTACCTGGTTTTTCTCCG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 906307086 1:44726261-44726283 CCGGTTGTTACAGACATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 55
906307075_906307086 15 Left 906307075 1:44726223-44726245 CCCTTTCCTCCAGAACACCCTAC 0: 1
1: 0
2: 3
3: 27
4: 242
Right 906307086 1:44726261-44726283 CCGGTTGTTACAGACATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906307086 Original CRISPR CCGGTTGTTACAGACATTAA AGG Intergenic
901019227 1:6247549-6247571 GCGGTTTTTACAAACATAAAGGG - Exonic
902318114 1:15639205-15639227 ACGGTTGTTACTGACAGAAAAGG - Intronic
904341578 1:29838334-29838356 CCAGCTGTAACTGACATTAATGG - Intergenic
906307086 1:44726261-44726283 CCGGTTGTTACAGACATTAAAGG + Intergenic
911690597 1:100829600-100829622 CAGGTTCTTACAGCCAATAATGG - Intergenic
914750461 1:150531640-150531662 CTGATTGTTACAGACATTATTGG - Intergenic
921430532 1:215060024-215060046 CAGGTTGTGACAGAAAGTAAAGG + Intronic
922313524 1:224419907-224419929 AGGGTTGTTATAAACATTAAAGG - Intronic
1081942192 11:46953141-46953163 CAGGTTGTTAGTGGCATTAAGGG + Intronic
1085634530 11:78148162-78148184 GCAGTTGTAACAGGCATTAAAGG - Intergenic
1090462034 11:126899770-126899792 CCAGTTGTTACAGAACTTCAGGG - Intronic
1092134864 12:6139913-6139935 CCAGTTGTTACAGCCTATAAAGG + Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1101207185 12:102500298-102500320 ATGGTGGTTACAGAGATTAAGGG + Intergenic
1101306964 12:103537971-103537993 CCAGTTTTTCCAGACACTAAAGG + Intergenic
1108093389 13:46875067-46875089 CCAGTTGCTACAGAAATCAAAGG - Intronic
1114827079 14:26094112-26094134 TGGTTTGTTACAGACCTTAAAGG + Intergenic
1120946593 14:90003483-90003505 CCGGTTGTTAGGGAAATTATTGG + Intronic
1126215969 15:46155593-46155615 CTGGTTCTTACAGAAATTGATGG + Intergenic
1126514244 15:49517253-49517275 CCAGTTGTTAATGAAATTAATGG + Intronic
1128055430 15:64695929-64695951 GTGGTAGTTAAAGACATTAAGGG + Intronic
1132044376 15:98550925-98550947 CCCGTTGTTACAGTTCTTAAAGG - Intergenic
1151267854 17:72970441-72970463 CCCTTTGTTTCAGACATAAAAGG - Intronic
927851420 2:26502299-26502321 CCGCTTGTTGGAGACATTAGTGG + Exonic
930538809 2:52679075-52679097 GAGTTTATTACAGACATTAACGG + Intergenic
931658456 2:64532533-64532555 TCATTTGTTACAGATATTAAAGG + Intronic
938208206 2:129441679-129441701 CAGGATGTTACAGACACTGAAGG + Intergenic
938913699 2:135912337-135912359 CCAGTGGTGACAGACATCAATGG + Intronic
940341627 2:152587677-152587699 CCAGATGTTAAAGACACTAATGG - Intronic
1168878567 20:1186825-1186847 CCCGTTGTTAGAGACTTCAAAGG + Intronic
1168920989 20:1536165-1536187 CTGGTTGTTACAGCCTTTTAGGG - Intronic
1171408495 20:24929854-24929876 CAGGGTGTTACAAACTTTAATGG - Intergenic
952326360 3:32323845-32323867 CAAGTTGTTGCAGAGATTAATGG + Intronic
954464738 3:50647791-50647813 CAGGCTGTCACTGACATTAAGGG + Intronic
957406230 3:79777189-79777211 TAGGGTGTTACAGACTTTAATGG - Intergenic
964683469 3:159367922-159367944 CAAGTTAATACAGACATTAAAGG - Intronic
967679507 3:192343899-192343921 GCATTTCTTACAGACATTAAAGG + Intronic
971727239 4:30329324-30329346 TCTGATGTTACAGACATGAAGGG + Intergenic
972656313 4:41066910-41066932 TCGGTTGTTACAATCATTCAGGG + Intronic
973812497 4:54585183-54585205 CCGGATTTTACAGACAAAAAAGG + Intergenic
973989101 4:56386364-56386386 ATGGTTGCTACAGACATTTAAGG + Intronic
975008513 4:69320945-69320967 CCAGTTGGTAAAGACATTGAGGG - Intronic
985258178 4:188090293-188090315 TAGGTTGTTAAAAACATTAAAGG + Intergenic
985712745 5:1439109-1439131 CCTGTTGTTACAGACAGACAGGG - Intronic
989398659 5:40985590-40985612 CCTGTTTTCTCAGACATTAATGG - Intergenic
993320426 5:86462988-86463010 CCGGGTGTTACAAACTTCAATGG - Intergenic
999887873 5:155943658-155943680 CTATTTGTTACTGACATTAAGGG - Intronic
1002821400 6:728546-728568 CAGGTTGTTGCCGACAGTAAAGG + Intergenic
1008010545 6:46462648-46462670 CTGGATGTTAGAGACATTACTGG + Intronic
1017971749 6:159317804-159317826 TCGGTTGACACAGACATTAAGGG + Intergenic
1023182592 7:37500002-37500024 CAGGTTGTTACAAAAATTAAGGG - Intergenic
1027365873 7:77457272-77457294 CCGGTTGGTTTAGACATAAAAGG + Intergenic
1033465902 7:141589266-141589288 AAGGTTGTTACAAAGATTAAAGG + Intronic
1036598308 8:10235070-10235092 CAGGGTTTTACAGACATTTATGG - Intronic
1044246500 8:89953133-89953155 CTGAGTGTTAAAGACATTAATGG + Intronic
1053872414 9:42506183-42506205 CTGGTTATTACAGAAATCAATGG - Intergenic
1193070172 X:77298213-77298235 CAGGGTGTTACAAACTTTAATGG - Intergenic
1200912108 Y:8539814-8539836 CAGGTTGTTACAAACTTCAATGG - Intergenic
1200925256 Y:8648594-8648616 CAGGTTGTTACAAACTTCAATGG - Intergenic