ID: 906310844

View in Genome Browser
Species Human (GRCh38)
Location 1:44753155-44753177
Sequence AATGGTATTTCAGCCACTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906310844_906310849 0 Left 906310844 1:44753155-44753177 CCTGCAGTGGCTGAAATACCATT 0: 1
1: 0
2: 0
3: 11
4: 156
Right 906310849 1:44753178-44753200 GAGGATGGTCAGCGAGGAGATGG 0: 1
1: 0
2: 5
3: 32
4: 368
906310844_906310847 -6 Left 906310844 1:44753155-44753177 CCTGCAGTGGCTGAAATACCATT 0: 1
1: 0
2: 0
3: 11
4: 156
Right 906310847 1:44753172-44753194 ACCATTGAGGATGGTCAGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 78
906310844_906310850 25 Left 906310844 1:44753155-44753177 CCTGCAGTGGCTGAAATACCATT 0: 1
1: 0
2: 0
3: 11
4: 156
Right 906310850 1:44753203-44753225 GAGCAAGTCCATTCCATCCGAGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906310844 Original CRISPR AATGGTATTTCAGCCACTGC AGG (reversed) Exonic
906310844 1:44753155-44753177 AATGGTATTTCAGCCACTGCAGG - Exonic
907047110 1:51306093-51306115 AGTCCTGTTTCAGCCACTGCTGG + Intronic
908863743 1:68521316-68521338 CATGGTCTTTGAGCCACTGTTGG + Intergenic
909434026 1:75619335-75619357 AATGATATTTCAGTCAATGATGG - Intergenic
909931310 1:81502892-81502914 ACTGGTATTGGTGCCACTGCTGG - Intronic
912781243 1:112550468-112550490 AATACTATTTTAGCCACTTCTGG - Intronic
915396862 1:155591366-155591388 AATGCTGTTTCAGAAACTGCAGG + Intergenic
915412402 1:155712187-155712209 AATGCTCTTTCAGAAACTGCAGG + Intronic
918132904 1:181644894-181644916 AATGTTATTCCTGCCCCTGCTGG - Intronic
918861551 1:189832748-189832770 AATGGAATTGCAGCCTCTCCAGG - Intergenic
924015195 1:239713683-239713705 ACTGTTATGTCAGCCACAGCTGG + Intronic
1063437512 10:6046441-6046463 AATGACATTTCAGGCACTGTGGG + Intronic
1064215507 10:13397031-13397053 AATGATAGTGCAGCCGCTGCGGG - Intergenic
1066068680 10:31782114-31782136 AACTGCATTTTAGCCACTGCTGG - Intergenic
1067343782 10:45423790-45423812 AATGGAATTCAAGGCACTGCAGG + Intronic
1071125342 10:82328319-82328341 AATGCTACTTCAGCCACTGAGGG - Intronic
1073791158 10:106941837-106941859 AATGGTATCACAGGGACTGCCGG + Intronic
1075823453 10:125333889-125333911 AAAGGTATTTCTGGCACTGTGGG + Intergenic
1078824509 11:14916051-14916073 AATATTATTGCAGCCACTACTGG - Intronic
1086504868 11:87494613-87494635 AATTGTTCCTCAGCCACTGCAGG - Intergenic
1088398060 11:109390532-109390554 AAGGGTATTTAACCCAGTGCTGG - Intergenic
1092897735 12:13029385-13029407 ATTGGCATTGCAGCCACTGGAGG + Intergenic
1095170706 12:39032536-39032558 AATGACATTTTAGCCACTGATGG + Intergenic
1096534733 12:52264085-52264107 AATGGTGTTACAGGCAGTGCTGG - Intronic
1097894875 12:64814966-64814988 AATGGTATGTCAGTCACTATAGG - Intronic
1100551396 12:95649613-95649635 ATAGGTATTTCAGGCACTGGTGG - Intergenic
1100615716 12:96230356-96230378 GACTGTATTTCAGACACTGCTGG + Intronic
1100908116 12:99325046-99325068 AATGATATTTCAGTCAATGATGG + Intronic
1101036269 12:100710304-100710326 AATGGTATTTCAACAGATGCTGG - Intergenic
1101463434 12:104921453-104921475 AATGTTATTTCACCCTCTTCTGG - Intronic
1103189405 12:118988296-118988318 AATGGTATTTGAGACCCTGCTGG - Intronic
1106556740 13:30816365-30816387 AATGGGACATCAGGCACTGCTGG - Intergenic
1106652543 13:31707314-31707336 ATTTGTCTTTCAGCCACTGGAGG - Intergenic
1108448808 13:50538854-50538876 AATGATATTTCAGCAAATGGAGG - Intronic
1110689347 13:78413656-78413678 AATGGTTTGTCAACCACTGGGGG + Intergenic
1110796146 13:79640660-79640682 AAGGGAATCTCATCCACTGCTGG - Intergenic
1111382406 13:87475329-87475351 AATGATATTTCAGTCAGTGGGGG - Intergenic
1111701860 13:91700053-91700075 TGTGATATTTCAGCCTCTGCTGG + Intronic
1111993994 13:95145197-95145219 AATGGAAATTCAGCCATTGTGGG + Intronic
1117181122 14:53192879-53192901 AAAGGTATTCCTGGCACTGCAGG - Intergenic
1117479075 14:56125347-56125369 AATGGAACTTCAGAGACTGCTGG + Intronic
1118468838 14:66056295-66056317 ATTGGTATTTGAACCACAGCTGG - Intergenic
1121241497 14:92433555-92433577 ACTGGAATTTCAAACACTGCTGG - Intronic
1121681600 14:95797291-95797313 AATGGAATTTCAGGATCTGCAGG - Intergenic
1122778263 14:104132573-104132595 AATGGAATGTCAGCCCCTGGAGG - Intergenic
1125841287 15:42803386-42803408 AATGATATTTCAGTCAATGATGG - Intronic
1128407447 15:67357530-67357552 AGTGCTATTTCAGCTGCTGCTGG + Intronic
1130316589 15:82801795-82801817 CATGGTATCTCAGCCTCAGCAGG - Intronic
1131477388 15:92751783-92751805 AATGCCATTTCAGTCCCTGCAGG - Intronic
1132105752 15:99061439-99061461 CATGGTACTTTACCCACTGCAGG + Intergenic
1133274195 16:4626740-4626762 AATGACATTTCAGCCACAGTGGG - Intronic
1135885992 16:26308517-26308539 AATGATATTTCAACAGCTGCAGG - Intergenic
1136973045 16:34989705-34989727 AATGGTGGGGCAGCCACTGCGGG - Intergenic
1140334136 16:74088114-74088136 GATGGCATTGCAGCAACTGCAGG + Intergenic
1142352070 16:89585119-89585141 AATGGGATTTCAGCGACGGCAGG + Intronic
1148140515 17:45324694-45324716 AATGGTTTTGGAGCCACTTCAGG - Intergenic
1149090286 17:52769853-52769875 GATGGTGATTCAGCCATTGCGGG + Intergenic
1151442767 17:74143738-74143760 AATGGAACTCCATCCACTGCTGG + Intergenic
1152804558 17:82348999-82349021 AATCGTATTTCAGGGACGGCTGG - Intergenic
1154376159 18:13811749-13811771 TCTTGTATTTCAGCCACTCCAGG + Intergenic
1156430546 18:37068882-37068904 GCTGGAATTACAGCCACTGCTGG + Intronic
1158617195 18:58999116-58999138 AATCCTATTTCTACCACTGCAGG - Intergenic
1161722983 19:5914014-5914036 CAGGGCATTTCAGCCCCTGCAGG + Intronic
1163060395 19:14756393-14756415 CATAGTATATCAACCACTGCAGG - Intronic
928881085 2:36097320-36097342 AATGGTACTTAAGTCACTGGAGG + Intergenic
931408764 2:62007486-62007508 AATGACATTTCAGTCACTGATGG + Intronic
934909367 2:98236822-98236844 AAATGTATTTTAGCCACTGGGGG + Intronic
935432183 2:102988150-102988172 AATGTTCTTCCAGCCACTGATGG - Intergenic
936997882 2:118434287-118434309 AATGACATTTTAGCCAATGCTGG + Intergenic
937747042 2:125426498-125426520 AATGGTATTTCAGTTTCTGGGGG + Intergenic
939216888 2:139250253-139250275 AATGGTATTTCTGGGACTACAGG - Intergenic
941588709 2:167391503-167391525 AATGCTTTTCCACCCACTGCTGG + Intergenic
942217954 2:173740801-173740823 ATGGTTATTTCAGCCACTGTTGG + Intergenic
944119164 2:196222267-196222289 CATTGTCTTTCATCCACTGCAGG + Exonic
945013944 2:205494540-205494562 AATGATGTTGGAGCCACTGCAGG - Intronic
945303072 2:208232387-208232409 AATGATATCTCAGACTCTGCAGG - Intergenic
948213487 2:236211952-236211974 AAAGGGATTCCAGCCACTGCAGG - Intronic
1170539739 20:17375628-17375650 CCTGGTATTTAAGCCATTGCAGG + Intronic
1170857503 20:20070697-20070719 AATGATATTGCAGCCACTTTGGG - Intronic
1171484911 20:25479545-25479567 AATGGTATTCCTTCCACTGAGGG - Intronic
1173084022 20:39898020-39898042 AATGGCATTTTTGCCACTCCTGG - Intergenic
1174082718 20:47982570-47982592 AATGGACTTTCAGACACGGCAGG - Intergenic
1175468263 20:59207790-59207812 GATGGTAATTCAGGCACTGCTGG - Intronic
1177311517 21:19400860-19400882 AATGGCATTTCAGTCAATGATGG - Intergenic
1179975786 21:44865227-44865249 AATGTTATTTTAGCCATTTCAGG - Intronic
1181448095 22:22994359-22994381 GATGGTATTTCAGCCATCTCAGG - Intergenic
949218692 3:1602517-1602539 AATGCTATTTCAGCATCTGTTGG + Intergenic
949737996 3:7196580-7196602 AATGGCCTTTCACCTACTGCTGG + Intronic
950459856 3:13114895-13114917 GGTGGCATTTCAGCCAGTGCGGG + Intergenic
952116848 3:30192587-30192609 AGTGGGATTTCATCCACTGTGGG - Intergenic
953373489 3:42409136-42409158 ACTGATATCTCAGCCACTGAGGG - Intronic
955339383 3:58113344-58113366 AATGGCATTTCAAACACAGCAGG - Intronic
956768490 3:72504810-72504832 GGTGGTATTTCAGACACTGTTGG + Intergenic
957838625 3:85635813-85635835 AATGATATTTCAGCCAATGATGG + Intronic
960869216 3:122232379-122232401 AGTGGTGTTTGAGCCACTGAAGG + Intronic
961514012 3:127421711-127421733 AATGGTTTTGCAGCCTGTGCAGG + Intergenic
961577313 3:127848406-127848428 TCTGGTATTGCAGCGACTGCAGG - Intergenic
961702518 3:128757354-128757376 GATGGCATTTGAGCCACTGATGG + Intronic
962006540 3:131355439-131355461 AAAGTCATCTCAGCCACTGCAGG + Intergenic
963974743 3:151468098-151468120 AATGCTATTTCAGTCCCTGCAGG - Intergenic
967358316 3:188599075-188599097 AATGGCATTTTATCCAGTGCTGG + Intronic
967797322 3:193611732-193611754 AATGCTGTTTCAGCCCCTGCAGG + Intronic
968017004 3:195344927-195344949 AATAGTATTTCAACCACTTTTGG + Intronic
972427569 4:38948469-38948491 AATGGTATTTCTGCTATTTCTGG + Intergenic
976807590 4:89065404-89065426 AATGCTGTTTCAGTCCCTGCAGG - Intronic
980565972 4:134541504-134541526 AATGGCATTTAATTCACTGCTGG - Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
983684690 4:170394488-170394510 AAATCTATTTCAGCCACTGCAGG + Intergenic
990868128 5:60402140-60402162 ATTGCTATTTCAGGCATTGCTGG - Intronic
991173075 5:63651516-63651538 CATGCTATTTCAGCCCCTACTGG + Intergenic
992872837 5:81023839-81023861 GATGGCATTTCAGTAACTGCTGG - Intronic
994807828 5:104474847-104474869 CAAGGTATTGCAGCAACTGCTGG - Intergenic
995552135 5:113292479-113292501 AATAGTTTTCCAGCCAATGCAGG + Intronic
997344231 5:133174580-133174602 AATGATGTTTCAGCCAATGATGG + Intergenic
1000133312 5:158320629-158320651 AAAGGTATTTTAAACACTGCTGG - Intergenic
1003826830 6:9962139-9962161 AATGCTACATCAACCACTGCTGG + Intronic
1004795226 6:19075225-19075247 AATGGTTCTGCAGCCTCTGCAGG - Intergenic
1004891273 6:20102786-20102808 AATGACATTTCAGCCAATGATGG + Intronic
1006047986 6:31315102-31315124 AATGGAATTTCAGCTTCTTCAGG + Intronic
1008411607 6:51187140-51187162 AATGATATTTCAGTCAATGATGG + Intergenic
1011516567 6:88161258-88161280 AATTGTATTTGAGCCCCAGCTGG - Intronic
1011986059 6:93447507-93447529 ACTACTATTTCAGCCACTACAGG + Intergenic
1012207502 6:96478916-96478938 ACTGGTATTCCAGGCACTACTGG + Intergenic
1014808830 6:125862563-125862585 AATGGCATTTTTGCCACTGTGGG + Intronic
1014946460 6:127504491-127504513 GATGCTATTTCTGCCACTACTGG + Intronic
1017322595 6:153111062-153111084 ACTGGCATTCCAGGCACTGCTGG - Intronic
1017600879 6:156079729-156079751 AATGATATTTCAGTCAATGATGG + Intergenic
1018649860 6:165984782-165984804 AGGGGTATTTCAGTAACTGCAGG - Intronic
1019949153 7:4357133-4357155 AATGGTGTTACAGCCTCTGTGGG - Intergenic
1022190464 7:28012679-28012701 AAGGGTATGTCAGCCACTTTGGG + Intronic
1022467148 7:30659602-30659624 GAAGGTTTTTCACCCACTGCTGG - Intronic
1023296575 7:38721262-38721284 GATGGCATTCCAGCCAATGCCGG + Intergenic
1023788909 7:43736585-43736607 CATTGTATATCAGCCACTCCAGG + Intergenic
1029802930 7:102968900-102968922 AATGATATTTCAGTCAATGATGG + Intronic
1030549282 7:110937795-110937817 AGTAGTATCTCAGCCTCTGCTGG + Intronic
1031603055 7:123736605-123736627 AATGGTGTTTCAGTCAGTGATGG - Intronic
1032621811 7:133541923-133541945 AATGGGACTTCAGCCTCTGCTGG - Intronic
1036275872 8:7351270-7351292 TCTGGTATTTCATACACTGCCGG + Intergenic
1036840811 8:12119843-12119865 TCTGGTATTTCATACACTGCCGG - Intergenic
1037513125 8:19603592-19603614 AATGTTACTTCAGCGCCTGCAGG + Intronic
1039130302 8:34256695-34256717 AATGGGATTTCAGCTGCTTCTGG - Intergenic
1039835510 8:41253374-41253396 ATTGGTATGTCAGCCACTGATGG + Intergenic
1040595822 8:48836565-48836587 AATAGTATTCAAGCCACTGTAGG + Intergenic
1041425452 8:57715630-57715652 AATGTTATTTAAGCCAATGGAGG - Intergenic
1042884155 8:73529611-73529633 AATGGTATCTGAGTCACTGATGG - Intronic
1044739316 8:95309614-95309636 TATCCTATATCAGCCACTGCTGG - Intergenic
1045531597 8:102990188-102990210 AATGCCATTTCAGTCTCTGCAGG + Intergenic
1049957645 9:708147-708169 AATGGAATTTCAGACAGTCCTGG + Intronic
1049957651 9:708204-708226 AATGGAATTTCAGACAGTCCTGG + Intronic
1049957657 9:708261-708283 AATGGAATTTCAGACAGTACTGG + Intronic
1050122033 9:2317483-2317505 AATAGTAGCTCAGCCACAGCAGG - Intergenic
1055479973 9:76699954-76699976 ACTGGTATTTGATCCCCTGCTGG + Intronic
1057867283 9:98691589-98691611 AATGTGCTTTCAGACACTGCGGG + Intronic
1060788797 9:126471424-126471446 AGTGATTTATCAGCCACTGCCGG - Intronic
1062123156 9:134845076-134845098 AAGTGAGTTTCAGCCACTGCTGG + Intergenic
1186969141 X:14821231-14821253 AATAGTATTTTAGCCATTGTAGG - Intergenic
1191200196 X:57772497-57772519 AATGCCATTTCAGTCCCTGCAGG - Intergenic
1191633827 X:63354388-63354410 ACTGATATTTCATCCACTGTTGG + Intergenic
1193394696 X:80969590-80969612 AATGCCATTTCAGTCCCTGCAGG + Intergenic
1193509871 X:82385690-82385712 AATGTTATTTTATCCACTGAAGG + Intergenic
1193808377 X:86021241-86021263 AATGCTGTTTCTGCCACTACAGG - Intronic
1194202684 X:90974130-90974152 AACAGTATTTCAGCCAATGATGG + Intergenic
1194358960 X:92923601-92923623 AATGCTTTTTCAGCCACAGTTGG - Intergenic
1194779496 X:98007089-98007111 AATGGTATTTCAGATATAGCAGG + Intergenic
1195712625 X:107786127-107786149 AATTGTCTTTCAGCCACCTCTGG + Intronic
1196110609 X:111943219-111943241 TATGGTCTTTCTACCACTGCAGG + Intronic
1200548521 Y:4549590-4549612 AACAGTATTTCAGCCAATGATGG + Intergenic
1200667175 Y:6039606-6039628 AATGCTTTTTCAGCCACAGTTGG - Intergenic