ID: 906311505

View in Genome Browser
Species Human (GRCh38)
Location 1:44757767-44757789
Sequence GCCTTGCCATGTCAGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906311501_906311505 -9 Left 906311501 1:44757753-44757775 CCCATCACCAGATAGCCTTGCCA 0: 1
1: 0
2: 0
3: 4
4: 101
Right 906311505 1:44757767-44757789 GCCTTGCCATGTCAGATGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 124
906311500_906311505 -8 Left 906311500 1:44757752-44757774 CCCCATCACCAGATAGCCTTGCC 0: 1
1: 0
2: 0
3: 5
4: 120
Right 906311505 1:44757767-44757789 GCCTTGCCATGTCAGATGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 124
906311498_906311505 7 Left 906311498 1:44757737-44757759 CCCTTGTTACAGATGCCCCATCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 906311505 1:44757767-44757789 GCCTTGCCATGTCAGATGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 124
906311502_906311505 -10 Left 906311502 1:44757754-44757776 CCATCACCAGATAGCCTTGCCAT 0: 1
1: 0
2: 2
3: 14
4: 187
Right 906311505 1:44757767-44757789 GCCTTGCCATGTCAGATGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 124
906311499_906311505 6 Left 906311499 1:44757738-44757760 CCTTGTTACAGATGCCCCATCAC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 906311505 1:44757767-44757789 GCCTTGCCATGTCAGATGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 124
906311497_906311505 8 Left 906311497 1:44757736-44757758 CCCCTTGTTACAGATGCCCCATC 0: 1
1: 0
2: 0
3: 14
4: 111
Right 906311505 1:44757767-44757789 GCCTTGCCATGTCAGATGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906311505 Original CRISPR GCCTTGCCATGTCAGATGCA GGG Intronic
900176066 1:1291937-1291959 GCCTAGCCACCTCAGCTGCAGGG + Exonic
902880518 1:19369193-19369215 GCCTTGGGATGCCAGATGAAAGG + Intronic
906311505 1:44757767-44757789 GCCTTGCCATGTCAGATGCAGGG + Intronic
909170318 1:72285044-72285066 GACTTGACATGTCACATACATGG + Intergenic
910342866 1:86208020-86208042 GCCTTGCCATGTAAGGATCATGG - Intergenic
913065243 1:115246601-115246623 GACTTGCCATGACAGATGGTAGG - Intergenic
914702685 1:150149465-150149487 GCCTGGGCAGGTCAGATGCTGGG - Intronic
919863837 1:201763675-201763697 GCTTTGCCATGTCAGCTGGCAGG - Intronic
1065424447 10:25585202-25585224 GCCCTGCAATGTTAGATGGAGGG + Intronic
1067956147 10:50793913-50793935 CCCTTGCCATGTTTGAGGCATGG + Intronic
1068929633 10:62576192-62576214 ACCTTGCCATGGTAGAGGCATGG + Intronic
1070434126 10:76371947-76371969 ACCTTGCCTTGTTAGAGGCAAGG - Intronic
1072624976 10:97105452-97105474 TCCTTGCCAAGTCAGTGGCAGGG + Intronic
1074352488 10:112751369-112751391 GCCTGGCCATGCCAGATGTGAGG - Intronic
1077305654 11:1867643-1867665 GTCCTGCCATGTCAGGTGCAGGG + Intronic
1081523027 11:43901216-43901238 TCCTTTCCATGTCAAATACATGG - Intronic
1082193750 11:49277049-49277071 GTCTTGCCATGTCAAAGGCAAGG + Intergenic
1086672393 11:89564010-89564032 GCCTTGCCATGTCAAAGGCAAGG - Intergenic
1090381752 11:126332256-126332278 GTCTGGCCAGGCCAGATGCAAGG + Intronic
1091222131 11:133935903-133935925 GCCTTGGCATGTGAGACACACGG + Intronic
1094852422 12:34388224-34388246 GCCTCCCCATGCCACATGCATGG - Intergenic
1099079892 12:78164193-78164215 GCCTTGGCATGACAGCTACAGGG - Intronic
1103614911 12:122145843-122145865 GCCTTCCCACGTCAGAGCCAGGG - Exonic
1104070088 12:125337061-125337083 TCCATGCCATGCCAGATGCAGGG - Intronic
1105439094 13:20401173-20401195 TCCTTGTCATGTCATATGGAGGG - Intergenic
1107175557 13:37394738-37394760 GCCCTGCCCTGTGAGAAGCAGGG - Intergenic
1108337128 13:49455584-49455606 GGTTTGCCATGGCAGATACAAGG + Intronic
1113055908 13:106267489-106267511 GCTTTGCCATTTCTTATGCATGG - Intergenic
1113514822 13:110886106-110886128 GCCTGGCCATGCGAGGTGCAGGG + Intronic
1114700137 14:24668700-24668722 TCCTTGCCAGCTCAAATGCATGG + Intergenic
1116286952 14:42986036-42986058 GGATTGCCATGTCAGAGGAAAGG + Intergenic
1119463117 14:74828532-74828554 GCCTAGCCCTCTCAGATTCAGGG + Intronic
1123009001 14:105338241-105338263 GCATTTCCATGTCAGCTGGAAGG - Intronic
1123803696 15:23850201-23850223 GCCTTGTCAGTTCAGATCCAGGG + Intergenic
1127538432 15:59913228-59913250 GCCTTACCTGCTCAGATGCATGG - Intergenic
1128560952 15:68667360-68667382 TCCTTGCCATGTTTGAGGCAGGG + Intronic
1130403694 15:83579936-83579958 GCATTGGCATGTCAGGTCCAAGG - Intronic
1131886966 15:96926463-96926485 GCCTTGGCAAGACACATGCAGGG + Intergenic
1132235747 15:100219753-100219775 GCATTCCCAGGTCAGATGAAGGG - Intronic
1133290158 16:4715189-4715211 GCCTTGGCCTGTCAAATGCTGGG - Intronic
1138455071 16:57116398-57116420 GCCTTCCCAGGCCAGGTGCATGG + Intronic
1139029388 16:62860606-62860628 AACATGCCATGTCAGATGTATGG - Intergenic
1139330304 16:66183493-66183515 GCCTTGCCTTGCCTGAGGCAGGG - Intergenic
1140822431 16:78675467-78675489 GCCTTGCCATGTTCCAGGCACGG + Intronic
1142727445 17:1826573-1826595 GCCTTGCCAGTTCAGATACTCGG - Intronic
1146393256 17:32442360-32442382 ACCTTGCCATGTCAAACACAGGG + Intergenic
1150376262 17:64684303-64684325 GCCCTGCCATGGGAGACGCATGG + Intergenic
1153152872 18:2114561-2114583 GCTTTGCCATGTAGGATGAACGG - Intergenic
1157579441 18:48764875-48764897 GCCTTCCCATGGCAGCTGAAAGG - Intronic
1159517271 18:69473650-69473672 TCCTTGCTAGGTCATATGCAGGG + Intronic
1160462045 18:79046715-79046737 GCCTTGCCCTGTGAGCTGGAGGG + Intergenic
1161790657 19:6357966-6357988 GCCATCCCACGTCAGAGGCAGGG + Intergenic
1164015710 19:21254474-21254496 GCCTTGCAATATCATAGGCAGGG - Intronic
1165059211 19:33196602-33196624 GCCTTGCCCTGTAAGAGGAAGGG + Intronic
1167605262 19:50478600-50478622 ACCTGGCCATGTCAGAATCAGGG - Intronic
925218310 2:2116544-2116566 GCCATGCCTTGTGATATGCACGG + Intronic
928815776 2:35292959-35292981 GACCTGCCTTGTCAGGTGCATGG - Intergenic
931122305 2:59233533-59233555 GCCCAGCCATGTGACATGCATGG + Intergenic
932049421 2:68383907-68383929 GCCCTGCCTTGTCTGATGCTGGG - Intronic
932814937 2:74853928-74853950 GACTGGCCATGTCAGGTGCTGGG + Intronic
934161446 2:89253319-89253341 GCATTGCCATGTCTGCTGCTGGG + Intergenic
934205833 2:89929096-89929118 GCATTGCCATGTCTGCTGCTGGG - Intergenic
936158908 2:110069627-110069649 TTCTGGCCATGTCACATGCAGGG + Intergenic
936185752 2:110301705-110301727 TTCTGGCCATGTCACATGCAGGG - Intergenic
938131045 2:128715784-128715806 GCCTTGCCACGTCCCATCCAAGG + Intergenic
941162394 2:162050687-162050709 GCCTTGCCATTTGATAAGCAGGG + Intronic
941258326 2:163262886-163262908 GACTTACCAAGTCATATGCAGGG + Intergenic
942737893 2:179137268-179137290 GCCTAGCCATGCAAGAAGCATGG - Intronic
944641239 2:201727967-201727989 GCCTTGCCATCTCTGCTGCAGGG + Intronic
1168745703 20:237944-237966 GGCTTGCCAAATCAGATTCAGGG - Intergenic
1169037811 20:2468012-2468034 TCCTTGTCGTGTCAGTTGCAGGG + Intronic
1169668843 20:8071958-8071980 GTCTTGCCATGTCAGAAGATTGG + Intergenic
1170628774 20:18050322-18050344 ACTTTGCCATGGCAGATGCAGGG + Intronic
1173106016 20:40134490-40134512 TCCTTGCCATCTCTGATGCAGGG + Intergenic
1174093634 20:48069890-48069912 GCCCTTACATGTCAGATGCTTGG - Intergenic
1175700578 20:61133914-61133936 GCCTAGCAATTTCAGGTGCAGGG - Intergenic
1180057151 21:45364886-45364908 GACTTGCCCTGTCTGATGAATGG + Intergenic
1181510522 22:23386860-23386882 GCCTTCCCATGTCAGAGGTGAGG - Intergenic
1182101770 22:27662754-27662776 GCCTTGCTTTGGCAGATGCCTGG + Intergenic
1182283620 22:29231745-29231767 TCCTGGCCATGTCAGGAGCAGGG - Intronic
1182402261 22:30087865-30087887 GCCTGGCCATGCCAGCTGCTAGG + Intronic
1182995805 22:34811037-34811059 TCCTTGCTCTGTCAGCTGCAAGG + Intergenic
949660700 3:6275240-6275262 CCCATGCCATGCCAGATGCTTGG - Intergenic
953393215 3:42545762-42545784 ACCTTGTCATGTCAACTGCAGGG + Intergenic
956276958 3:67512396-67512418 ACCTTGCAATGTGAGTTGCATGG + Intronic
958723516 3:97875741-97875763 CTCTTGCAATGTCAGATGTAGGG + Exonic
962337474 3:134548294-134548316 TCCTTGCCACCTCAGAAGCAGGG + Intronic
966507748 3:180726178-180726200 GCCTTGGCCTCTCAGATGCTAGG - Intronic
967887104 3:194340956-194340978 GCCTTGGCTTTTCACATGCAAGG - Exonic
969171662 4:5368850-5368872 TCCTTGCCATGCCAGATGCTGGG + Intronic
971820044 4:31539933-31539955 TCCTTCCCATGTTAGATCCAAGG + Intergenic
983529842 4:168798228-168798250 GCCTTGCCATATCAAAGGTAAGG + Intronic
987525531 5:19045085-19045107 GACTTGCCTTGTCAAGTGCATGG + Intergenic
989604625 5:43232233-43232255 GCCTTGCCATGGTAAATACATGG - Intronic
991006411 5:61832504-61832526 AGCTAGCCAGGTCAGATGCAGGG + Intergenic
1000458338 5:161481112-161481134 GCCTTGCCAAGTGTGATACATGG + Intronic
1001130756 5:169061617-169061639 GCCATGCCCAGTTAGATGCAGGG + Intronic
1003276748 6:4660506-4660528 GCCTGGCCATGGGAGCTGCATGG - Intergenic
1007587812 6:43002625-43002647 GCCTTGCCATGTCTAATACACGG + Intronic
1011788054 6:90868303-90868325 CCCTTGCCATCTGAGATGGAGGG + Intergenic
1018908245 6:168087635-168087657 GCGCTGGCATGTGAGATGCACGG + Intergenic
1019178769 6:170174804-170174826 GCCTGGCCCTGCCAGATGCCTGG - Intergenic
1019452142 7:1104573-1104595 GCCTTTCCACGTAAGCTGCATGG - Intronic
1019559885 7:1650771-1650793 GCCTTCCCATGGGAGACGCAGGG + Intergenic
1019732390 7:2635150-2635172 GCCCTGCCAGCTCAGCTGCAGGG - Intronic
1019749518 7:2720077-2720099 TCCTTGCCTTCTCAAATGCAAGG - Intronic
1020549513 7:9584684-9584706 GCCTTGCCTTGTAAAATGAAGGG + Intergenic
1022252668 7:28624301-28624323 GCCTATCTATGTCAGAAGCAGGG + Intronic
1022399791 7:30026384-30026406 GTCTTGCGATGGCAGATGAATGG + Exonic
1022909299 7:34884398-34884420 GCCAAGCCATATCAGATGGATGG + Intergenic
1026467011 7:70662761-70662783 TCCTTGCCTTGTCAGCAGCAGGG + Intronic
1028267696 7:88748017-88748039 CCCTTCCCATGTCATATTCAAGG - Intergenic
1029031134 7:97468309-97468331 TCTTTGTCATCTCAGATGCAGGG + Intergenic
1033452975 7:141478057-141478079 GGCTTGCAGTGTCAGAAGCAGGG + Exonic
1034689722 7:153004557-153004579 GCCTTGCGGTGTGAGATGGAGGG - Intergenic
1040860232 8:51991238-51991260 GTCTTGCCATGTGACATGCCAGG + Intergenic
1042809690 8:72810528-72810550 GACTTGCCATATCTGATGGATGG - Intronic
1044391328 8:91655473-91655495 ACCTGGCCTTGTCAGAAGCAAGG + Intergenic
1045696916 8:104819539-104819561 GCCTGGCCCTGTCAGATGGCTGG - Intronic
1046988044 8:120412767-120412789 GCATTGGCATGTCAGCTTCAAGG - Intronic
1046996452 8:120529472-120529494 ACATTGCCAGCTCAGATGCAAGG - Intronic
1048016190 8:130499758-130499780 TCCTTGCCAGGTGAGCTGCAGGG + Intergenic
1048170600 8:132102619-132102641 GCCTTGGCAGGTCACAAGCAAGG - Intronic
1049019656 8:139947103-139947125 GACTTGCCAGGTGAGTTGCATGG - Intronic
1049366190 8:142238004-142238026 GCCTCCCTAAGTCAGATGCATGG - Intronic
1050640394 9:7661345-7661367 GCCTTGCCATGGCATATCCCAGG + Intergenic
1055219087 9:73906495-73906517 ATATTGCCATGTCAGATACAAGG - Intergenic
1059680796 9:116583732-116583754 TCCTTGCCATTTCAGACTCAAGG - Intronic
1186209396 X:7233729-7233751 GTCTTCCTATGTCAGATGCCCGG + Intronic
1188849173 X:35110836-35110858 GCCTGGCCATGTCACAGACAAGG - Intergenic
1188900104 X:35721765-35721787 GCCTTGCCAAATCAAATGAAAGG + Intergenic
1196191956 X:112804170-112804192 GCCTTCCCTTGACAAATGCAAGG - Intronic
1201773954 Y:17644591-17644613 GTCATCCCAAGTCAGATGCACGG + Intergenic
1201827603 Y:18261398-18261420 GTCATCCCAAGTCAGATGCACGG - Intergenic