ID: 906315890

View in Genome Browser
Species Human (GRCh38)
Location 1:44786278-44786300
Sequence GAGGCTGCTGTTCCGCCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906315879_906315890 27 Left 906315879 1:44786228-44786250 CCTGAGGGGGTAAAGCAGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 172
Right 906315890 1:44786278-44786300 GAGGCTGCTGTTCCGCCGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 85
906315887_906315890 -8 Left 906315887 1:44786263-44786285 CCTCTGCCGCCAGGGGAGGCTGC 0: 1
1: 0
2: 3
3: 37
4: 378
Right 906315890 1:44786278-44786300 GAGGCTGCTGTTCCGCCGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 85
906315886_906315890 -7 Left 906315886 1:44786262-44786284 CCCTCTGCCGCCAGGGGAGGCTG 0: 1
1: 0
2: 2
3: 28
4: 314
Right 906315890 1:44786278-44786300 GAGGCTGCTGTTCCGCCGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906315890 Original CRISPR GAGGCTGCTGTTCCGCCGTC TGG Intronic
900380998 1:2383863-2383885 GAGGCTGCTGGTCCACAGTGTGG - Intronic
900630451 1:3632401-3632423 GAGGCTGCTGTGCCTGCATCGGG + Intronic
902360029 1:15937321-15937343 GAGGCTGCTCTACTCCCGTCTGG - Exonic
905632721 1:39527558-39527580 GGGGCTGCTGTCCCGCAGTGTGG - Intergenic
905665095 1:39758859-39758881 GGGGCTGCTGTCCCGCAGTGTGG + Exonic
906315890 1:44786278-44786300 GAGGCTGCTGTTCCGCCGTCTGG + Intronic
907458665 1:54592484-54592506 GAGGCCCCTGTTCCTCCCTCTGG + Intronic
915588688 1:156858967-156858989 CAGCCTGCTGCTCCGCCCTCAGG - Exonic
919956039 1:202417173-202417195 GAGGTGGCTGTTCCACTGTCTGG + Intronic
1063188176 10:3668896-3668918 GAGGCTGCACTTCAGCCGGCGGG + Intergenic
1066708100 10:38202964-38202986 GAGACTGCTATTCAGCCATCAGG - Intergenic
1066981405 10:42419617-42419639 GAGACTGCTATTCAGCCATCAGG + Intergenic
1067055326 10:43046513-43046535 GAGGCTGCTGCTGGGCCCTCAGG - Intergenic
1069566089 10:69464427-69464449 GAGGCTTCTGTCCCGTCCTCAGG + Intronic
1072669550 10:97419391-97419413 GCGGCTGCTGTTCAGCCCACAGG - Intronic
1077917932 11:6623025-6623047 GAGGTGGCTGTTCCGCTGCCTGG + Exonic
1079129811 11:17740901-17740923 GAGGCTTCTGTTCCTCCCTTGGG + Intronic
1082279998 11:50261469-50261491 GAGGTCGCTGTTCTGCCTTCTGG + Intergenic
1082928993 11:58579511-58579533 GGGGCTGCTCCTCCGCCGGCGGG - Exonic
1083551461 11:63593289-63593311 GAGGCTGCTGTTGCTCAGGCTGG + Intronic
1086062337 11:82712643-82712665 TAGGCTGCTGTTCCTCGGGCTGG + Intergenic
1087336167 11:96847644-96847666 GAGGCTGCTGTTCTTCAGCCTGG + Intergenic
1088687866 11:112299776-112299798 GAGGCTGCCTTTCAGCCCTCTGG - Intergenic
1088739524 11:112755803-112755825 GAGTCTGTTGTACCGCAGTCTGG - Intergenic
1089562037 11:119348175-119348197 GAGGTTGCTGTGCCGGGGTCTGG + Intergenic
1090872866 11:130763384-130763406 GAAGATGCTGACCCGCCGTCTGG + Intergenic
1100186541 12:92145587-92145609 GGGGTGGCTGCTCCGCCGTCGGG - Exonic
1104989748 12:132618872-132618894 GGGGCTGCTGGTCCGCCCTCTGG + Exonic
1118757544 14:68855783-68855805 GAGACTGCTGTTCTGCCCCCGGG + Intergenic
1120967836 14:90183368-90183390 GAGGCTGCTGTTTCTCTGCCTGG + Intronic
1121341217 14:93106273-93106295 GAGGCTGCAGTTATGCCCTCGGG - Intronic
1132903098 16:2268817-2268839 GCGCCTGCTGTTCCCCCGCCGGG - Intergenic
1136153077 16:28364894-28364916 GAGGTTGCTGTGGCGCCGTCTGG - Intergenic
1136210006 16:28750379-28750401 GAGGTTGCTGTGGCGCCGTCTGG + Intergenic
1136483766 16:30558196-30558218 GAGGCAGCCGATCCGTCGTCGGG - Exonic
1141413723 16:83854129-83854151 GAGGTTGCTGTGTGGCCGTCAGG + Intergenic
1141611461 16:85183455-85183477 GAGGCTGGTGTTCCACAGCCAGG + Intronic
1143709905 17:8726982-8727004 GAGGCTGCAGTCCTGCCGGCTGG - Intergenic
1151655932 17:75496032-75496054 GAGGCAGCTGTTCCGCAGGTTGG - Exonic
1154356298 18:13625036-13625058 GAGGGTGCTGAGCCGCCGCCAGG - Intronic
1160074075 18:75655349-75655371 GAAGCTGCTCATCAGCCGTCAGG + Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1162021331 19:7869804-7869826 GAGGCTGCGGCACCGCCCTCGGG + Exonic
1163103190 19:15109595-15109617 GAGGCTGGTGTTCCCCTGGCGGG - Intronic
1163595904 19:18220919-18220941 GAGGCTGCTGTACCGCAGGCAGG - Exonic
1167840229 19:52110817-52110839 AAGACTGCTGCTCCGCAGTCTGG + Intergenic
925110332 2:1330087-1330109 TACACTGCTGTTCCGCCATCAGG + Intronic
926880303 2:17538158-17538180 GAGCCCGCTGTTCCTCCTTCAGG - Intergenic
927458506 2:23277656-23277678 GAGGCTGCTGTTCCCTCATTGGG - Intergenic
938211077 2:129466116-129466138 GGGGCTGCTCTCCTGCCGTCTGG + Intergenic
942681453 2:178480972-178480994 GGGGCTCCTCTTCCTCCGTCTGG + Intronic
947360884 2:229344182-229344204 AAGGCTTCTGTTCCTCTGTCAGG - Intergenic
947988830 2:234471295-234471317 GAGGCTCCTGTTCCTCTGCCAGG + Intergenic
949019968 2:241735325-241735347 GAGGCTGCTGCTCCGCCCCGGGG + Exonic
1168751510 20:285137-285159 GTGGCTGCTGTGCCTTCGTCTGG - Intronic
1169471417 20:5888857-5888879 GACGCTGCTTATCCACCGTCTGG + Intergenic
1176017119 20:62939955-62939977 GAGGCAGCTGTTCCGGCTTTGGG - Intronic
1178390254 21:32192295-32192317 GGGGCTGCAGTTCTGCAGTCGGG - Intergenic
1179009675 21:37546612-37546634 GAGGCTGAGGTTCCGGGGTCCGG + Intergenic
1180100246 21:45580578-45580600 GAGGCAGCTGTGTCTCCGTCAGG - Intergenic
949188440 3:1221334-1221356 GAGGCTGCAGTTCCGCATTGAGG - Intronic
961379406 3:126487433-126487455 GAGGCTGCAGTTCCGCACTGCGG - Intronic
968227896 3:196987159-196987181 GAGGCTGCTGGTCAGCCCTGGGG + Intergenic
970451251 4:16168487-16168509 GTGCCTGCTGTTCCTCCATCAGG + Intronic
976161153 4:82201067-82201089 GAGGGTTCTGTTCTGCCATCTGG - Intergenic
978441641 4:108739846-108739868 AAGGCTGCTGTTCCACAGTAGGG + Intergenic
985961636 5:3307176-3307198 GAGGCATCTGTTCCGATGTCTGG + Intergenic
986171771 5:5320201-5320223 GCGGCTGCTGTTCTCCTGTCCGG + Exonic
987383388 5:17306822-17306844 GAGGCCGCTGTTCCTGCGGCGGG + Intergenic
991720870 5:69493335-69493357 GAGGCGGCTGTTCGGCGGCCCGG + Intronic
999366009 5:151023900-151023922 GAGGCTGCGCTTCCTCCGCCAGG - Intronic
1001235442 5:170025533-170025555 GAGTCTGCTGTGCGGCTGTCTGG - Intronic
1004504709 6:16238596-16238618 GGGGCTGCTGTGCCGCGGCCGGG - Exonic
1006151633 6:31993055-31993077 AAGGCTGCAGTCCAGCCGTCAGG - Intronic
1006157934 6:32025793-32025815 AAGGCTGCAGTCCAGCCGTCAGG - Intronic
1019782890 7:2954708-2954730 GAGGATGCTGTTCCTCCCACCGG - Intronic
1023038810 7:36154675-36154697 GAGGCTGCTGCTCCGCTAGCAGG - Exonic
1026982675 7:74535959-74535981 AGGGCTGCTGTTCCTCCTTCTGG + Intronic
1029544672 7:101204096-101204118 GAGGCTGCTGATCAGCCCTGGGG + Intergenic
1034132910 7:148737480-148737502 GAGCCTGCTGTTCTGCCATTTGG + Intronic
1036782766 8:11660858-11660880 GAGGCTGTTGTTCCTGCATCAGG - Intergenic
1043543728 8:81292348-81292370 GAGGCTCCTTTTCTGCCTTCAGG - Intergenic
1049745106 8:144260006-144260028 GAGGCTGGTGCTCCGCGGCCTGG + Exonic
1055775226 9:79760486-79760508 TAGGCTGCTGTTCCATCATCAGG - Intergenic
1056335483 9:85564204-85564226 GGGGCTGCCGTTCCACCTTCTGG - Intronic
1058606546 9:106729470-106729492 GAGGCTGCTTTTCCCCAGTTAGG - Intergenic
1058966959 9:110047939-110047961 GAGGCAGCTGATCCGCAGACTGG - Intronic
1059145500 9:111896496-111896518 GAGGCTGCTCTCTCTCCGTCTGG - Intergenic
1194865538 X:99061370-99061392 GATTCTGCTGTTCTGCTGTCAGG + Intergenic
1202578565 Y:26354010-26354032 GAGGTGGCTGTTCCACTGTCTGG - Intergenic