ID: 906315963

View in Genome Browser
Species Human (GRCh38)
Location 1:44786568-44786590
Sequence GGCGCAGCAGGCGGCCCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 310}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906315957_906315963 4 Left 906315957 1:44786541-44786563 CCAGGTTCGCGTAGCGGATGAGG 0: 1
1: 0
2: 1
3: 1
4: 16
Right 906315963 1:44786568-44786590 GGCGCAGCAGGCGGCCCCGCTGG 0: 1
1: 0
2: 1
3: 31
4: 310
906315953_906315963 28 Left 906315953 1:44786517-44786539 CCGAGCGCAGCACCAGCACGGAC 0: 1
1: 0
2: 1
3: 16
4: 137
Right 906315963 1:44786568-44786590 GGCGCAGCAGGCGGCCCCGCTGG 0: 1
1: 0
2: 1
3: 31
4: 310
906315955_906315963 16 Left 906315955 1:44786529-44786551 CCAGCACGGACGCCAGGTTCGCG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 906315963 1:44786568-44786590 GGCGCAGCAGGCGGCCCCGCTGG 0: 1
1: 0
2: 1
3: 31
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906315963 Original CRISPR GGCGCAGCAGGCGGCCCCGC TGG Exonic
900170104 1:1263127-1263149 GACGCTACAGGCGGCCCTGCAGG + Intronic
900255066 1:1693563-1693585 GGGGCCGCAGGCGCGCCCGCGGG - Intronic
900263809 1:1746829-1746851 GGGGCCGCAGGCGCGCCCGCGGG - Intergenic
900287557 1:1908889-1908911 GGCGCCGGCTGCGGCCCCGCAGG - Intergenic
900325105 1:2104759-2104781 GGGGCAGCAGTGAGCCCCGCAGG - Intronic
900420375 1:2553561-2553583 GGCGGAGCAGGCGGCGGTGCAGG - Intergenic
900424051 1:2568097-2568119 GGCGGAGCAGGCGGCGGTGCAGG + Intergenic
901012451 1:6209422-6209444 GGCCCTGCAGACGGCCACGCGGG + Exonic
901050791 1:6424970-6424992 GGCGCTGCAGGCGGCGCGGCAGG + Exonic
901414193 1:9105623-9105645 GGCGCAGCAGGCGGTGCTCCTGG + Exonic
902566447 1:17314715-17314737 GGAGCAGCAGGCAGCCTCGAAGG - Intronic
902876271 1:19342666-19342688 GGAGCAGCAGCCGGACCGGCAGG + Intronic
903413776 1:23168115-23168137 GCCGCAGCTGTCGGCCGCGCCGG - Intronic
904181434 1:28669089-28669111 AGCGCAGCCGGCCGCGCCGCCGG + Intronic
904211212 1:28887738-28887760 GGCACAGCCGGCGCCCCAGCTGG - Intronic
905207512 1:36351334-36351356 GGAGCAGTAGGCGGACCAGCTGG - Intronic
905441937 1:38001305-38001327 GGGGCAGCAGGGGGCCACACAGG + Intronic
906286067 1:44588686-44588708 GGCCCAGCAGTCGGCCCAGCTGG - Intronic
906295291 1:44645730-44645752 GCCGCAGCAGGCGGGCAGGCAGG - Intronic
906315963 1:44786568-44786590 GGCGCAGCAGGCGGCCCCGCTGG + Exonic
906365414 1:45205959-45205981 GGCGCTGCTGGCGGCGCCGCGGG - Exonic
909340455 1:74525778-74525800 GGAGCAGCAGTTGGCCCAGCAGG + Intronic
909931100 1:81501642-81501664 GGCGGAGGAGGCGGCCGCTCAGG - Intronic
912568791 1:110607149-110607171 TGCGCTGCAGGCTGCGCCGCCGG + Intronic
912879194 1:113391188-113391210 GACGCAGCAGGTGCCCCCGCCGG - Exonic
919781967 1:201226952-201226974 GGGGCAGCAGGTGGGACCGCAGG - Exonic
920150214 1:203900327-203900349 GGAGCGGCCGGCCGCCCCGCCGG + Intergenic
921206998 1:212858016-212858038 TGGGCGGGAGGCGGCCCCGCGGG - Intergenic
921909189 1:220528670-220528692 GGTGCAACAAGCGGCCCCGGCGG - Exonic
922218466 1:223539753-223539775 GGCTCAGCAGGAGACCCTGCAGG + Intronic
922781566 1:228256841-228256863 GGTGCAGCAGGCGGGCCAGGCGG + Exonic
923119670 1:230978623-230978645 GCAGCAGCAGGAGGCCCCGGCGG - Exonic
923318635 1:232805998-232806020 GGCTCAGCAGGCGGCTTCCCAGG - Exonic
923490369 1:234478743-234478765 TCCGCAGCTGGCGGCCGCGCTGG - Exonic
1063961269 10:11307258-11307280 GGCGCAGCAGGCAGCATCTCTGG + Intronic
1067112066 10:43408168-43408190 GGCGCAGTGGGAGGCCCAGCCGG - Intronic
1067684186 10:48457295-48457317 GGTGAAGCAGGCGGCCCGGCTGG - Intronic
1067893111 10:50152861-50152883 GCCGCAGCTGGCGGCCCATCGGG - Intergenic
1069962485 10:72087220-72087242 GTCGCAGGCGGCGGCCCGGCGGG - Intronic
1070923889 10:80205503-80205525 GGCGCAGCAGCCGTCAGCGCCGG + Exonic
1072673911 10:97451684-97451706 GGCCCAGCAGCAGGCTCCGCTGG - Exonic
1072804802 10:98417605-98417627 GGTGCAGCAGGCCGGCCAGCTGG - Exonic
1072891799 10:99330509-99330531 AGTCCAGCAGGCGGCCCAGCGGG - Exonic
1074015340 10:109528721-109528743 GGTCCAGCAGGAGGCCCAGCAGG + Intergenic
1074065467 10:110008561-110008583 GGCCCACCCGGCGGCGCCGCAGG - Intronic
1074771479 10:116737714-116737736 GGAGCAGCTGCCAGCCCCGCAGG + Intronic
1076095852 10:127734999-127735021 GGAGCTGCAGCCGGACCCGCAGG - Intergenic
1076096334 10:127737192-127737214 GGCGCTGCTGGCGGCCAAGCTGG + Intergenic
1077018389 11:406890-406912 GGCGCAGCAGGCGGAGCGCCGGG + Exonic
1077187026 11:1239993-1240015 GGCCCTGCAGGCTGCCCCCCAGG + Intronic
1078266448 11:9758883-9758905 GGCGCTGCAGGCGGCCTGGTTGG + Intergenic
1080012344 11:27472052-27472074 GGCCCAGCGGGGGGCGCCGCGGG - Intronic
1080628518 11:34052166-34052188 GGCCGAGCCGGCGGCTCCGCGGG + Intronic
1080628538 11:34052216-34052238 GGCCCAGCCGGGCGCCCCGCTGG + Intronic
1081870657 11:46381354-46381376 GGGGCAGCGGGCGGCGGCGCAGG + Intronic
1083467260 11:62856679-62856701 GTTGCAGCAGGCAGCACCGCCGG - Intronic
1083681240 11:64352780-64352802 GGCACAGGAGGTGGCCCTGCTGG + Exonic
1083938779 11:65883988-65884010 GGCGCAGGAGGCAGCCGCGGAGG + Exonic
1084000150 11:66291774-66291796 GGCGCTGCCGGCGGCGCCGCCGG + Intergenic
1084008678 11:66336052-66336074 TGAGCAGCAGGCGCTCCCGCAGG + Exonic
1084208621 11:67610716-67610738 GGGACAGCAGGCGGCCCTGGGGG - Intronic
1084720418 11:70902145-70902167 AGAGCAGCAGGCGGCCACCCGGG + Intronic
1085157716 11:74311578-74311600 GGCGCGGCTGGCGGCGCTGCTGG - Exonic
1085597140 11:77820546-77820568 GGTGCTGCAGGCGCCGCCGCCGG - Exonic
1085666279 11:78417820-78417842 GGCGGGGCGGGCGGCCCGGCGGG + Intronic
1087634549 11:100687601-100687623 GGGGCAGCCGGCGGCCGCGGCGG - Intergenic
1087761914 11:102110965-102110987 GGCGACCCAGGCGGCGCCGCAGG + Exonic
1089452616 11:118608314-118608336 GGCGCCCCAGGCGGCCTCCCCGG - Intronic
1089796605 11:120986104-120986126 GGCGCAGGAGGCCGCCCTGGTGG + Exonic
1092264036 12:6967759-6967781 AGCCCAGCAGGAGGCCCAGCGGG - Exonic
1096024735 12:48350896-48350918 GGCGGAGACGGCGGCCCGGCAGG + Intronic
1096868603 12:54579383-54579405 GGCCCAGGAGGAGGCCCCGAGGG + Exonic
1101253429 12:102956455-102956477 GCGCCAGCACGCGGCCCCGCCGG + Intronic
1102157440 12:110742589-110742611 AGGGCGGCAGGCGGCCCCGGGGG - Intronic
1102457089 12:113077656-113077678 GGCGGCGCAGGCGGCGGCGCCGG - Exonic
1105605171 13:21920934-21920956 CGGGCAGCCGGCTGCCCCGCCGG - Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106105371 13:26728440-26728462 GGCGCAGCAGGTGGACCAGCAGG - Intergenic
1106138967 13:26994847-26994869 GGAGCAGAAGGGGACCCCGCCGG - Intergenic
1106602640 13:31200473-31200495 GGCGCAGCAGCCGCCCCCACAGG + Intronic
1107307415 13:39037827-39037849 CCGGCAGCAGGCGGCCCGGCAGG + Exonic
1110219654 13:73059504-73059526 GGCGCAGCCCGCGCCCGCGCAGG + Exonic
1111232529 13:85363058-85363080 GGAGCAGCAGGGGGCCCCCACGG - Intergenic
1114073428 14:19132838-19132860 GGCGGAGGTGGCGGCCCTGCGGG + Intergenic
1114088837 14:19267145-19267167 GGCGGAGGTGGCGGCCCTGCGGG - Intergenic
1114459448 14:22877356-22877378 TGGGCAACAGGCGGCCTCGCAGG - Exonic
1117722157 14:58638337-58638359 GGAGCGGCAGGAGGCCACGCTGG + Exonic
1121670922 14:95710224-95710246 GACGCAGCAGGAGGCCAGGCCGG - Exonic
1122603288 14:102931725-102931747 GCTGCAGCAGGCGGCTCCCCTGG - Intronic
1122720010 14:103716428-103716450 GCTGGAGCTGGCGGCCCCGCAGG + Intronic
1122953897 14:105061102-105061124 GGCCCAGCAGGAGGCCCGGTGGG + Intronic
1123019035 14:105389010-105389032 AGCACAGCATGAGGCCCCGCCGG - Intronic
1123783130 15:23646067-23646089 GGGCCAGCGGGCGGCGCCGCGGG + Exonic
1128067839 15:64775544-64775566 GGCGGAGGCGGCGGCCCCTCCGG - Exonic
1128995061 15:72289480-72289502 GCAGCACCAGGCGGCCCTGCTGG - Exonic
1129450460 15:75648361-75648383 TGCGCAGCCGGAGCCCCCGCCGG - Exonic
1129697775 15:77750235-77750257 GGAGCAGGAGGCGGCCTCACGGG - Intronic
1130348053 15:83067066-83067088 GGCGGCGGCGGCGGCCCCGCGGG + Exonic
1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG + Exonic
1131257336 15:90871438-90871460 GGCGCCCCAGAAGGCCCCGCAGG + Intronic
1132045884 15:98562541-98562563 TGGGCAGGAGGCGGCCCCCCTGG + Intergenic
1132462844 16:63870-63892 GGGGCAGCATGCTGCCCCGGAGG - Intronic
1132547057 16:538146-538168 GGGGCACCTGGCGGCCACGCCGG - Intronic
1132657954 16:1049128-1049150 GGTGCAGCAGGCGGCCGAGGAGG - Intergenic
1132741102 16:1413929-1413951 GGCGCCGCAGGCCCCTCCGCAGG - Exonic
1133061220 16:3175533-3175555 GGCGCAGCAGGAGGCCCCCGAGG - Intergenic
1133916081 16:10111328-10111350 GCAGCGGCAGGCGGCCGCGCGGG + Intronic
1136498382 16:30657918-30657940 GGCACAGCACGCGGCCGCTCGGG + Intergenic
1136775721 16:32870775-32870797 GCTGCAGCAGGTGGCCCCACTGG + Intergenic
1136894896 16:33990737-33990759 GCTGCAGCAGGTGGCCCCACTGG - Intergenic
1138100182 16:54246125-54246147 GTGGGAGCAGGCTGCCCCGCTGG + Intronic
1138686998 16:58734338-58734360 GGCCCAGCACGCGGCCGCTCTGG - Exonic
1139514476 16:67445219-67445241 GGCGCAGCAGCCGGCAGCACGGG + Intronic
1140927676 16:79599479-79599501 GGCGCAGCAGCTGGCCGCGGCGG - Exonic
1141947055 16:87317617-87317639 GGGGCGGCCGGCGGCCCCTCCGG - Intronic
1141999029 16:87653427-87653449 GGCCCAGCAGGAAGCCCCACAGG + Intronic
1142074616 16:88110242-88110264 AGCCCAGGAGGCGGCCCCCCGGG - Intronic
1142130753 16:88430547-88430569 GGCGCCGCCGGCTGCCCCCCAGG + Exonic
1142136117 16:88452827-88452849 GGCGCAGGATGCGGTGCCGCGGG + Intergenic
1142173020 16:88632617-88632639 GGCTCAGCTCGCGGCCCCGTGGG - Intergenic
1142187831 16:88702847-88702869 GGTGAAGTAGGCGGCCCCCCCGG - Intronic
1142239867 16:88940308-88940330 GGAGCAGAAGGCGGCCAGGCTGG - Exonic
1142291081 16:89193835-89193857 GGGGGTGCAGGCGGCCCTGCGGG - Exonic
1203078139 16_KI270728v1_random:1132884-1132906 GCTGCAGCAGGTGGCCCCACTGG + Intergenic
1143134494 17:4704000-4704022 GCAGCAGCAGGCGGAGCCGCGGG + Exonic
1143188111 17:5022661-5022683 TGCGGAGCATGCGGTCCCGCAGG - Exonic
1145993930 17:29095016-29095038 GGCGCATGAGGAGGCCCAGCGGG - Exonic
1146079127 17:29761357-29761379 GGCGGCGGAGGCGGGCCCGCCGG + Intronic
1146400202 17:32495502-32495524 TGTGCAGCAGGAAGCCCCGCTGG + Intronic
1146948656 17:36890946-36890968 GGAGCAGCAGGCAGCCCATCTGG + Intergenic
1147057364 17:37844765-37844787 GACGCCTCAGGCGGCCCCCCTGG - Intergenic
1148060053 17:44830075-44830097 GGCGGAGGAGGCGGCTCCGGGGG - Intronic
1148340788 17:46872393-46872415 TGGGCAGCAGGCTGACCCGCTGG - Intronic
1148371053 17:47100156-47100178 GGCAGAGGAGGCGGCCCCGAGGG - Intergenic
1151348057 17:73515438-73515460 GGCGAAACAGGCGGCCCAGCTGG + Intronic
1151478531 17:74356818-74356840 GGACCAGCAGGCGGCCCTGCTGG + Exonic
1151702100 17:75748939-75748961 GGCGGACCTGGCGGCCCCGCAGG - Exonic
1151938883 17:77280978-77281000 GGCGCTCCGGGCGGCCCCGCCGG - Intronic
1152233937 17:79128719-79128741 GGCACAGCAGGAGTCCCCACAGG - Intronic
1152279692 17:79378135-79378157 GGCGCATCAGGGGTCCCAGCGGG + Intronic
1152282446 17:79393228-79393250 GCTGCAGCAGGCGGCTACGCGGG - Intronic
1152561331 17:81080228-81080250 GGTGCCGCAGGCGCCCCAGCCGG - Intronic
1152689725 17:81712476-81712498 CGTGCAGCAGGCGGCCCCGCAGG - Exonic
1152784114 17:82239209-82239231 GGAGCAGCAGGCGGGGCCCCTGG - Exonic
1152809589 17:82375299-82375321 GGCCCCGCACGCGGCCGCGCAGG - Exonic
1153770179 18:8408970-8408992 GGAGCAGCTGTGGGCCCCGCAGG + Intergenic
1153886943 18:9475597-9475619 AGCGCAGGAGGCGGCTCCGGTGG + Intronic
1153935236 18:9914626-9914648 CGCCCAGGAGGCGCCCCCGCGGG - Intronic
1154241505 18:12657766-12657788 GGGGCAGCCGGCGGCGCGGCCGG - Exonic
1156498087 18:37538960-37538982 GGAGCAGCAGGGGTCCCCACCGG - Intronic
1157605327 18:48922806-48922828 GGCGGAGCAGGGCGCCCTGCAGG - Intronic
1160174250 18:76579815-76579837 GGCGGAGCAGGCGGAGCCGGTGG + Intergenic
1160256096 18:77250113-77250135 GGTGCAGCACGCAGCCCCTCCGG + Intergenic
1160499345 18:79394542-79394564 GGCGCCGTAGGGGCCCCCGCAGG + Intergenic
1160662153 19:306206-306228 GGGGCAGCCCGCGGCCCTGCCGG + Exonic
1160761893 19:789632-789654 GGAGCTGCAGCCAGCCCCGCAGG - Intergenic
1160765741 19:806856-806878 GCCCCAGCAGGCCGCCCTGCTGG + Intronic
1161003197 19:1921441-1921463 GGTGCAGCAGGGGCCCCCGGTGG + Intronic
1161462947 19:4409685-4409707 GGGGGAGCAGGCGGCCCCTCGGG - Exonic
1161793924 19:6375810-6375832 GGAGCAGCAGGGAGCCCAGCAGG + Exonic
1162070486 19:8149474-8149496 GGCACGGCAGGCGGACGCGCGGG + Exonic
1162230130 19:9259605-9259627 GGAGCAGCAGGCCGGCCTGCCGG + Intergenic
1162572149 19:11480046-11480068 GGCGCGCCCGGAGGCCCCGCGGG - Intronic
1162810743 19:13163194-13163216 GGCGGAGCTTGCGGCCCAGCGGG + Intergenic
1162904945 19:13817828-13817850 GGGGCAGCAGCGGGCCCTGCCGG + Exonic
1162959635 19:14118146-14118168 GGCTCAGGAGGCGGCCCCGGCGG + Intergenic
1163014583 19:14446509-14446531 GGCGCTGCAGGCCGGCCAGCTGG + Exonic
1163358310 19:16829451-16829473 AGCGGTGCCGGCGGCCCCGCGGG + Exonic
1163390369 19:17026899-17026921 GGCGGAGCAGGCGTCCCGGGAGG - Intergenic
1163424878 19:17235858-17235880 GGCGCAGGGGGCGGCGCGGCGGG - Exonic
1163442653 19:17329448-17329470 GGAGGAGCAGGCGGAACCGCAGG + Intronic
1163669036 19:18617029-18617051 CGCGCTGCAGACGGCCCCCCTGG - Exonic
1165993704 19:39830515-39830537 GGCCCAGCAGGCGCCACCCCAGG - Exonic
1167080792 19:47274985-47275007 AGCGCAGCCAGCGCCCCCGCGGG - Exonic
1167311268 19:48739211-48739233 GGCCTAGCAGGCAGCCCCGGCGG - Exonic
1167705993 19:51081614-51081636 GCCGTGGCAGGCGGCCCTGCTGG - Exonic
1168257594 19:55175177-55175199 GGAGCTGCAGGCGGCTCCGCGGG - Exonic
1168293435 19:55368224-55368246 GGCGCAGCAGCCGGTCCAGTCGG + Exonic
1168346986 19:55654821-55654843 GGCGAAGCAGGCGGCCGCTTCGG - Intronic
1168613533 19:57819863-57819885 GGAGCAGCAGGCGCCCTCACCGG - Exonic
927114143 2:19885283-19885305 GGCCCAGCAGGAGTCCCGGCTGG - Intergenic
929242428 2:39666187-39666209 GGAGCAGCCGGCGCCCCAGCGGG - Exonic
929252891 2:39779113-39779135 GGCGCGGCTGGCGGCCACGCAGG - Exonic
929778355 2:44942282-44942304 GGCGGAGCAGGCGGCGGCGGCGG + Exonic
931714505 2:65018570-65018592 GGAGCAGCAGGCGTGCCAGCTGG + Exonic
932496205 2:72147118-72147140 GGCGCTGCCGACGGCGCCGCAGG + Intronic
933279936 2:80322514-80322536 GGGGCTGCAGGCAGCCCCGCGGG - Intronic
933684618 2:85133431-85133453 GGCGGAGCAGGCGGCGGCGGTGG + Exonic
933720691 2:85395585-85395607 GGAGCGGCAGGCAGCCCTGCAGG - Exonic
933772776 2:85754562-85754584 GGCGCAGGAGGCGGCGGCGGCGG - Exonic
934846368 2:97663702-97663724 GGCGAAGCCAGCGGCCCGGCGGG + Intronic
935265175 2:101387478-101387500 AGCGCTGCTGGCGGCCCCGGCGG - Exonic
936038403 2:109130003-109130025 GGCGCGGCAGGCAGCACCCCGGG + Exonic
936525159 2:113236467-113236489 GGCCCACCTGGCGGCCCGGCCGG + Intronic
936976185 2:118224527-118224549 GGCTCTGCGGGCCGCCCCGCCGG + Intergenic
938091903 2:128439993-128440015 GGGGCAGCAGGTGACCACGCAGG - Intergenic
945575494 2:211524646-211524668 GGAGCAGCCGGCGGCCCTGCCGG - Intronic
946407294 2:219498481-219498503 GGCCCAGCCGGCGGTACCGCTGG - Intergenic
947119454 2:226799947-226799969 GCCGGAGCTGGCGGCCGCGCAGG - Intergenic
947156005 2:227164006-227164028 GGCGCTGCGGGCGTCCCCACAGG - Exonic
947411977 2:229850809-229850831 GGAGGAGCAGCCGGCCCTGCCGG + Intronic
947636002 2:231681054-231681076 GGCGCAGATGGCGGCGGCGCGGG + Intergenic
948461311 2:238131188-238131210 GGCTGAGCCGGCAGCCCCGCGGG + Exonic
948708534 2:239810793-239810815 CGTGGAGCAGGCGGCCCAGCAGG - Intergenic
948854038 2:240721770-240721792 GCTGCACCAGGCTGCCCCGCAGG - Intronic
1169889096 20:10433797-10433819 GGCGTAGAAGGCGGCAGCGCAGG + Intronic
1172097769 20:32468569-32468591 GGCGCTGCAGGGTGCCCCTCAGG - Intronic
1172446099 20:34994260-34994282 GGAGGAGCTGGCGGCCCTGCGGG + Exonic
1172756617 20:37289773-37289795 GGCCCACCAAGCGGCGCCGCTGG - Intronic
1174287308 20:49482586-49482608 GGGGGTGCAGGGGGCCCCGCGGG + Exonic
1175184891 20:57173439-57173461 TGAGCAGCAGGGGGCCCAGCAGG + Intronic
1178408830 21:32347496-32347518 GCCGCAGCTGGAGGCCCTGCAGG - Exonic
1179719017 21:43305083-43305105 GGGGAAGCAGGCGGCCACCCTGG - Intergenic
1179799516 21:43804420-43804442 TGCGCAGCCTGCGGACCCGCGGG - Exonic
1180491871 22:15855191-15855213 GGCGGAGGTGGCGGCCCTGCGGG + Intergenic
1180614775 22:17120234-17120256 CGCGCCGCCGGCGCCCCCGCGGG + Exonic
1180801504 22:18634124-18634146 GGCGGAGCAGGCGAGCCAGCCGG - Intergenic
1180960704 22:19761094-19761116 GGCGCTGGTGGCGGCCCCGGCGG - Exonic
1181614211 22:24041216-24041238 GGCCCAGCTGGCAGCCCAGCGGG + Exonic
1182349083 22:29688580-29688602 GGAGCAGCGGAGGGCCCCGCCGG + Intronic
1182711472 22:32325917-32325939 GGAGCAGCAGGCTGCCCTGCTGG + Intergenic
1183326985 22:37199615-37199637 GGCCCGGCAGGGGGCGCCGCGGG - Intergenic
1184398993 22:44262697-44262719 GGAGTAGCAGGCTGCCCTGCTGG + Intronic
950101515 3:10359763-10359785 GGCTCAGCAGCCTGCCCGGCTGG - Intronic
951078552 3:18425286-18425308 GGCGGATGAGCCGGCCCCGCTGG - Intronic
954876104 3:53804124-53804146 GGCGTAGCAGGCGGCACAGGCGG + Intronic
958638581 3:96777028-96777050 GGCGCAGCAGGCAGCGCGGCGGG + Intergenic
960479530 3:118171489-118171511 GGAGCAGCCGGCGGCGCCACCGG + Intergenic
961222595 3:125212393-125212415 GCCTCCGCAGGCCGCCCCGCAGG + Intronic
961524727 3:127489499-127489521 GGGGCAGCAAGAGGCCCCACAGG + Intergenic
961665906 3:128492968-128492990 TGCGCGGCAGGCGGGCTCGCGGG + Exonic
962222339 3:133574141-133574163 GGCGCAGCGGGCAGCGCCGGCGG + Exonic
962259726 3:133895119-133895141 GGCGCTGCAGGGGGCCCGGAGGG - Intronic
962847628 3:139285854-139285876 GGCAGAGCAGGTGGCCCCTCAGG + Intronic
966886591 3:184380558-184380580 GGCGCGGCGGGCGGCCCGGAGGG + Intronic
966915797 3:184583600-184583622 GGCACAGCTGGCGGCGGCGCGGG + Intronic
968051668 3:195658589-195658611 CGGGCTGCGGGCGGCCCCGCAGG - Intergenic
968104148 3:195989744-195989766 CGGGCTGCGGGCGGCCCCGCAGG + Intergenic
968302449 3:197627334-197627356 CGGGCTGCGGGCGGCCCCGCAGG + Intergenic
968756509 4:2418780-2418802 GGCGCGGCGGGTCGCCCCGCCGG - Intergenic
969256915 4:6008427-6008449 GGGGCAGCAGGCGGCGGCCCTGG - Intergenic
970333413 4:15005126-15005148 AGCCAAGGAGGCGGCCCCGCGGG - Intronic
971230890 4:24799713-24799735 GGTGCAGCCGTCGGCCACGCTGG + Exonic
971352000 4:25863134-25863156 GGAGCAGCGGGCGCCCACGCAGG + Intronic
973293295 4:48490584-48490606 GTCGCAGCTGCCGGCCCTGCGGG - Exonic
973317765 4:48779796-48779818 GGCGCTGCCGGCGGAACCGCCGG + Intronic
974069361 4:57110198-57110220 CGCCCAGCAGGCAGCCCAGCGGG + Exonic
975633084 4:76421278-76421300 GGCGCGGGAGGGGTCCCCGCCGG - Intronic
976246534 4:83010977-83010999 GGCGGAGCACGGGCCCCCGCAGG + Intronic
980541489 4:134201681-134201703 GGCGAAGCGGGCGGCCAGGCGGG + Intronic
981093445 4:140756223-140756245 GCCCCAGCAGGCGGCCCGGGAGG + Intergenic
982616104 4:157637765-157637787 GGAGGAGCGGACGGCCCCGCGGG - Intergenic
985545391 5:506456-506478 GGAGCAGCATGGGGCCCCTCGGG - Intronic
985867167 5:2523145-2523167 GGAGCAGAAGGTGGCCCCTCTGG - Intergenic
986993269 5:13578603-13578625 GGAGCGGCCGGCCGCCCCGCCGG + Intergenic
990451259 5:55933533-55933555 GCAGCAGCAGGCAGCCCCTCTGG + Intergenic
990607127 5:57422531-57422553 GCCGCAGCAGCCGACCCCCCCGG + Intergenic
991488790 5:67164360-67164382 TGGGCAGCAGGAGCCCCCGCCGG + Exonic
992089405 5:73303866-73303888 GGAGCTGGAGGAGGCCCCGCAGG - Intergenic
998200554 5:140114667-140114689 TGCGCAGGAAGCGGCCGCGCTGG - Exonic
1002495711 5:179610134-179610156 GGCTCACCAGGCTGCCCTGCAGG - Intergenic
1003577653 6:7312871-7312893 GTAGCAGCAGGGGTCCCCGCGGG - Intronic
1003736882 6:8887259-8887281 GGAGCAGCAGCCAGCCCTGCTGG + Intergenic
1003864663 6:10351925-10351947 GGCTAAGCAGTCGGCCTCGCTGG + Intergenic
1005839251 6:29730669-29730691 GAGGCAGCAGGCAGCCCAGCTGG - Intronic
1005843097 6:29757435-29757457 GAAGCAGCAGGCAGCCCAGCTGG - Intergenic
1005872205 6:29982993-29983015 GATGCAGCAGGCAGCCCAGCTGG - Intergenic
1006727654 6:36211373-36211395 GGCGTAGCAGGCGGACACGACGG - Exonic
1007406479 6:41638703-41638725 GGCTCAGCGGGCGGCGCCGGAGG - Intronic
1007415917 6:41691147-41691169 GGCGCAGCAGGAGGAGCAGCGGG - Exonic
1007760030 6:44128018-44128040 GGCGCAGCTGGCACCCCCGAGGG - Intronic
1007924813 6:45642534-45642556 AGCGCAGTGGGCGGCCACGCGGG - Intronic
1015525970 6:134175518-134175540 AGCGCCGCCGCCGGCCCCGCTGG - Intronic
1016433153 6:144008463-144008485 GTGGCAGGAGGAGGCCCCGCCGG + Intronic
1016923329 6:149317425-149317447 GGAGCAGCAGGCGGCGGCGGCGG - Intronic
1017873057 6:158502675-158502697 GGGGCTGCAGGGGGGCCCGCGGG - Exonic
1017972472 6:159325326-159325348 GGCACTGCAGTCAGCCCCGCGGG + Intergenic
1018686467 6:166307923-166307945 GACGCAGCCGCCGGCCCCTCCGG - Exonic
1020055937 7:5117573-5117595 CGCGCAGCAGGCGGCCAAGCAGG - Intergenic
1022094571 7:27130621-27130643 GGCGCAGACGGCGGCCCGGGCGG - Exonic
1022443344 7:30451335-30451357 GGCGCTGCAGTCGGCCGAGCAGG + Exonic
1022443537 7:30452288-30452310 GGCTCAGCAGGCGGTCCTGCAGG + Exonic
1023860655 7:44216124-44216146 GGTGCATCAGGGGGCCCAGCGGG + Intergenic
1023860952 7:44217496-44217518 GGCCCAGCAGCCGGCCACCCTGG - Exonic
1023955642 7:44884913-44884935 TGCGCAGGAAGCGGCCGCGCTGG + Exonic
1024930736 7:54664703-54664725 GGCGCAGCGGGCGGATCTGCGGG + Intergenic
1033186508 7:139231628-139231650 GGCGGAGCCGCCGGCCCCGCGGG + Exonic
1033406371 7:141074019-141074041 GGGGCGGGAGGCGGCCGCGCTGG + Intergenic
1033832393 7:145269972-145269994 GGCCCACCAGGCGCCCCTGCAGG - Intergenic
1034128915 7:148698588-148698610 GCCGCTGCCGGCGGCCCCGGGGG - Intronic
1034147240 7:148884134-148884156 GCCGCTGCGGGCGGCCCGGCCGG - Intronic
1034276891 7:149827787-149827809 GTGGCAGCAGGTGGCCCCGGGGG + Intergenic
1034306291 7:150047692-150047714 GGCGCAGGCGGCGGCGCCCCGGG - Intergenic
1034335973 7:150323623-150323645 GGCCCAGCAGGTGGCCCCCCGGG - Intronic
1034800556 7:154052961-154052983 GGCGCAGGCGGCGGCGCCCCGGG + Intronic
1035453177 7:158992367-158992389 GGCTCAGCTGGGGGCCCCGCAGG - Intergenic
1038361488 8:26883853-26883875 GGCGCAGCAGGAGGCTTTGCTGG + Intergenic
1038540275 8:28385658-28385680 GGCCGGGCGGGCGGCCCCGCCGG + Intronic
1040951144 8:52939994-52940016 GGCGCCGCTGCCGGCGCCGCTGG + Exonic
1041107869 8:54459230-54459252 TGAGCCGCAGGCGGCCGCGCTGG + Exonic
1043502658 8:80873386-80873408 GGCGGCGCGGGCGGCCGCGCGGG - Intronic
1043891640 8:85656441-85656463 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043892712 8:85663278-85663300 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043895532 8:85735511-85735533 GGCCAAGGAGGCGGCCCCGGAGG + Intergenic
1043897147 8:85746297-85746319 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043899473 8:85764665-85764687 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043901081 8:85776858-85776880 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043903045 8:85792133-85792155 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043904655 8:85804326-85804348 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1043906267 8:85816517-85816539 GGCCAAGGAGGCGGCCCCGGAGG - Intergenic
1045653865 8:104367364-104367386 GGCGCTGCAGACGGGCCCCCTGG - Intronic
1048865222 8:138755795-138755817 GGTACACCAGGTGGCCCCGCAGG + Exonic
1049206569 8:141366386-141366408 GGAGCAGCTGGCGACCTCGCAGG - Intronic
1049493485 8:142917221-142917243 GGCCAAGCAGGAGGCCCTGCTGG + Intronic
1049687722 8:143945645-143945667 GGGACAGCAGGCGGCGCCTCAGG - Intronic
1053393392 9:37751970-37751992 GGAGCGGCGGCCGGCCCCGCCGG + Intronic
1057785981 9:98087646-98087668 GGGGCCGCAGGCGGCTGCGCTGG + Exonic
1057997164 9:99828783-99828805 GGCCAAGAGGGCGGCCCCGCTGG + Exonic
1059176707 9:112175080-112175102 GGCCCAGCCGGGGGCCCCGCCGG + Intronic
1059299786 9:113303061-113303083 GGCGGAGGAGGCGGCTCCGAGGG - Intronic
1060565856 9:124591046-124591068 GGCTCAGCAGCTGGCCCCACTGG + Intronic
1060695597 9:125706854-125706876 GGCCCGGCAGGCGGCCCGCCGGG + Intronic
1061753852 9:132799143-132799165 GGCGCAGCAGGAGGGGCCTCTGG - Intronic
1061986924 9:134135489-134135511 AGCCCGGCAGCCGGCCCCGCGGG + Intronic
1062542803 9:137049025-137049047 GGCGCAGTAGTCGGCCAGGCGGG + Exonic
1185446066 X:258552-258574 GGTGCAGCAGGAGGCCCCTCTGG + Intergenic
1185460850 X:332234-332256 GGCGCAGCAGGGGTGACCGCCGG - Intergenic
1185478338 X:428346-428368 GACGCAGCAGGCGGCCGCCAGGG + Intergenic
1186017525 X:5214414-5214436 GGTGCAGCAGGGGTCTCCGCTGG + Intergenic
1189988676 X:46575083-46575105 AGCGCAGCAGGCGGCGCAGCTGG - Exonic
1190024663 X:46912538-46912560 GGCGCGGGGGGCGGCCCCGGCGG + Exonic
1190440225 X:50469508-50469530 GGCGCAACTGGCGGCCCTCCAGG - Intronic
1196684141 X:118496150-118496172 GGCGCACCAAGCGGCCGCACTGG - Intronic
1197757666 X:130007507-130007529 GCCACAGCACCCGGCCCCGCTGG - Intronic
1198312332 X:135435083-135435105 GGAGCAGGAGGCGGCGCGGCAGG + Intergenic
1198619207 X:138488028-138488050 GGCGCTGGAGGCAGCCCCGCAGG - Intergenic
1198758933 X:140011374-140011396 GGGGAAGCAGGGGGCCCCACTGG + Intergenic
1198779809 X:140222207-140222229 GGGGAAGCAGGGGGCCCCACTGG - Intergenic
1200093829 X:153648088-153648110 GGCGCAGCAGGAGCGCCGGCAGG - Exonic
1200104178 X:153703263-153703285 GCTGCAGCAGGTGGCCCCGCTGG - Intronic
1200227813 X:154428812-154428834 GGCGGAGCAGCAGGTCCCGCTGG + Exonic
1202109526 Y:21405904-21405926 GCGGCAGCAGGAGGACCCGCAGG + Intergenic
1202197151 Y:22307687-22307709 GCGGCAGCAGGAGGCCCAGCAGG - Intergenic