ID: 906318791

View in Genome Browser
Species Human (GRCh38)
Location 1:44804260-44804282
Sequence CTGGTACATGCTGCTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906318788_906318791 -6 Left 906318788 1:44804243-44804265 CCAGGTAAGGGTGGGGTCTGGTA 0: 1
1: 0
2: 1
3: 4
4: 111
Right 906318791 1:44804260-44804282 CTGGTACATGCTGCTGTGGTGGG 0: 1
1: 0
2: 0
3: 21
4: 179
906318785_906318791 -4 Left 906318785 1:44804241-44804263 CCCCAGGTAAGGGTGGGGTCTGG 0: 1
1: 0
2: 0
3: 23
4: 279
Right 906318791 1:44804260-44804282 CTGGTACATGCTGCTGTGGTGGG 0: 1
1: 0
2: 0
3: 21
4: 179
906318787_906318791 -5 Left 906318787 1:44804242-44804264 CCCAGGTAAGGGTGGGGTCTGGT 0: 1
1: 0
2: 1
3: 13
4: 201
Right 906318791 1:44804260-44804282 CTGGTACATGCTGCTGTGGTGGG 0: 1
1: 0
2: 0
3: 21
4: 179
906318784_906318791 -3 Left 906318784 1:44804240-44804262 CCCCCAGGTAAGGGTGGGGTCTG 0: 1
1: 1
2: 2
3: 22
4: 222
Right 906318791 1:44804260-44804282 CTGGTACATGCTGCTGTGGTGGG 0: 1
1: 0
2: 0
3: 21
4: 179
906318780_906318791 5 Left 906318780 1:44804232-44804254 CCTTCATGCCCCCAGGTAAGGGT 0: 1
1: 0
2: 0
3: 10
4: 128
Right 906318791 1:44804260-44804282 CTGGTACATGCTGCTGTGGTGGG 0: 1
1: 0
2: 0
3: 21
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906318791 Original CRISPR CTGGTACATGCTGCTGTGGT GGG Intronic
900874364 1:5331080-5331102 CTGGAACATTCTGCTGTGACAGG - Intergenic
900998284 1:6134497-6134519 GTGGAACCCGCTGCTGTGGTAGG - Intronic
902128503 1:14238253-14238275 TTTGTTCATGCTGCTGTGGTTGG + Intergenic
902134839 1:14296241-14296263 CAGGCAAATGCTGCAGTGGTGGG + Intergenic
904235757 1:29115979-29116001 CTGCTACAGGCTGCTTTAGTTGG - Intronic
904867505 1:33592412-33592434 CTGGTCCAAGCTTCTGTGGCTGG + Intronic
905629608 1:39511318-39511340 CTGGAACATGCTGACGTGGAGGG - Exonic
905668151 1:39774872-39774894 CTGGAACATGCTGACGTGGAGGG + Exonic
906318791 1:44804260-44804282 CTGGTACATGCTGCTGTGGTGGG + Intronic
907417388 1:54323872-54323894 CTTGTACATCCTGCTCAGGTGGG - Intronic
909389614 1:75105014-75105036 CAGGTGCATGCTGCTATGCTGGG - Intergenic
910758178 1:90712447-90712469 CCGGTACATGCTGCTGTACATGG + Exonic
910920859 1:92345221-92345243 CAGGTACATGCTGCTGTGTCTGG - Intronic
916069552 1:161161839-161161861 GTGGTACATTCAGCTGTGATGGG + Intronic
916877993 1:168990861-168990883 CTGGCACATGCTGCTATGGCAGG - Intergenic
918368807 1:183838025-183838047 CTGGTCCATGGTGCAGGGGTTGG + Intronic
923121188 1:230993231-230993253 CAGGTACATGCTACTGTGCCTGG + Intronic
1063070538 10:2658770-2658792 CAGGTACGGGCTGCTCTGGTTGG - Intergenic
1063461943 10:6220597-6220619 CAGGTGCATCCTGCTGTGGGTGG + Intronic
1066682516 10:37947844-37947866 CTGGTACATTCAGCAGTGGAGGG + Intergenic
1068187874 10:53610653-53610675 CTGTTACATACTGCTGTTGATGG - Intergenic
1070319484 10:75343854-75343876 CTGTTACATGATGCCCTGGTGGG + Intergenic
1072484012 10:95837263-95837285 CTGTCGTATGCTGCTGTGGTTGG + Intronic
1075650557 10:124125915-124125937 CTGGTTCATGCTGCTGTTGGTGG + Intergenic
1075697088 10:124444505-124444527 CAGGCACATGCTGCTATGTTTGG - Intergenic
1076521127 10:131082037-131082059 CTGATACAGGCAGATGTGGTGGG + Intergenic
1076922843 10:133464630-133464652 GTGGGACCTGCTGCTGTGCTGGG + Intergenic
1079985570 11:27197081-27197103 CTGGTCCCTCCTGCTCTGGTTGG - Intergenic
1081654388 11:44847974-44847996 CAGGTACATGCCACTGTGGCTGG + Intronic
1082097537 11:48143657-48143679 CTGTTACATTCTTTTGTGGTAGG + Intronic
1083475576 11:62912904-62912926 CTGTGACAGGCTGCTGTGATAGG + Intronic
1084173926 11:67413640-67413662 CTGGGGTATGCTTCTGTGGTTGG + Intronic
1085419276 11:76341633-76341655 CTGGTGCATGTCACTGTGGTGGG - Intergenic
1088368836 11:109066824-109066846 CAGTTACATGCTGCTTTGGTTGG - Intergenic
1089137737 11:116263150-116263172 CTGGTGAATGCTGCTGAGGGAGG + Intergenic
1095168350 12:39002320-39002342 CTGGTAAATGCTGTTTTGATGGG - Intergenic
1096500925 12:52063393-52063415 CTGGTACATGCTGCGTTAGCAGG + Intergenic
1098751093 12:74293698-74293720 CTGGAACCTGCTGCTGTGCCTGG + Intergenic
1102035469 12:109768522-109768544 CTGGTACAGGAGGCTGTGGATGG - Exonic
1105754584 13:23452829-23452851 CTGGTGAATGCTGCTGTTGCAGG - Intergenic
1107029212 13:35833698-35833720 CGGGTACATTCTGCTGTGTTTGG - Intronic
1108296796 13:49028880-49028902 ATTATACATGCTGCTGTTGTTGG - Intronic
1110871312 13:80455437-80455459 CAGGCACCTGCTGCTGTGCTGGG - Intergenic
1111306700 13:86422895-86422917 CTGCGTCATGCTGCTGAGGTGGG + Intergenic
1112544528 13:100353300-100353322 CAGGTATATTCTGCTGTTGTTGG - Intronic
1113579571 13:111419482-111419504 CTCGTTTCTGCTGCTGTGGTGGG + Intergenic
1113670286 13:112171332-112171354 CTGGTGCCCGCTGCTGTGGGGGG - Intergenic
1118096947 14:62547295-62547317 GTGGTAAATGCTGCTGGGCTTGG - Intergenic
1118310068 14:64685644-64685666 CTGGTGCAAACTGCTGTGCTGGG - Intergenic
1118554156 14:66995590-66995612 CTACTACATTCTGCTGTGCTTGG + Intronic
1122059529 14:99127372-99127394 CTCGCAAATGCTTCTGTGGTTGG + Intergenic
1122463206 14:101912980-101913002 CTGGCACCCGCTGCTGGGGTGGG - Intronic
1124240415 15:28023641-28023663 GTGGTAGGTGCTGCTGTGATGGG - Intronic
1127567379 15:60204993-60205015 CTCCAACATGCTGCCGTGGTAGG - Intergenic
1128185317 15:65639647-65639669 CTGGTAGATGGTGCTGCGGATGG - Exonic
1128697558 15:69779971-69779993 CTGGTACATGGAACTGTGCTAGG + Intergenic
1131359809 15:91780652-91780674 CTGTTATAAGCTGCTGTGTTTGG - Intergenic
1134224145 16:12378697-12378719 CTGACACTTGCTGCTATGGTTGG - Intronic
1136685792 16:31994272-31994294 GTGGTAAGTGCAGCTGTGGTGGG + Intergenic
1136786405 16:32937805-32937827 GTGGTAAGTGCAGCTGTGGTGGG + Intergenic
1136883367 16:33915990-33916012 GTGGTAAGTGCAGCTGTGGTGGG - Intergenic
1137072009 16:35911980-35912002 CTGGCACATGCTGCTGTGAAAGG - Intergenic
1137950674 16:52780732-52780754 CTGTTGCATGCTGTGGTGGTGGG - Intergenic
1141006086 16:80353711-80353733 CTGGCTCATGCATCTGTGGTTGG + Intergenic
1142120635 16:88384905-88384927 CTGGAACAGGCTGCTGTGATGGG - Intergenic
1203088639 16_KI270728v1_random:1199471-1199493 GTGGTAAGTGCAGCTGTGGTGGG + Intergenic
1142908219 17:3063046-3063068 CATGTACATCCTGCTGTGGCTGG - Exonic
1142926346 17:3241215-3241237 CATGTACATCCTGCTGTGGCTGG + Intergenic
1143406519 17:6681275-6681297 CTGGAAGATGCTCCTGGGGTAGG + Intergenic
1144108374 17:12007668-12007690 CTGCTACCTGCTGCTGGGGATGG + Intergenic
1145220306 17:21083174-21083196 CTGGTAGTCCCTGCTGTGGTTGG - Intergenic
1151730681 17:75909448-75909470 CTGGTAGGTGCTGGTGTGGGAGG - Exonic
1152639835 17:81444837-81444859 CTGGTCCAGGCTGCTGTACTTGG + Intronic
1153894155 18:9543782-9543804 CTGGGACATGTTTCTGTGGAGGG - Intergenic
1154005306 18:10522570-10522592 CTGGAACATTCAGCTGTGGGAGG + Intergenic
1155269619 18:24127385-24127407 CTGGTACAGGGAGCTGTGGATGG - Intronic
1156757561 18:40546952-40546974 CTGGTTCATGCTGCGTTAGTGGG + Intergenic
1158492737 18:57924866-57924888 TTGGTCAATGCTGCTGTGCTAGG - Intergenic
1159097027 18:63914771-63914793 CAGGTACATGCAGGTGTGGTAGG + Intronic
1160317018 18:77857852-77857874 GTGGTATATGCTGATGTGATCGG + Intergenic
1160557392 18:79735210-79735232 CTCGTACCTGCTGCGGGGGTGGG + Intronic
1161260541 19:3335505-3335527 CAGGTACCTGCTGCTCTGGGAGG - Intergenic
1161533938 19:4807274-4807296 CTGGGACATGCGGCTGGGGTGGG + Intergenic
1165858443 19:38894024-38894046 CTGGGACAGGCTGCCGGGGTTGG + Intronic
1166165396 19:40984246-40984268 ATGGTCCATGCTTTTGTGGTTGG - Intergenic
1168719272 19:58545894-58545916 CTGGTACATGAGGCTGAGGGGGG + Exonic
926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG + Intergenic
926233153 2:11019968-11019990 CTGGTACAAGCTGATGGGGCAGG + Intergenic
927187062 2:20489514-20489536 CTGGCACATGCTGCTATGCCCGG + Intergenic
927990833 2:27445744-27445766 CCGGTACATGCTGCTTAGCTGGG + Exonic
928089798 2:28367117-28367139 CTGCTACAAGCCGCAGTGGTAGG + Intergenic
931050380 2:58407313-58407335 CAGGCACATGCCGCTGTGCTCGG - Intergenic
934908601 2:98229297-98229319 CTGGTTCCTTCTGCTGTGGGGGG + Intronic
935202673 2:100871471-100871493 CAGGCACATGCTGCTGTGCTTGG + Intronic
939044370 2:137232617-137232639 GAGATACATGCTGCAGTGGTGGG + Intronic
941601357 2:167547087-167547109 CGAGGACGTGCTGCTGTGGTGGG - Intergenic
942230909 2:173860269-173860291 CTGGAACATGCTCCTGTAGGCGG + Intergenic
942336295 2:174890410-174890432 CAGGTACATGCTACTGTAGCTGG - Intronic
942628444 2:177929200-177929222 CTGGTGCACACTGCTGTTGTGGG - Intronic
944298267 2:198092178-198092200 CTGGGACAAGCTGGTGAGGTTGG - Intronic
944868444 2:203884952-203884974 CTGGTGCAGGTTGCTGGGGTGGG + Intergenic
945689594 2:213016902-213016924 CTGTTGCATGTAGCTGTGGTGGG - Intronic
948060347 2:235038876-235038898 CAGGTACATGATGTAGTGGTTGG + Intronic
948358270 2:237398100-237398122 ATGGTCCCAGCTGCTGTGGTTGG - Intronic
1169014345 20:2279608-2279630 CTGGTCCATGCTGCAGCTGTAGG + Intergenic
1170974999 20:21154637-21154659 CTGATACATGCTGCTGCTTTTGG + Intronic
1171777545 20:29383157-29383179 CTGGCATATGCTCCTGGGGTGGG + Intergenic
1172798256 20:37558421-37558443 TTGGCAAATGCTGCTGTGGATGG + Intergenic
1175811640 20:61861609-61861631 CTTGTTCAAGCTGCTGTGGTTGG - Intronic
1178487415 21:33027737-33027759 CTGGCACATGCTGCAGGGGCAGG - Exonic
1179931477 21:44573738-44573760 ATGGTGGATGCTGCTGTGCTGGG - Exonic
1180581603 22:16844408-16844430 CTGGTACATGGGGTTGTGGCTGG - Intergenic
1181562610 22:23714624-23714646 CTGGAACAGGCTGCTGATGTCGG + Intergenic
1181843484 22:25686303-25686325 AGGGTAGATGCTGCTGTGTTTGG - Intronic
1182194433 22:28501113-28501135 CTAGTACATAATGCTGTGCTTGG - Intronic
1184318589 22:43720367-43720389 CAGGTACATGCTACTGTGCCCGG - Intronic
1184431998 22:44446634-44446656 CTGTAAGATGCTCCTGTGGTTGG - Intergenic
949795743 3:7848748-7848770 GTGGTAGATGCTACTGAGGTAGG + Intergenic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950977449 3:17263093-17263115 GTGGTACATGCTGCTGAGGCAGG + Intronic
951087999 3:18537487-18537509 CAGGCACATGCTGCTGGGCTCGG + Intergenic
951789250 3:26461543-26461565 CTATTACCTGCTGCTGTAGTTGG + Intergenic
951943282 3:28105673-28105695 CTGGCATATGATGCTGTGATTGG + Intergenic
952743096 3:36752892-36752914 CTGCTACATGCCACTGTGGTAGG - Intergenic
954043878 3:47912216-47912238 CTGGTTCATCCTCCTGTGGTGGG - Intronic
954110961 3:48432808-48432830 CTGGTACATGCTGCTGGGCCAGG - Exonic
954115550 3:48465178-48465200 CTGGAACAGGCTGCAGTGGGCGG - Intronic
955907192 3:63819477-63819499 CTGGTAGATACAGCTGAGGTTGG - Exonic
956284536 3:67594726-67594748 CTGGTACCTTCTGGTGTGATGGG + Intronic
956816628 3:72914013-72914035 CTGGCACATGCTGAAGGGGTGGG + Intronic
958872076 3:99571583-99571605 CAGGTGCATGCTGCTGTGTCTGG - Intergenic
959310235 3:104726791-104726813 CTCGTATATACTTCTGTGGTGGG - Intergenic
961721701 3:128901358-128901380 CTGGTACAAGGGGCTGTGGCTGG - Intronic
961807715 3:129501211-129501233 CGTGCACATGCTGCTGCGGTAGG + Intronic
965026049 3:163303322-163303344 CTGCAACATGCTGCTGTTGCTGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966904148 3:184509452-184509474 CACGTTCGTGCTGCTGTGGTAGG + Intronic
968333353 3:197891046-197891068 CTGATACAAGCTGCTTAGGTGGG - Intronic
970644236 4:18101234-18101256 CTGAAATATGCTGCTGTGTTTGG - Intergenic
975490898 4:74987261-74987283 CTGGTCCAATCAGCTGTGGTTGG + Intronic
977577990 4:98694976-98694998 CTGGTTCAGTCTGCTGTGATTGG + Intergenic
979337267 4:119477502-119477524 CAGGTATATGCTACTGTGTTAGG - Intergenic
982323203 4:154101870-154101892 CAGGTACCTGCTGCTAAGGTTGG - Intergenic
984523506 4:180828304-180828326 CTGATATATGCTGATGTGGCAGG + Intergenic
985350422 4:189055545-189055567 CTGGCACTTCCTGCAGTGGTGGG - Intergenic
985614749 5:912970-912992 ATGGCACACCCTGCTGTGGTTGG + Intronic
987243666 5:16026824-16026846 CTGGTACCTGCTTCTGGGCTAGG + Intergenic
993427644 5:87788066-87788088 CTGATCCATGCTGCTATTGTTGG - Intergenic
994001069 5:94779879-94779901 CTGTTCCATTCTGCTGAGGTAGG - Intronic
994007441 5:94855472-94855494 CTGGCAATTGTTGCTGTGGTAGG + Intronic
998349176 5:141489868-141489890 CTGGTGCTTACTGCTGTGGATGG + Exonic
999658562 5:153834659-153834681 CTGGCACATGATGCTGTGATGGG + Intergenic
1001806416 5:174590526-174590548 CTGGTAGATGGTGCTGGTGTAGG + Intergenic
1002100722 5:176856280-176856302 CTGGCACATGCTGCTCTTGTAGG - Intronic
1002109172 5:176896585-176896607 GATGGACATGCTGCTGTGGTTGG + Intronic
1002640529 5:180628627-180628649 CTGTTACATGTGGGTGTGGTGGG - Intronic
1005718336 6:28575157-28575179 CTGTTGCATGCTTCTGTGATAGG + Exonic
1005989217 6:30892895-30892917 CTGGAACACCCAGCTGTGGTGGG - Intronic
1006980813 6:38146268-38146290 CTGGTACTACTTGCTGTGGTTGG + Intronic
1010202077 6:73290836-73290858 CTGTTACATACAGCAGTGGTAGG - Intronic
1010243281 6:73637674-73637696 CTCGTACATGCTGTTCTGATTGG + Intronic
1011078675 6:83465758-83465780 CTGGTATATTCAGCAGTGGTTGG + Intergenic
1014056990 6:117027268-117027290 CTGGTAAATGCTGCTTTGGGAGG - Intergenic
1014690780 6:124560914-124560936 CTGGAAGATGCTGCAGAGGTAGG + Intronic
1014851831 6:126350002-126350024 CAGGTGCAAGCTGCTGTGTTCGG + Intergenic
1017566454 6:155692445-155692467 CAGGTCCATGCTGCTCTAGTTGG + Intergenic
1022294992 7:29042460-29042482 CAGGAGCATGCTGCTGTGCTTGG - Intronic
1025205644 7:56992079-56992101 CTGAGCCATGCTCCTGTGGTCGG + Intergenic
1025666296 7:63584859-63584881 CTGAGCCATGCTCCTGTGGTCGG - Intergenic
1028665174 7:93334615-93334637 CTGGTATATGCTGCCGAGTTAGG + Intronic
1029517772 7:101037492-101037514 CTGGTACCTCCTGCAGTTGTAGG - Exonic
1030176725 7:106661284-106661306 CTGGAAGATGGTGCTGGGGTGGG + Intergenic
1031964991 7:128021344-128021366 CTGGATCATGCAGCTGTGTTTGG - Intronic
1032492341 7:132333119-132333141 CTGGTTTCTGATGCTGTGGTCGG + Intronic
1036786199 8:11689388-11689410 CAGGTGCATGCTGCTGTTCTGGG - Intronic
1036822904 8:11954314-11954336 CTGGCACATGCTGCTTGGGAGGG - Intergenic
1042040675 8:64585670-64585692 CTGGCACATGCTGCAGTCTTAGG - Intergenic
1043636033 8:82383205-82383227 CAGGTGCATGCTGCTGTGCCTGG + Intergenic
1044266670 8:90189971-90189993 ATGGTGCATGCTGCTTGGGTGGG - Intergenic
1045599078 8:103693049-103693071 CTGGTTCCTACTGCTGTGATGGG + Intronic
1047181874 8:122596177-122596199 CTGTTATATGCTGCTGAGGTTGG + Intergenic
1049001893 8:139831626-139831648 CTGGCACAGGCTGCGGCGGTGGG - Intronic
1049979844 9:893996-894018 CTGGTAGAAGCTGCTGTAGTAGG - Exonic
1050921581 9:11208884-11208906 CAAGTACTTGCTGCTGTTGTTGG + Intergenic
1057002879 9:91529090-91529112 CTGGAACACACTGCTGTTGTCGG + Intergenic
1057256317 9:93550574-93550596 CAGGTACATGGTGCAGTGGCCGG + Exonic
1058326337 9:103703041-103703063 ATGAGACAGGCTGCTGTGGTAGG + Intergenic
1060735509 9:126064339-126064361 CTGGCCCATGCTGCTGAGTTTGG + Intergenic
1060792469 9:126495928-126495950 GTGTGACATGCTGCTGTGGATGG + Intronic
1061730831 9:132612541-132612563 CTGGTACCAGGTGCTGTGCTGGG - Intronic
1062266227 9:135687691-135687713 CTGGGACAAGATGCTGAGGTTGG - Intergenic
1062564557 9:137158456-137158478 CAGGTTCATGATGCTGTAGTTGG - Exonic
1186581861 X:10828318-10828340 ATGTTACATTCTGCTGGGGTAGG + Intronic
1187775718 X:22754359-22754381 CTGGTTCAAGCTGGTGTGGAGGG + Intergenic
1189370568 X:40425331-40425353 CTGGTACAGGATGTTATGGTGGG - Intergenic
1189808594 X:44760515-44760537 CTGGTCCATGTTCCTGTGATTGG + Intergenic
1191975523 X:66867116-66867138 CTGGGACATGCTACGGTGCTGGG + Intergenic
1198088656 X:133305785-133305807 CTAGTGCCAGCTGCTGTGGTTGG + Exonic
1198745050 X:139881441-139881463 CTGCCACATGTTGCAGTGGTAGG - Intronic
1198870848 X:141176375-141176397 CAGTTACCTGCTGCTGGGGTCGG - Exonic
1200834367 Y:7718351-7718373 CTGGCACATTATGCTGAGGTGGG - Intergenic