ID: 906319272

View in Genome Browser
Species Human (GRCh38)
Location 1:44806503-44806525
Sequence CTCGCGCCGGGGCTCCATGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 90}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906319272_906319283 3 Left 906319272 1:44806503-44806525 CCAGCATGGAGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 906319283 1:44806529-44806551 GGGGCTGGACCTGGACCTGCCGG 0: 1
1: 1
2: 8
3: 83
4: 573
906319272_906319284 7 Left 906319272 1:44806503-44806525 CCAGCATGGAGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 906319284 1:44806533-44806555 CTGGACCTGGACCTGCCGGTCGG 0: 1
1: 0
2: 0
3: 13
4: 138
906319272_906319291 28 Left 906319272 1:44806503-44806525 CCAGCATGGAGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 906319291 1:44806554-44806576 GGGCCTCATCAATGCTGGGCAGG 0: 1
1: 0
2: 2
3: 23
4: 199
906319272_906319281 -6 Left 906319272 1:44806503-44806525 CCAGCATGGAGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 906319281 1:44806520-44806542 CGCGAGGCCGGGGCTGGACCTGG 0: 1
1: 0
2: 4
3: 94
4: 582
906319272_906319285 8 Left 906319272 1:44806503-44806525 CCAGCATGGAGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 906319285 1:44806534-44806556 TGGACCTGGACCTGCCGGTCGGG 0: 1
1: 0
2: 1
3: 14
4: 121
906319272_906319290 24 Left 906319272 1:44806503-44806525 CCAGCATGGAGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 906319290 1:44806550-44806572 GGTCGGGCCTCATCAATGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 47
906319272_906319289 23 Left 906319272 1:44806503-44806525 CCAGCATGGAGCCCCGGCGCGAG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 906319289 1:44806549-44806571 CGGTCGGGCCTCATCAATGCTGG 0: 1
1: 0
2: 0
3: 0
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906319272 Original CRISPR CTCGCGCCGGGGCTCCATGC TGG (reversed) Exonic
904744473 1:32702634-32702656 GCCGCGCCGGGGCTCCGGGCTGG + Exonic
904788301 1:32998840-32998862 CTGGGGCCTGGGTTCCATGCAGG + Intergenic
906319272 1:44806503-44806525 CTCGCGCCGGGGCTCCATGCTGG - Exonic
912385316 1:109268506-109268528 CACAGGCCGGGGCTCCATGGTGG + Intronic
915271850 1:154759183-154759205 CTGGCGCGGGGGCCCCAAGCTGG + Intronic
917744606 1:177995632-177995654 CTGGTGCCTAGGCTCCATGCAGG - Intergenic
1063379344 10:5574676-5574698 CTCGCGGCGGGACCCCAGGCAGG - Intergenic
1067042304 10:42961611-42961633 CTCGAGGTGGGGCTCCATGGGGG - Intergenic
1069526876 10:69180325-69180347 CTCCCGGCGGGGCGCCAGGCTGG + Exonic
1070609964 10:77926503-77926525 CCGGCGCTGGGGCTCCATGGTGG + Exonic
1076417323 10:130301011-130301033 CTGGCCCCAGGGCCCCATGCGGG + Intergenic
1076726729 10:132417341-132417363 CGCGCGCTGGGGTTCCATGGAGG + Exonic
1076809281 10:132878376-132878398 CTGGCCCTGGGGCTCCCTGCTGG + Intronic
1077030271 11:462349-462371 CACACGCAGGGGCTCCCTGCTGG - Intronic
1080551412 11:33376422-33376444 CACCCGCCGCGGCTCCATGCGGG + Intergenic
1080601863 11:33828963-33828985 CCCGCTGCGGGGCTCCAGGCTGG - Intergenic
1083374092 11:62205621-62205643 CTCGCGCCCGAGCCTCATGCTGG - Intergenic
1089479254 11:118791680-118791702 CTCGGGGCGCGCCTCCATGCAGG + Intergenic
1091306400 11:134539007-134539029 GTCGCCCCGGGGTTCCAGGCAGG - Intergenic
1108542061 13:51453621-51453643 CTCGCGCCGGGGCGGCGCGCCGG - Intronic
1113403580 13:110018148-110018170 CTCCGGCCGTGGTTCCATGCTGG - Intergenic
1114265636 14:21071137-21071159 CACGAGCCGGAGCTCCCTGCAGG + Intronic
1119905512 14:78298232-78298254 CCCATGCCGGGGCTCCAGGCTGG + Intronic
1120253699 14:82091243-82091265 CCCAAGCTGGGGCTCCATGCTGG + Intergenic
1122822968 14:104356289-104356311 CCCGCCCCTGGGCTCCATGTAGG + Intergenic
1128554395 15:68621334-68621356 CTTGCTCCAGGTCTCCATGCTGG - Intronic
1130515316 15:84621809-84621831 CTTCAGCCGGGGCTCCATTCTGG + Exonic
1131047517 15:89325630-89325652 CTGGGGCCCGGGGTCCATGCAGG + Exonic
1132870238 16:2112572-2112594 CACGCCCCGGGCCTCCATTCAGG + Intronic
1133315989 16:4884398-4884420 CTCGCGCTCGGCCTCCCTGCGGG + Exonic
1134522301 16:14924363-14924385 CACGCCCCGGGCCTCCATTCAGG - Intronic
1134709971 16:16323014-16323036 CACGCCCCGGGCCTCCATTCAGG - Intergenic
1134949632 16:18345631-18345653 CACGCCCCGGGCCTCCATTCAGG + Intergenic
1134957566 16:18389145-18389167 CACGCCCCGGGCCTCCATTCAGG + Intergenic
1135712623 16:24730142-24730164 CTCGCGCCGGGGCCGGATGGGGG - Intronic
1136451222 16:30355253-30355275 CTTGCGCCAGGGCTACATCCGGG + Exonic
1138370054 16:56519710-56519732 CTGGGGCCCGGGCTCCCTGCGGG + Intronic
1139534653 16:67563536-67563558 CTCGCGCCCGGGTTCCTGGCCGG + Intronic
1143246124 17:5486811-5486833 CCCGCGCCCGCGCTGCATGCTGG - Intronic
1143670594 17:8393218-8393240 CTCCCGCTGGCCCTCCATGCTGG - Exonic
1144854110 17:18258590-18258612 CGCGTGCCGGGCCTCCCTGCAGG - Intronic
1145381967 17:22391719-22391741 CTGGCGCTGGGGCTGCGTGCAGG + Intergenic
1145382441 17:22394083-22394105 CTGGCGCTGGGGCTGCGTGCAGG + Intergenic
1145384566 17:22404401-22404423 CTGGCGCTGGGGCTGCGTGCAGG + Intergenic
1146901447 17:36592020-36592042 GTCGCGCCACCGCTCCATGCCGG - Exonic
1147617152 17:41836265-41836287 CCCCCGCCCGGGCTCCAGGCGGG - Intronic
1148156825 17:45429548-45429570 CTTGCGCCCCGGCTCCGTGCGGG + Intronic
1150283056 17:63940551-63940573 TGCGCTCAGGGGCTCCATGCTGG - Exonic
1150388537 17:64778329-64778351 CTCGAGCCCAGGCTCCCTGCGGG + Intergenic
1150790926 17:68199619-68199641 CTCGCGCCCCGGCTCCGTGCGGG - Intergenic
1151538091 17:74749768-74749790 CTCGCGCCGGGGCTCCACACAGG - Intronic
1152404103 17:80086758-80086780 CTTGGGTCGGGGATCCATGCTGG + Intronic
1152880100 17:82809544-82809566 TTAGCGCGGGGGCTCCAAGCAGG + Intronic
1153900563 18:9614368-9614390 CCCGCGCCGGGACCCCACGCCGG + Intronic
1157810526 18:50692250-50692272 CTCACCCAGAGGCTCCATGCAGG + Intronic
1161264660 19:3358766-3358788 GTCCCGCAGGGGCTCCAGGCAGG - Intergenic
1163493419 19:17630668-17630690 CTCGCTCCAGGGCACCGTGCAGG + Exonic
1164179724 19:22807726-22807748 CTCGGGCTGGGGCCCCCTGCAGG + Intergenic
1168403137 19:56097678-56097700 CTCGCGCCGTGCCTGCACGCAGG - Intronic
925008970 2:467902-467924 CTCACGCCGGGGGCCCAGGCAGG + Intergenic
925750884 2:7090036-7090058 CTGGGGGCGGGGCTCCCTGCAGG - Intergenic
930011407 2:46940992-46941014 CGGGCGCCGGGGCTCCGCGCGGG + Intronic
937931150 2:127205941-127205963 CTCCCGCCAGGACTCCATGTTGG + Intronic
941516839 2:166490968-166490990 CTGGCCCTGGGGCTCCATGTTGG - Intronic
943133162 2:183881466-183881488 ATAGTGCCTGGGCTCCATGCTGG + Intergenic
1174481270 20:50833140-50833162 CTCAGGCAGGGGCTCCAGGCAGG + Intronic
1181011408 22:20043042-20043064 ATGGAGCCTGGGCTCCATGCCGG - Intronic
1184302585 22:43570906-43570928 CCCGCCCCAGGGCTCCATGGTGG - Intronic
1184726599 22:46350949-46350971 CTCGCGGGCGGGCTCCATGGAGG - Intronic
954384204 3:50236005-50236027 CTCGGGCCTGGGCTGCAGGCGGG - Exonic
954879527 3:53823960-53823982 CCCGTGCCAGGGCTCCAGGCCGG + Exonic
962708587 3:138067598-138067620 CTTGGGCCGGGGCACCATCCTGG + Exonic
964726439 3:159818743-159818765 CTAGAGCAGGGCCTCCATGCTGG - Intronic
964749175 3:160038951-160038973 GTCGCTGCGGGGCTCCAGGCTGG + Intergenic
969313643 4:6368761-6368783 CTCTCCCCGGGTCTCCTTGCTGG + Intronic
1002277531 5:178113656-178113678 CTCGGGCCGGGACTGCGTGCCGG - Exonic
1002455465 5:179343842-179343864 CCCGAGCAGGGGCTCCACGCGGG + Exonic
1002645096 5:180649076-180649098 CGCGCGCCGGAGATCCATCCCGG - Intronic
1007181406 6:39931851-39931873 CTCCCTCTGAGGCTCCATGCAGG - Intronic
1007704845 6:43784332-43784354 CTCAGGCCGGGGCTCCCTGAGGG + Intronic
1017877703 6:158537398-158537420 GACGCGGCGGGGCGCCATGCGGG + Intronic
1018391254 6:163343481-163343503 CCCGCGCTTGGGCTCCCTGCCGG + Intergenic
1020260163 7:6526555-6526577 CCCGCGCAGGGCCTCCTTGCTGG - Exonic
1027592761 7:80135532-80135554 CTCGCGCCTGGGCTCTTTGCTGG - Intronic
1029622568 7:101699163-101699185 ATCGGGCCAGGGCTCCCTGCAGG + Intergenic
1032069335 7:128794208-128794230 CTTGCCCCGGGGCTCCTTGGGGG + Intronic
1033288578 7:140062598-140062620 CGCGCACCAGGGCTCCAAGCCGG - Exonic
1034197789 7:149261797-149261819 CCCTCGCCGGGGCTCCAGTCCGG - Intergenic
1034433297 7:151051441-151051463 CTGGCTCTGGGGCTCCGTGCTGG + Intronic
1035243964 7:157550484-157550506 CTCGCGCCCGGCCTCCCTGGTGG - Intronic
1049616423 8:143577588-143577610 CCAGCGCCGGGGCTCCGTGCTGG - Intronic
1049802150 8:144522847-144522869 CTCGGGCCGGGGCTCGCTGCCGG + Exonic
1049896155 9:113591-113613 CCCTCCCCGGGGCTCCCTGCGGG - Intergenic
1051353209 9:16217775-16217797 TTCCAGCCGAGGCTCCATGCTGG - Intronic
1057054529 9:91950288-91950310 CTTGCGCCGGCGCCCCCTGCCGG + Intergenic
1060219929 9:121759106-121759128 CTCGGGCCCTGCCTCCATGCAGG - Intronic
1061415675 9:130445598-130445620 CTCGCGGCGGGGTTTCCTGCTGG + Intronic