ID: 906319881

View in Genome Browser
Species Human (GRCh38)
Location 1:44809227-44809249
Sequence CTGAGTGAGTGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1245
Summary {0: 1, 1: 0, 2: 5, 3: 107, 4: 1132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906319881_906319889 11 Left 906319881 1:44809227-44809249 CCCTCCTCCCTCCACTCACTCAG 0: 1
1: 0
2: 5
3: 107
4: 1132
Right 906319889 1:44809261-44809283 GGCCTCACTGCTAGAAGAAGAGG 0: 1
1: 0
2: 0
3: 15
4: 173
906319881_906319891 30 Left 906319881 1:44809227-44809249 CCCTCCTCCCTCCACTCACTCAG 0: 1
1: 0
2: 5
3: 107
4: 1132
Right 906319891 1:44809280-44809302 GAGGAACAGATGACCTGTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 118
906319881_906319888 -10 Left 906319881 1:44809227-44809249 CCCTCCTCCCTCCACTCACTCAG 0: 1
1: 0
2: 5
3: 107
4: 1132
Right 906319888 1:44809240-44809262 ACTCACTCAGCTTGGTATTGAGG 0: 1
1: 0
2: 1
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906319881 Original CRISPR CTGAGTGAGTGGAGGGAGGA GGG (reversed) Intronic
900361033 1:2289245-2289267 CTGACAGAGAGGAGGCAGGAGGG - Intronic
900372481 1:2338087-2338109 CTGAGTGAGTGGAGGGGCGCTGG + Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900498167 1:2986011-2986033 GTGAATGAATGGATGGAGGATGG - Intergenic
900509496 1:3051813-3051835 GTGGGTGAGTGTATGGAGGATGG - Intergenic
900509540 1:3051982-3052004 GTGGGTGAGTGGATGGAAGATGG - Intergenic
900515093 1:3077996-3078018 CTGAGTGTGGGGAGGCAGTAGGG - Intronic
901435190 1:9243190-9243212 CAGAGGGGGTGGTGGGAGGAGGG + Intronic
901636067 1:10670762-10670784 GTGAGGTAGAGGAGGGAGGAGGG - Intronic
901922188 1:12545268-12545290 TTGAATGAATGAAGGGAGGAAGG - Intergenic
902255422 1:15186070-15186092 CTGAGTGGGAGGAGGGGGCAGGG - Intronic
902599040 1:17528624-17528646 ATGAATGAATGGATGGAGGATGG - Intergenic
902613694 1:17612084-17612106 GAGAATGAATGGAGGGAGGATGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
903178793 1:21595250-21595272 CTGCACCAGTGGAGGGAGGAGGG - Intergenic
903215400 1:21840982-21841004 ATGAGTGGATGGAGAGAGGAAGG - Intronic
903277392 1:22230905-22230927 ATGAGTGGGTGGATGGATGATGG - Intergenic
903277442 1:22231099-22231121 ATGAGTGGGTGGATGGATGATGG - Intergenic
903294591 1:22335705-22335727 CTGAGCAGGAGGAGGGAGGAGGG - Intergenic
904036911 1:27563907-27563929 CTGAATGAGTGGTGGAGGGAGGG + Intronic
904082971 1:27883586-27883608 CAGAGTGAGTGGAGGAAGATGGG - Intronic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
904918333 1:33986250-33986272 TTGAGAGAGTAGAGGTAGGAGGG - Intronic
904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG + Intergenic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905519898 1:38589606-38589628 CTGGGGGAGTGGAGGGTGTAGGG - Intergenic
905665666 1:39761607-39761629 GTGAGTGGGAGGAGGGCGGAGGG - Intronic
905788481 1:40776614-40776636 CTCAGGGATTGGAGGGAGGCCGG - Intergenic
905874692 1:41424257-41424279 CTGAGTGAGTGGCGGGGGTGTGG + Intergenic
906134920 1:43491888-43491910 CTGAGTTTGTGGGGGGTGGAAGG + Intergenic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906658274 1:47564513-47564535 ATGAGTGAGTGGGGGGATGAGGG + Intergenic
906735975 1:48128574-48128596 CTGAGAAATTGGAGGGAGCAAGG + Intergenic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
906914127 1:49989992-49990014 CTTAGTGAGTGAGGGGTGGAAGG + Intronic
907380421 1:54082706-54082728 GAAAGTGAGGGGAGGGAGGAAGG + Intronic
907523137 1:55038191-55038213 CTGAGGGAGGTGGGGGAGGAAGG - Intergenic
907663903 1:56417471-56417493 ATAAGTGAGTTGGGGGAGGAGGG - Intergenic
907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG + Intergenic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908515147 1:64884640-64884662 CAGTGTGAGTGAAGGCAGGAGGG - Intronic
909030320 1:70531506-70531528 TTGAGTGGGAGGTGGGAGGAAGG + Intergenic
909356657 1:74717348-74717370 TTGACTGAGTGGATTGAGGAAGG - Intronic
909897822 1:81095395-81095417 CTCAGAGAATGGAGGCAGGATGG + Intergenic
910791497 1:91055666-91055688 CTGAGTCAGTGGACTGGGGAAGG - Intergenic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
911462021 1:98203107-98203129 CTAGGTGAGTGGACTGAGGATGG - Intergenic
911647520 1:100352410-100352432 CTGAGGGAGGGCGGGGAGGAAGG + Intronic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
911794996 1:102064414-102064436 AAGAGTGGGTGGCGGGAGGAGGG + Intergenic
912435884 1:109660695-109660717 CTGAGGGATTTGGGGGAGGATGG + Intronic
912667214 1:111593072-111593094 CTGAGTGGGTGGAGGGGGCGGGG + Intronic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
912832716 1:112967928-112967950 CAGAGGGAGGGTAGGGAGGAAGG - Intergenic
912949461 1:114110782-114110804 CTGAGGTAGTGCAGCGAGGATGG - Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913074831 1:115333124-115333146 CTAAGTGAGCCCAGGGAGGATGG - Intronic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913527497 1:119708128-119708150 CTGATTGAGTGGATGAATGAAGG + Intronic
914976651 1:152370576-152370598 CGGGGTGGGGGGAGGGAGGAGGG + Intergenic
915166693 1:153951960-153951982 CTGCCTGACTGGAGGGATGAAGG - Intronic
915287656 1:154863081-154863103 CTGAGTGACAGGAGAGGGGAAGG - Intronic
915851745 1:159331748-159331770 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
915875681 1:159609742-159609764 CGGAGTGGGGGGAGGGTGGAGGG + Intergenic
915927326 1:160032570-160032592 CAGAGTGATTGGAGAGCGGATGG - Intergenic
915932324 1:160068353-160068375 CTGAGTGGGGGGTGGGGGGATGG + Intronic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
915972324 1:160363373-160363395 TTGAGGGAGGGGAGGGAGGTTGG - Intergenic
916481621 1:165219435-165219457 TGTTGTGAGTGGAGGGAGGAGGG + Intronic
916564751 1:165964795-165964817 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917320964 1:173781023-173781045 GAGAGAGAGAGGAGGGAGGAGGG + Intronic
917500174 1:175578571-175578593 ATGAATGAGAGAAGGGAGGAGGG + Intronic
917562008 1:176168399-176168421 CTGGGTGGGTGGGGGGAGTACGG + Intronic
917665117 1:177218715-177218737 CTGACTTAGGGGAGAGAGGAAGG + Intronic
917961597 1:180149948-180149970 ATGTGTGTGTGGAGGGAGAAGGG - Intergenic
918002336 1:180509069-180509091 CTGAGTTGGTGGGGGGAGGTGGG + Intergenic
918224622 1:182470368-182470390 ATGAGTGAGGGGAGGGAAGTAGG - Intronic
918845169 1:189600522-189600544 CTGAGTCAGTGGACTGGGGAAGG - Intergenic
919289726 1:195614169-195614191 TTGGGTGAGGGGAGGGGGGAAGG - Intergenic
919506594 1:198406456-198406478 CTCAGAGGGTGGAGGGGGGAGGG + Intergenic
919640479 1:200040397-200040419 CTGAGTGAGTTGGGGGTGGGAGG + Intronic
919758754 1:201083323-201083345 CTGAGGGAGGGGACAGAGGATGG + Intronic
919933618 1:202237155-202237177 CTGAGAGAGTGCAGGGAGGCAGG - Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920387401 1:205578722-205578744 CTGAGAGAGGGGAGGGGGAAAGG - Intronic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
920852882 1:209640592-209640614 CACAGTGAGTGGTGGGAGGTGGG - Intronic
921136294 1:212262086-212262108 GTGAGTGAGTGGGGCTAGGAAGG + Intergenic
921260453 1:213381459-213381481 CTGAATGAGAGGAGGGGGGCAGG + Intergenic
921411094 1:214836926-214836948 CTGAATGAATGAAGAGAGGAGGG - Intergenic
921624199 1:217359956-217359978 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
922343621 1:224677736-224677758 CTGTCTGAGTGCAGGGAGGTGGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922585630 1:226733097-226733119 CTGTGTGAGTGGGGTGAGCAAGG + Intronic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
922978619 1:229805764-229805786 CTAAGTGCTTGGAGGGAGGAGGG + Intergenic
923049674 1:230381893-230381915 CTGTGAGAGTGGATGTAGGATGG - Intronic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
924166624 1:241289844-241289866 CTGAGTGAGAAGAGGAAAGATGG + Intronic
924784512 1:247183128-247183150 CTGAGTGTGGGGTGGGAGGAAGG - Intergenic
924815737 1:247440349-247440371 CTGAGTGAGTAAACGGGGGACGG + Intronic
1062974388 10:1672661-1672683 GTGCGTGCGTGGAGGGAGGCAGG - Intronic
1062974411 10:1672742-1672764 GTGTGTGCGTGGAGGGAGGGAGG - Intronic
1063362402 10:5469160-5469182 GGGAGGGAGTGGAGGGAGAAAGG - Intergenic
1063379690 10:5576648-5576670 CTGTGTGTGTGCAGGGAGTAGGG - Intergenic
1063581510 10:7312077-7312099 TGGAGTGGGGGGAGGGAGGAGGG + Intronic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064817991 10:19288695-19288717 CAGAATGAGAGGAGGAAGGATGG - Intronic
1065838681 10:29682002-29682024 CTGAGGGAGTGGGGACAGGAAGG - Intronic
1066241356 10:33538866-33538888 GTGAGTGAGTAAAGGGAGAAAGG + Intergenic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1066950243 10:42110747-42110769 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067053466 10:43038327-43038349 CTGGGAGGGTGGAGGGAGGCGGG + Intergenic
1067084035 10:43228869-43228891 CTGAGTAAGTGAAAGAAGGAAGG + Intronic
1067284766 10:44899469-44899491 CAGAGTGTGTGGAGGAAGGATGG + Intergenic
1067357654 10:45545799-45545821 CTGGCTGAGTGAAGGGAAGAAGG - Intronic
1067438370 10:46294411-46294433 CTGGGAAAGTGGAGGGAGGCAGG + Intronic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1067830108 10:49606870-49606892 TTGAATGAGTAGAGGAAGGAAGG - Intergenic
1067833695 10:49624892-49624914 ATGAGTGGGTGGTGGGTGGAAGG + Intronic
1067932362 10:50575604-50575626 CTTTGTGTGTGGGGGGAGGAGGG - Intronic
1068443450 10:57089754-57089776 CTGAGGGAGTGAAGGGCTGATGG + Intergenic
1068459211 10:57304971-57304993 GAGAGTGAGTGGTGGGAGGAAGG - Intergenic
1068577724 10:58703267-58703289 TTGAGTCTGTGGTGGGAGGATGG - Intronic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1070331044 10:75417570-75417592 CTCAGAGTGAGGAGGGAGGAAGG - Intergenic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070793475 10:79203436-79203458 CTGAGTGGGAGGAGGGAGTGTGG - Intronic
1071415153 10:85434139-85434161 CTGTGTGGGTTGTGGGAGGATGG - Intergenic
1071552965 10:86581501-86581523 CTCTGTGAGTAGAGGGAGGTTGG - Intergenic
1072211839 10:93253259-93253281 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1072253540 10:93600545-93600567 CCGAATGGGTGGAGGGAGGGAGG - Intronic
1072724268 10:97801790-97801812 CTGGGTGAGAAGGGGGAGGATGG + Intergenic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073531013 10:104232100-104232122 CGGAGGGAGAGGAGGGAGGAGGG + Intronic
1073667092 10:105545784-105545806 TTGAGTCAGTGAATGGAGGAAGG + Intergenic
1073667093 10:105545788-105545810 GTCAGTGAATGGAGGAAGGAAGG + Intergenic
1073777082 10:106798429-106798451 GTGGGTGGGGGGAGGGAGGAAGG - Intronic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074111266 10:110424182-110424204 GTGGGTTAGTGGAGGGAGGTGGG + Intergenic
1074123741 10:110512162-110512184 CTGCGTAGGTGGAGGAAGGAAGG + Intergenic
1074436950 10:113442351-113442373 CTGAGGTAGTGGAGAGAGAAAGG - Intergenic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075489977 10:122858403-122858425 TTGGGTGAGGGGAGGGGGGAGGG + Intronic
1076007084 10:126956435-126956457 CTGAGTGAGTGGGAGGAGAGGGG + Intronic
1076135138 10:128040484-128040506 CAGGGCGAGTGGAGGGTGGATGG + Intronic
1076303852 10:129449469-129449491 GTGAGTGAGTGAAGGAGGGAGGG + Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076429482 10:130391588-130391610 CCTAGTGAGTGGAGCGAGGGAGG + Intergenic
1076845114 10:133066020-133066042 ATGAGTGGGTGGATGGGGGAGGG + Intergenic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077423033 11:2461834-2461856 CTGGGTGGGTGGAGAGAGAAAGG + Intronic
1077533146 11:3106663-3106685 GTGAGTGACGGGAGGGAGGATGG - Intronic
1078257865 11:9675411-9675433 GAGAGAGAGAGGAGGGAGGAGGG + Intronic
1079083505 11:17429720-17429742 GAGAGTGGGTGGTGGGAGGAGGG + Intronic
1079140077 11:17802745-17802767 CTGATTGAAGGGAGGGAGGGAGG - Intronic
1079244786 11:18744098-18744120 CTGAGGGCGGCGAGGGAGGAGGG + Exonic
1079863678 11:25707547-25707569 ATAAGTGAGTGGAAGGAGGCAGG - Intergenic
1080684629 11:34504851-34504873 CTGAGAAAGAGGAGGGAGGGTGG + Intronic
1080695202 11:34597690-34597712 CTGAGGGACAGGAGAGAGGAGGG + Intergenic
1081207351 11:40291677-40291699 GTGCGTGGGTGGAGGGAGAAAGG - Intronic
1081654977 11:44851139-44851161 GTGAGTGCGTGGAGAGAAGAGGG + Intronic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1081662561 11:44896916-44896938 GTGGGTGGGTTGAGGGAGGAAGG + Intronic
1081671990 11:44947563-44947585 CTGGGTGAGTTGGGGGAGGCAGG + Intronic
1081773938 11:45665327-45665349 CGGAGGAAGAGGAGGGAGGAGGG - Exonic
1081995186 11:47359395-47359417 ATGAGTGAGTGGAGGGACCCTGG + Intronic
1082773088 11:57223938-57223960 TTGAGTGAGTGGGTGGATGAGGG - Intergenic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1082834173 11:57639769-57639791 CTTAGGGAGTGCAGGGAGAAAGG - Intergenic
1083293668 11:61703652-61703674 GTGAGTGGGTAGATGGAGGATGG + Intronic
1083673797 11:64314456-64314478 ATGAGTGAGTGAAGAGACGAAGG - Intronic
1083724448 11:64620969-64620991 ATGAGTGAGTGTAAGGAGGAGGG + Intronic
1084036703 11:66515709-66515731 CTGAGTGACTGGATGGACAAAGG - Exonic
1084162709 11:67358646-67358668 CTGAGTGAGTAGGGGGCGGGTGG - Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084322524 11:68381551-68381573 CTGCATGCGTGCAGGGAGGAAGG + Intronic
1084461884 11:69300800-69300822 ATGAGTGGGTGGATGGATGAAGG + Intronic
1084475660 11:69387199-69387221 CTGACCGAGCAGAGGGAGGAAGG - Intergenic
1084494005 11:69493647-69493669 AGGAGTGAGTGGATGGAGGACGG - Intergenic
1084507016 11:69574725-69574747 CTGAGTGGATGGTGGGAGGGAGG - Intergenic
1084682364 11:70673784-70673806 CCTAGTGAGTGGAGGGAGGTTGG - Intronic
1084713052 11:70856087-70856109 GTGGGTGGGTGGTGGGAGGATGG + Intronic
1084739924 11:71133129-71133151 GTGAATGAGTGGATGGAGGGAGG + Intronic
1084739926 11:71133133-71133155 ATGAGTGGATGGAGGGAGGGAGG + Intronic
1084870018 11:72092119-72092141 GAGAGTGAGGGTAGGGAGGAAGG - Intronic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1085084303 11:73656487-73656509 CTGAGTGAGCAAAGGAAGGAAGG + Intronic
1085193554 11:74650698-74650720 TTGAATGAGTGGACTGAGGAGGG - Intronic
1085261638 11:75208857-75208879 CTGAATGAATGAAGGAAGGAAGG - Intergenic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1085696008 11:78705274-78705296 CAGAGTCAGTGGAGGGAGAGAGG + Intronic
1085699002 11:78729685-78729707 CTCACCGAGTGGAGGGAAGATGG + Intronic
1085750852 11:79160069-79160091 GTGAGTGAGTGCATGGAGAAGGG - Intronic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087527154 11:99330164-99330186 GGGAGGGAGGGGAGGGAGGAGGG + Intronic
1087669576 11:101089679-101089701 TTGAGGGAGAAGAGGGAGGAAGG + Intronic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1088056918 11:105594067-105594089 CAGAATGAGTGGAAGAAGGAAGG - Intergenic
1088339331 11:108745134-108745156 GGGAGTGAGTGGAAGGAGAAGGG - Intronic
1088423439 11:109674211-109674233 CTGAGTGAGGGGATGGACAATGG - Intergenic
1088816074 11:113421918-113421940 CTGAGTGTGTCAGGGGAGGAGGG - Intronic
1089190107 11:116647583-116647605 GTGAGTGAGTTGAAGAAGGAAGG + Intergenic
1089735934 11:120550283-120550305 TGGAGTGAGTGGGAGGAGGATGG + Intronic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090405795 11:126475247-126475269 CTGAGCCAGTGGAGTCAGGACGG - Intronic
1090406482 11:126478829-126478851 CTGCGTGAGTAGTGGGAGGGAGG + Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090761468 11:129840408-129840430 ATGAGGAAGTGCAGGGAGGAGGG + Intronic
1090877256 11:130801727-130801749 CTGGGTGGGTGGAGGAAGGTGGG + Intergenic
1090915268 11:131157395-131157417 GTGAGAGAGAGAAGGGAGGAAGG - Intergenic
1091747167 12:2999802-2999824 CTGAGTGTGAGGAGCGGGGAAGG - Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092171426 12:6375948-6375970 CTGAGTGAGTAGAGGCAGGTGGG + Intronic
1092686952 12:11059154-11059176 ATGAGAGAGAGGAGGGAGAATGG - Intronic
1092923187 12:13250604-13250626 GTGAGTCAGTGGACTGAGGAGGG - Intergenic
1092996979 12:13959711-13959733 CTGATTGAATGAAGGGAGAAGGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094292180 12:28863807-28863829 GGGAGGGAGGGGAGGGAGGAAGG - Intergenic
1095206385 12:39443766-39443788 CTGACTCCGGGGAGGGAGGAGGG - Intergenic
1095443427 12:42260699-42260721 TTCAGTGAGTCCAGGGAGGATGG - Intronic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1095928596 12:47604192-47604214 CTTACTGTGTGGAGGGAGGGGGG + Intergenic
1096124593 12:49110217-49110239 CTGGGTGAGGGGTGGGAGGGAGG + Intronic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096518405 12:52170809-52170831 ATTAGGGAGTGAAGGGAGGAGGG - Exonic
1096626018 12:52896499-52896521 GTGACTGAGTGGAGTGGGGAAGG + Intergenic
1096792027 12:54051469-54051491 GTGAGTGAGGGGGCGGAGGAAGG - Intronic
1096879721 12:54657978-54658000 CTAAGTGAGAGGAGTGATGAAGG + Intergenic
1097083808 12:56453053-56453075 CTGGGTGAGTGAAGGGAGAGGGG - Exonic
1097178331 12:57156460-57156482 CTGAGTGGGTGGATGGGGGCTGG - Intronic
1097223416 12:57463191-57463213 CTGAGTGAGGGGAGGGGTAAGGG - Intronic
1098153957 12:67577776-67577798 CAGAGTGAGAGGTGGTAGGAGGG + Intergenic
1098716119 12:73830074-73830096 CTGAGGGAGAGAAGGGAGGGTGG - Intergenic
1098917866 12:76275899-76275921 CAGAGAGAGGGGAGGGAGGAAGG + Intergenic
1099541945 12:83922108-83922130 CTGAGTGAGTGGTGAGTGAATGG - Intergenic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1101099803 12:101380493-101380515 TTGAATGAGTGGAGGGTAGAAGG + Intronic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101541582 12:105670431-105670453 TGGAGTGAGTTGAGTGAGGAAGG + Intergenic
1102214574 12:111151578-111151600 CTGAATGCGTGGAGGGCAGACGG + Intronic
1102243346 12:111339354-111339376 CTGAGGCAGAGGAGGGAGGGAGG - Intronic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1102989379 12:117303786-117303808 CTGAGTTTGTGCAGGGAGGATGG + Intronic
1102991683 12:117320716-117320738 CATAGTGAGTGGAGGGAGAGTGG - Intronic
1103884621 12:124191331-124191353 AGGAGTGAGTGGGGGGAGGGTGG - Intronic
1104187431 12:126446144-126446166 CTCAGTGACTGGATGGAGGGTGG + Intergenic
1104307278 12:127621175-127621197 CTTAGTGAGTGGACTGAGCACGG + Intergenic
1104357642 12:128101752-128101774 GTGAGTGAGTGAAGGGTGAAGGG - Intergenic
1104460718 12:128953661-128953683 TTGTGTGTGTGGAGTGAGGAAGG + Intronic
1104581111 12:130011453-130011475 CTGAGTGTGTGCACGGAGGGTGG - Intergenic
1104638668 12:130453402-130453424 CTGAGAGAGAGGATGGTGGAAGG - Intronic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104856455 12:131904569-131904591 CTGGGTGAGTGGCTGGGGGATGG + Intronic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1104919860 12:132285149-132285171 CTGAGGGAGGGCAGGCAGGAGGG - Intronic
1105428116 13:20313177-20313199 CTGAGTGGGATGAGGGATGAAGG + Intergenic
1105774040 13:23639752-23639774 CTGAGGCAGTGGTGGGAGGGAGG + Intronic
1106327430 13:28707400-28707422 TGGAGTGGGGGGAGGGAGGAGGG + Intronic
1106900610 13:34351423-34351445 ATGAATGAGTAGAGGGATGATGG + Intergenic
1107358603 13:39594967-39594989 TGGGGTGGGTGGAGGGAGGAGGG + Intronic
1107584911 13:41835081-41835103 GAGGGTGAGAGGAGGGAGGAGGG + Intronic
1108327419 13:49347872-49347894 CCGAGTGAGGGAAGGAAGGAAGG - Intronic
1108441898 13:50462708-50462730 CTCAGGGAGTGGGGGCAGGAAGG + Intronic
1109400922 13:61827853-61827875 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1110295245 13:73856527-73856549 CTGGGTGCGTGTATGGAGGAGGG - Intronic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110565212 13:76950934-76950956 GTGAGAGAGTGGAGGGAGTTTGG - Intronic
1110705180 13:78596410-78596432 CTGAGTGAGTGAGGGGAGGGCGG + Intergenic
1111616765 13:90669845-90669867 TGGGGTGAGTGGAGGGCGGAGGG + Intergenic
1111715236 13:91871350-91871372 TTGAGAGAGGGGTGGGAGGAGGG + Intronic
1111753686 13:92365407-92365429 ATGAGTGAGTGGTGAGTGGATGG + Intronic
1112242806 13:97698768-97698790 TAGAGTGAATGGATGGAGGATGG + Intergenic
1112399681 13:99065142-99065164 CTCACTGTGTGGAGAGAGGAAGG + Intronic
1112442924 13:99437793-99437815 TTGGCAGAGTGGAGGGAGGAAGG - Intergenic
1112734641 13:102402329-102402351 AAGAGTGAGAGGAAGGAGGAAGG - Intergenic
1112845885 13:103643189-103643211 AAGGGTGAGTGGAGGGAGGTTGG - Intergenic
1112945086 13:104918626-104918648 AAGAGAGAGTGGAGGGCGGAAGG - Intergenic
1113072909 13:106438823-106438845 ATGGATGGGTGGAGGGAGGAAGG + Intergenic
1113433117 13:110267254-110267276 ATGACCCAGTGGAGGGAGGAGGG + Intronic
1113576788 13:111400509-111400531 TAGAGAGAGAGGAGGGAGGAGGG - Intergenic
1113618074 13:111695102-111695124 CGGAGAGAGTGGAGGGAGAGCGG - Intergenic
1113623607 13:111780363-111780385 CGGAGAGAGTGGAGGGAGAGCGG - Intergenic
1113767656 13:112891042-112891064 CTGGGTGGCTGGAGGGAGCAGGG - Intergenic
1113971265 13:114192064-114192086 GTGGGTGGGTGGGGGGAGGAAGG + Intergenic
1114399017 14:22392345-22392367 CTGAGTGAGTGAAGACAGGTAGG - Intergenic
1114450093 14:22819683-22819705 CTGAGTCAGGGGAGAGGGGAAGG + Intronic
1114532221 14:23403210-23403232 CGGAGTGAGTGGAGGGAGAAGGG + Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1115965583 14:38884101-38884123 ATGAGTGTGTGCATGGAGGAGGG + Intergenic
1116029181 14:39550342-39550364 CGGGGTGAGGGGAGGGAGGATGG - Intergenic
1116036462 14:39633679-39633701 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
1116133236 14:40887729-40887751 AAGACTCAGTGGAGGGAGGAAGG + Intergenic
1116455227 14:45112752-45112774 CTGAATGAGAGAAGGCAGGAAGG + Intronic
1116962805 14:50983993-50984015 CTGAGGGAGGGGAGGAGGGATGG + Intronic
1117279421 14:54223329-54223351 CTAAGTGAGTGAAGGATGGATGG - Intergenic
1117901035 14:60533611-60533633 TTGAGAGAGTGGAGGGAGTGAGG - Intergenic
1118012706 14:61626278-61626300 ATGAGTGAGAGGAGAGAGGATGG - Intronic
1118190015 14:63571748-63571770 TTGAATGAGTGGACGGAGTAAGG - Intergenic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118324104 14:64769833-64769855 CAGAGAGAGAGGAGGGAGCACGG - Intronic
1118692163 14:68350698-68350720 CTGATTTAGTGGAGGGGAGATGG + Intronic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1118935030 14:70279865-70279887 GAGAGTGGGGGGAGGGAGGAGGG + Intergenic
1119165434 14:72488754-72488776 CTGAGTGAGTGCTGGGCTGAGGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119745459 14:77040644-77040666 CTCACTGACTAGAGGGAGGAGGG - Intergenic
1119977263 14:79038943-79038965 TTTAATGAGTGTAGGGAGGATGG + Intronic
1120045064 14:79796453-79796475 AAGAGAGAGGGGAGGGAGGAAGG - Intronic
1120974441 14:90236265-90236287 GAGAGAGAGTGGAGGGAGGTAGG - Intergenic
1121055368 14:90847372-90847394 CTCAGGGAGTGGGGGCAGGAGGG + Intergenic
1121358210 14:93232350-93232372 CTGCCTGGGAGGAGGGAGGAAGG - Intergenic
1121537591 14:94701494-94701516 CAGAGTCAGTGCAGTGAGGAGGG + Intergenic
1121557703 14:94850848-94850870 AGGAAGGAGTGGAGGGAGGAAGG + Intergenic
1121627177 14:95394421-95394443 ATGAGTGAATGGAGGGTTGAAGG + Intergenic
1121676729 14:95759579-95759601 CAGAGTGAGAGGAGAGAGGGGGG - Intergenic
1121709905 14:96030154-96030176 CTGAGTGAGTGGACACAGAAGGG + Intergenic
1121936705 14:98026308-98026330 ATGAGTGAGTGGATGGTGGGTGG + Intergenic
1122145528 14:99686741-99686763 CTGAGTGTGTGGGGTGCGGAGGG + Intronic
1122329195 14:100901635-100901657 CAGAGTGAGTGGAAGGAGCGAGG - Intergenic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122748647 14:103916799-103916821 GTGAGTGGGTGGAGGGAGGGAGG - Intronic
1122805365 14:104253672-104253694 CTGAGGGAGTGGAGGGCTGGGGG + Intergenic
1122867600 14:104614518-104614540 ATGAGTGAGTGGGTGGATGAAGG + Intergenic
1122931197 14:104933698-104933720 CTGAGTGAGGGAAGGGCGGGAGG + Exonic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931268 14:104933869-104933891 CTGAGTGAGGGGAGGGCGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122958513 14:105083787-105083809 ATGGATGGGTGGAGGGAGGATGG - Intergenic
1123146803 14:106141237-106141259 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1123148947 14:106163145-106163167 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1123819160 15:24010332-24010354 TTGAGTGGGGGGAGGGGGGACGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124789982 15:32718189-32718211 GTGAGTGGGCGGAGGGAAGAGGG + Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125477345 15:40055972-40055994 CTGAGTCAGGTGTGGGAGGAGGG + Intergenic
1125685338 15:41560095-41560117 CTGAGAGGGTGAAGGGAGCAGGG + Intronic
1125718774 15:41835220-41835242 CTGGGTGAGTGGAGGTGGGGTGG + Exonic
1125929510 15:43590171-43590193 CTGCGCGAGCGGAGGGAGGCGGG - Exonic
1125942677 15:43690003-43690025 CTGCGCGAGCGGAGGGAGGCGGG - Intergenic
1126348067 15:47717400-47717422 CCGAGTGCGTGGAGGGAGCCAGG + Intronic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1127877725 15:63125075-63125097 CTTAGGGAGTCCAGGGAGGAAGG + Intronic
1127908107 15:63392191-63392213 AGGAGTGAGTGGGAGGAGGATGG - Intergenic
1127922236 15:63503373-63503395 CAGAGCGAGAGGAGGAAGGAAGG - Intergenic
1127982920 15:64047169-64047191 GTGAGGGGGTGAAGGGAGGAAGG + Intronic
1128241016 15:66100984-66101006 GTGAGTGGGTGGTGGGTGGATGG + Intronic
1128332402 15:66764058-66764080 CTGAGTGAGTGGTGGGTGATTGG + Intronic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128575590 15:68772333-68772355 CAGATTCAGTGGAGGGAAGATGG - Intergenic
1128649306 15:69398824-69398846 CTGAGTCAGAGGAGGGCAGAGGG + Intronic
1128715967 15:69908255-69908277 ATGAGTGAGTGGGGGGTGGGTGG - Intergenic
1129187910 15:73921748-73921770 GTGAGTGAGTGGATGAATGAAGG + Intergenic
1129234269 15:74214349-74214371 TGGGGTGAGTGGAGGGAGGCAGG - Intergenic
1129414361 15:75367005-75367027 CTGAGCCAGTGAAGGGAGGAAGG + Intronic
1130048057 15:80461382-80461404 CAGAGGGAGTGAAGGGAGGCCGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130182297 15:81642861-81642883 GTGCGTGTGTGTAGGGAGGAGGG - Intergenic
1130764066 15:86852336-86852358 CTCAGTGTGTGGAGAGAGGGAGG - Intronic
1130843967 15:87726930-87726952 GTGAGTCAGAGGAGGGAAGATGG + Intergenic
1130850543 15:87789409-87789431 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1130859001 15:87869266-87869288 CAGAGTCAGTGGGGAGAGGAGGG + Intronic
1130905995 15:88241314-88241336 CTGAGTGAGTGACAGAAGGAGGG + Intronic
1131039550 15:89250545-89250567 TGGAGTGAGGGGAGGGGGGAGGG + Intronic
1131459960 15:92611021-92611043 ATGAGTGAGTGAAGGATGGATGG + Intergenic
1131798110 15:96041295-96041317 CTCAGAGAGTGGAGGGTGGAAGG + Intergenic
1132343510 15:101092753-101092775 CTCAGTGAGAGGAGGGAGACAGG + Intergenic
1132644692 16:993550-993572 GTGAGTGGGTGGATGGAGGATGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133063175 16:3188557-3188579 GTGAGTGAGAGGAGGGAGGCGGG + Intergenic
1133305220 16:4804195-4804217 AAGAGGGAGAGGAGGGAGGATGG + Exonic
1133308770 16:4829136-4829158 CTGAGGGAGTGGTGAGAGCAAGG - Intronic
1133728995 16:8562748-8562770 ATGAGTGAGTGAAGGAGGGAGGG + Intergenic
1134075653 16:11289638-11289660 CTAAGTAAATGGATGGAGGATGG - Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134183412 16:12065049-12065071 CTGAGTGTTGGGAGGGAGAAAGG + Intronic
1134224857 16:12381822-12381844 ATGGGTGAGTGGATGGATGATGG - Intronic
1134350595 16:13434279-13434301 CTGAGTCAGTGGACTGAGAAAGG - Intergenic
1134534081 16:15011285-15011307 CTGAGTAATTCGAGGGAGAAAGG + Intronic
1134779392 16:16882014-16882036 TTCGGTGAGGGGAGGGAGGAGGG - Intergenic
1134782415 16:16910184-16910206 GTGGGTGAGTGGATGGAGGGAGG + Intergenic
1134782416 16:16910188-16910210 GTGAGTGGATGGAGGGAGGTAGG + Intergenic
1134995968 16:18738999-18739021 CTGAGTGAATGGATAAAGGAAGG + Intergenic
1135686098 16:24499471-24499493 GTGCGTGTGTGGAGGAAGGAAGG - Intergenic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1135951013 16:26914116-26914138 CTGAGTGAATGGTGGGAGAACGG + Intergenic
1136026305 16:27471150-27471172 CTGAGTGCGGGGAAGGAGAATGG + Intronic
1136095215 16:27950715-27950737 CTAAGTGACTGAAGGGTGGAAGG - Intronic
1136221681 16:28833351-28833373 CTGAGTGAGTGGAGCGGGGTGGG + Exonic
1136618988 16:31415516-31415538 CTGGGTGTGTGGATGGAGGTGGG - Intronic
1136681277 16:31964437-31964459 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136690515 16:32025075-32025097 GTAATGGAGTGGAGGGAGGAGGG + Intergenic
1136692263 16:32040311-32040333 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136781589 16:32905949-32905971 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136791102 16:32968635-32968657 GTAATGGAGTGGAGGGAGGAGGG + Intergenic
1136792759 16:32983540-32983562 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1136877096 16:33870514-33870536 CTGAGTGGGAGCAGGGAGGAGGG - Intergenic
1136878712 16:33885297-33885319 GTAATGGAGTGGAGGGAGGAGGG - Intergenic
1136888204 16:33947891-33947913 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1137071277 16:35906929-35906951 CTTAGTTAGCGGAGGCAGGAGGG + Intergenic
1137846836 16:51698102-51698124 CCAAGTGAAGGGAGGGAGGAGGG + Intergenic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138027574 16:53534435-53534457 GTGAGTGAGTGGAGGGGGAGGGG + Intergenic
1138220555 16:55246664-55246686 ATAAGTGTGAGGAGGGAGGATGG - Intergenic
1138560781 16:57799904-57799926 CTGAGCCTGTGGAGGGAGAAGGG + Intronic
1138767319 16:59619916-59619938 CTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1138983265 16:62296237-62296259 CTGAGTGAATTGAGGGATGTGGG - Intergenic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1139512047 16:67433076-67433098 CTGAGAGAGAGGTGAGAGGAAGG + Intronic
1139755716 16:69141979-69142001 CGGGGTGAGGGGAGGGGGGAGGG - Intronic
1139851499 16:69953373-69953395 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1139861955 16:70029442-70029464 CTGAGTAATTCGAGGGAGAAAGG - Intergenic
1139880475 16:70176285-70176307 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1140230456 16:73113240-73113262 CAGAGGAAGTGAAGGGAGGAAGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140700178 16:77574486-77574508 TTGAGTGGGTGGAGGCAGGGAGG - Intergenic
1140858765 16:79001021-79001043 CAGAGTGAGTGAATGCAGGAAGG + Intronic
1141141661 16:81500409-81500431 GGGAGGGAGGGGAGGGAGGAGGG - Intronic
1141147223 16:81539720-81539742 ATGAGTGAGTGAAGGCAGGAGGG - Intronic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1141347152 16:83257119-83257141 CTGAGTTGGGGGATGGAGGAAGG + Intronic
1141683079 16:85555351-85555373 CTGAGTCAGTGGTGGGACGCCGG + Intergenic
1141751205 16:85959546-85959568 CTGAGTGAGTGAATGAATGAGGG - Intergenic
1141949304 16:87330452-87330474 CCGTGTGCGTGCAGGGAGGAAGG + Exonic
1141998448 16:87649307-87649329 TTGAGTGTGTGAAGGCAGGAGGG - Intronic
1142020770 16:87780856-87780878 AGGCGTGGGTGGAGGGAGGAAGG - Intergenic
1142166121 16:88589629-88589651 CTGAGTGACAGAAGGGAGCACGG + Intronic
1142399895 16:89853026-89853048 CTGAGAGAGAGGACGGAAGATGG - Intronic
1142419932 16:89963945-89963967 CTTAGGGAGTGGAGGGCGGGGGG + Intronic
1203084244 16_KI270728v1_random:1169931-1169953 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1203093310 16_KI270728v1_random:1230096-1230118 GTAATGGAGTGGAGGGAGGAGGG + Intergenic
1203095016 16_KI270728v1_random:1245228-1245250 CTGAGTGGGAGCAGGGAGGAGGG + Intergenic
1203141176 16_KI270728v1_random:1767805-1767827 CTGTGTTACTGGTGGGAGGAGGG + Intergenic
1142548192 17:720426-720448 GTGAGGGAGTTGGGGGAGGATGG + Intronic
1142548247 17:720661-720683 GTGAGGGAGTTGGGGGAGGATGG + Intronic
1142548267 17:720748-720770 GTGAGGGAGTTGGGGGAGGATGG + Intronic
1142548308 17:720935-720957 CTGAGGGAGTTGGGGGAGGATGG + Intronic
1142600318 17:1050661-1050683 CTGAGTGAGTGGGGCCAGGGTGG + Intronic
1142698657 17:1646859-1646881 AAGAGTGTGGGGAGGGAGGAAGG - Intronic
1142702161 17:1669561-1669583 GTGAGTGAGTGGAGACAGCAAGG - Intronic
1142889852 17:2936248-2936270 CTGGGTGGGGGGAGGGGGGAGGG - Intronic
1143058783 17:4182647-4182669 ATGACTGAGTGGGGGAAGGAAGG - Intronic
1143193091 17:5054889-5054911 GTGTGTGACTGGAGGGAGGTAGG + Intergenic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1143383724 17:6512399-6512421 CTCAGTGACTGAAGGGAAGAGGG + Intronic
1143390591 17:6556972-6556994 CAGAGGGAGCGGAGAGAGGAAGG + Intergenic
1143633805 17:8153019-8153041 GTGGGTGAGTGGGTGGAGGAAGG + Intronic
1143748204 17:9009161-9009183 CAGAATGAGTGAAGTGAGGAAGG - Intergenic
1143748693 17:9012635-9012657 CAGAATGAGTGAAGTGAGGAAGG - Intergenic
1143952969 17:10648159-10648181 CTGTGTGGTTGTAGGGAGGAGGG - Intronic
1144955763 17:19018108-19018130 CTGAGGGAGAGGGTGGAGGAAGG - Intronic
1145911734 17:28547155-28547177 CTGAGTCAATGTTGGGAGGAAGG - Exonic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146375086 17:32288421-32288443 ATGAGTGAGTAGATGAAGGAAGG + Intronic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146575237 17:33985282-33985304 ATGTGTGAGTGGGGGGAGGTTGG - Intronic
1146651090 17:34606856-34606878 GCGAGTGAGTGGGGAGAGGAGGG - Intronic
1147153374 17:38531211-38531233 GTAATGGAGTGGAGGGAGGAGGG + Exonic
1147186386 17:38715589-38715611 CTGAAGGAGAGGAGAGAGGAAGG - Intronic
1147360582 17:39927363-39927385 CAGAGGGAGTGGGGGGTGGAGGG - Intronic
1147403697 17:40195697-40195719 CTGAGGGAGGGGAGAGGGGATGG + Intergenic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1147458514 17:40553693-40553715 CTGGGAGAGGGCAGGGAGGAGGG + Intergenic
1147459808 17:40560985-40561007 ATGAGTCAGTGGAGGGCGGGTGG - Intronic
1147725521 17:42564197-42564219 CAGAGGGAGTGGATGGGGGACGG + Intronic
1148487450 17:47999916-47999938 CTCAGTGGGTGGCAGGAGGATGG + Intergenic
1148855850 17:50578973-50578995 GTGACTGATTGGAGGCAGGAGGG + Intronic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149762031 17:59240853-59240875 CTGAGTGAGTGGTGAGTGAATGG - Intronic
1149821582 17:59784151-59784173 GAGAGAGATTGGAGGGAGGAAGG + Intronic
1150005069 17:61464140-61464162 GTGCGTGCCTGGAGGGAGGAGGG - Intronic
1150217293 17:63477681-63477703 CCGGGCGAGTGGAGGGTGGATGG - Intergenic
1150245423 17:63671108-63671130 CTGATGAAGTGGAGAGAGGAAGG + Intronic
1150358245 17:64506438-64506460 CTGAGAGAGTGGCGCGGGGAGGG - Exonic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150458920 17:65330759-65330781 GTAAGAGAGTGGAGGGAGGCTGG - Intergenic
1150635626 17:66911346-66911368 CTCAGTGACAGGAGGGATGATGG - Intergenic
1150697735 17:67420371-67420393 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
1150857862 17:68770467-68770489 TGGAGTGGGGGGAGGGAGGAAGG - Intergenic
1151126253 17:71847946-71847968 GTGAGAGAGTGGAGGGAGCTGGG - Intergenic
1151208697 17:72527757-72527779 CTAATTGAGTGGCAGGAGGATGG - Intergenic
1151472865 17:74328604-74328626 TTCAGTGAGTAGAGGAAGGAGGG - Intronic
1151546712 17:74797742-74797764 CAGAGTGACTGGAGGAAGGGGGG + Intronic
1151569828 17:74920727-74920749 TGGAGGGAGTGGAGGGGGGAGGG + Intronic
1151724247 17:75875365-75875387 CAGTGTGAGTGGAGGGGGCACGG + Intronic
1151834527 17:76574179-76574201 CTGGGTGCTTGGACGGAGGAGGG + Intronic
1151971163 17:77458192-77458214 CTGAATGAGTGAGGGCAGGAGGG - Intronic
1152138055 17:78517500-78517522 CTCAGTGTGTGAAGGGAGGCTGG - Intronic
1152182013 17:78828427-78828449 CTGAGGGAGAGCTGGGAGGAGGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152700705 17:81817553-81817575 CTGAGTGAGTGCAGGGTGTCTGG - Intergenic
1153193425 18:2568221-2568243 CTTACTGAGTGCAGGGATGAAGG + Intronic
1153833136 18:8940716-8940738 CTGATTCAGTGGAGACAGGAGGG - Intergenic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1154347301 18:13552599-13552621 GTTAGGAAGTGGAGGGAGGAGGG - Intronic
1154388104 18:13913692-13913714 CTGAGTGTGAGAAGTGAGGAAGG - Intronic
1155147558 18:23096768-23096790 CTCAGTGAGTGGAGGGAACCAGG + Intergenic
1155996301 18:32334444-32334466 CACAGGGAGTGGGGGGAGGATGG + Intronic
1156536447 18:37869194-37869216 CTAGGTCATTGGAGGGAGGAGGG + Intergenic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1156733950 18:40229962-40229984 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157493415 18:48139171-48139193 GTGCGGGAGTGGAGGCAGGAGGG + Intronic
1157689412 18:49668835-49668857 GTGGGTGGGTGGAGGGAGGAGGG + Intergenic
1157907003 18:51578067-51578089 CTGAATGACTGCATGGAGGAGGG + Intergenic
1158257750 18:55572407-55572429 CTGAGAAAATGGAGTGAGGAGGG + Intronic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1158333901 18:56394002-56394024 CTGAGTGAGAGCAGAGAGAAAGG - Intergenic
1158846839 18:61453157-61453179 AGGAGTGAGTGGAGGTGGGAGGG - Intronic
1159088520 18:63820873-63820895 TTTAGTGAATGGAGGAAGGAAGG + Intergenic
1159995440 18:74960251-74960273 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995447 18:74960287-74960309 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995454 18:74960323-74960345 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995461 18:74960359-74960381 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995522 18:74960647-74960669 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995530 18:74960683-74960705 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995553 18:74960791-74960813 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995561 18:74960827-74960849 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995568 18:74960863-74960885 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1160017599 18:75156536-75156558 AGGAGTGAATGTAGGGAGGATGG + Intergenic
1160253148 18:77221588-77221610 TTGGGTGAGTGGTGGGTGGAAGG - Intergenic
1160319244 18:77875055-77875077 CTGGGCGGGTGGATGGAGGAGGG - Intergenic
1160388166 18:78510479-78510501 CTAAGGAAGTGGAGTGAGGACGG + Intergenic
1160692202 19:465284-465306 ATGAGTGGGTGGATGGGGGATGG + Intronic
1160703240 19:518072-518094 CTGGGTGGGTGCTGGGAGGAGGG + Intronic
1160968197 19:1755791-1755813 CTGGGAGGGAGGAGGGAGGAGGG - Intronic
1161142248 19:2654629-2654651 CTGAGTGGGGGGAGGGAGAGAGG + Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161449153 19:4334951-4334973 ATGAGTGGGTGGATGGATGATGG - Intronic
1161551725 19:4916706-4916728 CGGAGGGAGAGAAGGGAGGAAGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161860146 19:6791923-6791945 GGGAGTGAGTGGAGGGAGAGTGG + Intronic
1161913892 19:7214798-7214820 GGGAGGGAGGGGAGGGAGGAGGG - Intronic
1161916067 19:7229154-7229176 ATGGGTGAGTGGATGGATGATGG + Intronic
1161919783 19:7257446-7257468 CGGGGTGGGAGGAGGGAGGAGGG + Intronic
1162292831 19:9792313-9792335 CTCAGTGAGGGGAGAGAAGAGGG - Intronic
1162582611 19:11540039-11540061 CCGGGTGAGTGGGGGGAGGTGGG - Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163191157 19:15677783-15677805 ATGAGTGAGTGAGGAGAGGAAGG - Intronic
1163191179 19:15678021-15678043 ATGAGTGAGTGTGGAGAGGAAGG - Intronic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163468622 19:17484137-17484159 CTGAATGAATGAAGGAAGGAGGG + Intronic
1163609931 19:18295482-18295504 GTGGGTGAGTGGATGGTGGATGG - Intergenic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1164404110 19:27927162-27927184 GTGAGGCAGTGGAGAGAGGAAGG + Intergenic
1164534790 19:29077007-29077029 CTGAGTGTGTGGTGGGGGAAAGG - Intergenic
1164839249 19:31380271-31380293 CTGCGGGAGGGGAGGTAGGAAGG + Intergenic
1164909313 19:31992796-31992818 CTGAGGGAGGGGAGCCAGGATGG - Intergenic
1165007708 19:32820028-32820050 CTCAGTGAGTGTGAGGAGGAAGG + Intronic
1165021530 19:32928361-32928383 GAGAGAGAGAGGAGGGAGGAAGG - Intronic
1165069760 19:33248516-33248538 GAGAGGGAGAGGAGGGAGGATGG + Intergenic
1165149655 19:33753436-33753458 GTGGGTGGGTGGTGGGAGGATGG - Intronic
1165149664 19:33753458-33753480 GTGGGTGGGTGGTGGGAGGATGG - Intronic
1165320087 19:35079883-35079905 CTGTGTGAGTGCAAGGAGGCTGG + Intergenic
1165433123 19:35783611-35783633 CTGAGTGAGTGAGGGGCTGAGGG + Intronic
1165699089 19:37923573-37923595 GTGAGTGAGTGGTGAGTGGATGG + Intronic
1165731730 19:38150223-38150245 CTGGTTGAGGGCAGGGAGGATGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166664302 19:44669579-44669601 TTGGGTGAGTGGAGCCAGGAAGG - Intronic
1166690345 19:44818677-44818699 AGGAGTGAGGGGAGAGAGGAGGG - Intronic
1167022166 19:46885519-46885541 CAGAGAGAGAGGAGGGAGGTGGG - Intergenic
1167281911 19:48574279-48574301 TTGAATGAGTGTAGGAAGGAAGG - Intronic
1167341323 19:48918253-48918275 CTGAGGGAGCCGAGGAAGGAGGG + Intronic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167951662 19:53032509-53032531 CTGAGGGAGAGAAGGCAGGATGG - Intergenic
1168097060 19:54121940-54121962 CTGAGTGAGTGCTGGGGGGCAGG + Exonic
1168249432 19:55133332-55133354 GAGAGGGAGAGGAGGGAGGAAGG + Intronic
1168251592 19:55145369-55145391 AGGAGGGAGAGGAGGGAGGAGGG + Intronic
1168411272 19:56141617-56141639 CTGAGGGAGAGGACGGGGGAGGG + Intronic
1168447230 19:56430466-56430488 CTGATTGATTGGATGGTGGAAGG + Intronic
1168450550 19:56463065-56463087 CAGAGTGAGTGCAGCGGGGAGGG + Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925242851 2:2347737-2347759 TTGAGAGACTGGCGGGAGGATGG - Intergenic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925858938 2:8156601-8156623 CTGAGTGTGGGCAGGGAGCAGGG + Intergenic
925978083 2:9155093-9155115 GTGGGAGATTGGAGGGAGGAAGG + Intergenic
926383580 2:12314794-12314816 ATGAGTTAGTGGAAGGAGCATGG - Intergenic
926587149 2:14699366-14699388 CTGAGTGCATGGAGGAAGGAGGG - Intergenic
926622624 2:15060615-15060637 CTGGGTCAGTGCAGGGAGGATGG + Intergenic
926777357 2:16435704-16435726 CAGAGTTAGGGGAGGGAGAATGG - Intergenic
927114248 2:19885909-19885931 GAGAGTGAGGGGAGAGAGGAAGG - Intergenic
927238758 2:20901734-20901756 TTGGCTGAGTGGAGGGAGAAGGG - Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927703521 2:25283003-25283025 CTCAGTGAGTGGCGGTGGGATGG - Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
928255468 2:29718546-29718568 AAGACTGAGTGCAGGGAGGAGGG + Intronic
928384213 2:30850851-30850873 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
928424876 2:31169536-31169558 CAGAGTGAGTGGTGGGAGGTGGG - Intergenic
928465927 2:31522318-31522340 CAGAGAAAGTGGAGGAAGGAGGG - Intergenic
928512447 2:32014040-32014062 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
929385356 2:41400212-41400234 CTGAGTGAGAGGTGGGACAAAGG + Intergenic
929536230 2:42786083-42786105 CACAGTGAGGGAAGGGAGGAGGG + Intronic
930048969 2:47199131-47199153 CTCATTGCGTGTAGGGAGGATGG + Intergenic
930064510 2:47317407-47317429 ATGAGATGGTGGAGGGAGGAAGG - Intergenic
930639534 2:53840615-53840637 GGGAGGGAGTGGAGGGGGGAGGG + Intergenic
930889900 2:56372603-56372625 CTAAGTCTGGGGAGGGAGGATGG + Intronic
930926658 2:56826459-56826481 CTGAGAGAGAGGAGTGTGGAAGG + Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931390104 2:61834351-61834373 GAGGGAGAGTGGAGGGAGGAGGG + Intronic
931803880 2:65785873-65785895 CTGAAAGGGTGGAGGGAGCAAGG + Intergenic
932322183 2:70830403-70830425 CTAAGGGAGTGGAAGGAGAAGGG + Exonic
933022255 2:77208488-77208510 CTGAGTGAGAAAAGGGAAGAAGG + Intronic
933271872 2:80241353-80241375 TAGAGTCAGTTGAGGGAGGAAGG + Intronic
933504744 2:83162496-83162518 CTGAGTGAGAGAAGGCAGGGTGG + Intergenic
933563806 2:83924185-83924207 ATGAATGAATGGAGGGATGATGG - Intergenic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
934331824 2:92075314-92075336 ATGAGAGAAGGGAGGGAGGAAGG + Intergenic
934502798 2:94872818-94872840 CTGAGAGAGTGCAGGGGGAAGGG - Intronic
934654868 2:96112263-96112285 CCCAGGGAGGGGAGGGAGGAAGG - Intergenic
935092536 2:99909392-99909414 ATGAGTTACTGGAGGGAGGGGGG + Intronic
935147859 2:100408469-100408491 CTGAGGTAGTGGTAGGAGGAGGG - Intronic
935430884 2:102974446-102974468 ATGAGTGGGTGGGGGAAGGAGGG - Intergenic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
936751195 2:115644303-115644325 CGGAGTGGGCGGAGGGGGGAGGG - Intronic
936780898 2:116030794-116030816 CTGAAAGAGGGGAGGGAGGTAGG - Intergenic
937240315 2:120456613-120456635 GTGAGTGTTTGGAGGGTGGAGGG - Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937346746 2:121130672-121130694 CTGGCTGAGAGGTGGGAGGAGGG - Intergenic
937913466 2:127087530-127087552 CAGCGTGAGTGGAGGCAGCAGGG + Intronic
938516120 2:132009493-132009515 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
939707402 2:145471962-145471984 GTGAGTGGGAGGAGGGAGGTTGG - Intergenic
940284424 2:152019531-152019553 ATGAGTGGGTGGATGGTGGATGG + Intronic
940694372 2:156959866-156959888 CTGAGCCTGTGGAGGGAGGGAGG + Intergenic
941428631 2:165383901-165383923 GAGAGTGAGAGGAAGGAGGAAGG + Intronic
941699127 2:168585263-168585285 ATGAATGAGTGAAGGAAGGAGGG - Intronic
941720031 2:168802701-168802723 CTGCGTGTGAGGAGGGTGGAGGG + Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942080419 2:172394897-172394919 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
942135991 2:172925971-172925993 CAGAGGGAGGGAAGGGAGGAAGG + Intronic
942785234 2:179693328-179693350 CTGAATGACTGAAGGGAGAAGGG + Intronic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943226430 2:185185026-185185048 CTGAGTCTGCGGTGGGAGGAGGG - Intergenic
944426722 2:199591171-199591193 GTGTGTGGGTGGAGGGAGGTTGG - Intergenic
944540289 2:200747764-200747786 CTCATTATGTGGAGGGAGGAGGG + Intergenic
944797241 2:203199812-203199834 GGGAGGGAATGGAGGGAGGAAGG - Intronic
945157878 2:206858650-206858672 CAGACTGTGTGGAGAGAGGATGG + Intergenic
945164178 2:206924624-206924646 ATGAGTGAGTTGAGGTATGAAGG + Intergenic
945929762 2:215843037-215843059 CAGAGTGAGAGGAGGGAGAGTGG - Intergenic
945998639 2:216462268-216462290 ATGAGTGAGTGTAGGTGGGAGGG + Intronic
946012627 2:216578489-216578511 CTGACAGAGTGAAGAGAGGAGGG + Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946196572 2:218035770-218035792 CTGCGTGTGTGGGGGGAGCAGGG - Intronic
946603386 2:221375168-221375190 CTGAGTGTGAGGAGGAAGAAAGG + Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947258982 2:228199277-228199299 TGGAGTGGGGGGAGGGAGGAGGG - Intergenic
947489172 2:230579084-230579106 CTCATGGTGTGGAGGGAGGAAGG - Intergenic
947821319 2:233073070-233073092 CAGGGTGAGTGAAGGGGGGATGG - Intronic
948166670 2:235867866-235867888 CTGGGTGGGTGGTGGGTGGATGG - Intronic
948282738 2:236760350-236760372 GGGAGGGAGAGGAGGGAGGAAGG + Intergenic
948375531 2:237518097-237518119 ATGAGTGGGTGGATGAAGGAGGG + Intronic
948456777 2:238108185-238108207 CTGCGCGAAGGGAGGGAGGATGG - Intronic
948571900 2:238922927-238922949 CTGAGTGCCAGCAGGGAGGATGG - Intergenic
948711212 2:239826912-239826934 CTGAGTGCACGGAGAGAGGAAGG - Intergenic
948874920 2:240821056-240821078 CTGGGACGGTGGAGGGAGGACGG - Intergenic
948892556 2:240914600-240914622 CTGAGTGAGGGGTGGGATGGAGG - Intergenic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
1168763078 20:362890-362912 GCGAGTGAGTGAAGGAAGGAAGG + Intronic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168852592 20:986807-986829 CCAAGTGTGTGGAGGGAGAATGG + Intronic
1168856492 20:1012860-1012882 GGGAGGGAGTGGAGGGAGCAAGG + Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1168928795 20:1604668-1604690 CTGGATGAGTGGAGGGTGGTGGG + Intronic
1168969584 20:1921764-1921786 CTGGATGAGTGGAGGGTGGTGGG - Intronic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169307726 20:4507542-4507564 TTGAGGGGGTGGAGGGAGGGCGG + Intergenic
1169826111 20:9770544-9770566 CTGGGTGAGTGTAGGCAAGATGG + Intronic
1170825672 20:19792772-19792794 CGGGGTGATTTGAGGGAGGAGGG + Intergenic
1170881043 20:20296515-20296537 TTGAGTGAGGGGAGGAAGGAAGG - Intronic
1170963818 20:21049045-21049067 CTGGGAGGGTGGAGGGAGAATGG + Intergenic
1171019459 20:21572084-21572106 TTGAGGGAGTGGAGAGAGAAGGG + Intergenic
1172190054 20:33056516-33056538 CAGAGAGAGTGGAAGTAGGAAGG - Intronic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1172982387 20:38953720-38953742 CTAAGTCAGGAGAGGGAGGAAGG - Intergenic
1173026867 20:39315741-39315763 CTGAGAGGGTGCAGGGAGGTAGG - Intergenic
1173125200 20:40330149-40330171 CTGAGTGAGTGGGTTGGGGAGGG + Intergenic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173508976 20:43611214-43611236 CAGAGTGAGAGAAGGGAGAAGGG - Intronic
1173766117 20:45611199-45611221 CCTAGGGAGTAGAGGGAGGACGG - Intronic
1173941263 20:46913337-46913359 CTGAGTGAGAGGAGAGGGGCAGG + Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174109256 20:48186648-48186670 GTGAGTGAGTGGTGGGAGTGGGG - Intergenic
1174156932 20:48521697-48521719 AGGAGTGAGTGGTGGGAGGTGGG - Intergenic
1174302103 20:49589863-49589885 CTGAGTGAGTTGGGGGAGAGTGG - Intergenic
1174318061 20:49718184-49718206 CAGAGTGAGGGCAGGGAGGAAGG - Intergenic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1174937057 20:54882308-54882330 TTGGGTGCGGGGAGGGAGGAGGG - Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175298274 20:57924284-57924306 ATGAGTGAGTGGCTGGAGCATGG + Intergenic
1175392478 20:58636000-58636022 GAGAGGGAGGGGAGGGAGGAAGG + Intergenic
1175466715 20:59194414-59194436 CCGAGTGAGGGCAGTGAGGAAGG - Exonic
1175598120 20:60251825-60251847 CTGATTGAGTGGTTGGAGGATGG + Intergenic
1175681757 20:60994542-60994564 CTGAGTGTGTGGGGGAAGGGGGG - Intergenic
1175687949 20:61045066-61045088 GTGAGTGGTTGGATGGAGGATGG - Intergenic
1175691897 20:61071521-61071543 CTGAGTAAGTGGAGGGTGAGAGG + Intergenic
1175817214 20:61889480-61889502 ATGAGTGAGTGGATGATGGATGG + Intronic
1175817265 20:61889780-61889802 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817331 20:61890124-61890146 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175829038 20:61952047-61952069 GTGAGTGAGTGGGGGGTGCAGGG - Intergenic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1175977360 20:62717731-62717753 ATGAGTGAATGAAGGAAGGAAGG - Intronic
1176209839 20:63913970-63913992 CTGCCTGAGGGGTGGGAGGATGG - Intronic
1176230782 20:64031870-64031892 CAGAGTGAGTGGCTGCAGGACGG - Intronic
1176234769 20:64049140-64049162 CTGGGTGAGCGGCGGGAGGGCGG - Exonic
1177164670 21:17586879-17586901 TGGGGTGAGGGGAGGGAGGAGGG - Intronic
1177701558 21:24645688-24645710 GTGGGAGAGTGGTGGGAGGAGGG + Intergenic
1177778409 21:25595442-25595464 TTGAGTGTGTGGTAGGAGGAAGG - Intronic
1177833566 21:26167248-26167270 GGGAGTAAGGGGAGGGAGGAGGG + Intronic
1179006741 21:37521939-37521961 CTGAAAGAATGGATGGAGGAGGG + Intergenic
1179030693 21:37717377-37717399 GTGGGTGTGTGGAGGGAGGCAGG + Intronic
1179170737 21:38970903-38970925 CTAAGTGATTGAAGGAAGGAAGG + Intergenic
1179382838 21:40915293-40915315 GTGAGTCAGTGGACTGAGGAGGG + Intergenic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1180024907 21:45155583-45155605 ATGGGTGAGTGGATGGATGATGG - Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180195930 21:46194391-46194413 CTGAGTGAATGTAGAGAGGAGGG - Intronic
1181167903 22:20993129-20993151 CAGAGTCAGTGGAGGGAGCCGGG + Intronic
1181319083 22:21990926-21990948 CTGAGTGAGTGGCCAGAAGAGGG + Intergenic
1181631118 22:24151892-24151914 AGGACTGAGTGGAGGAAGGATGG - Intronic
1181902693 22:26169365-26169387 CCGAGCGAGTGCAGGGAGGGAGG - Intergenic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1181975564 22:26726903-26726925 CTGAGGGAGTAGAGGGACAAAGG + Intergenic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182090895 22:27594137-27594159 GGGAGGGACTGGAGGGAGGAAGG + Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1182848090 22:33447799-33447821 GAGAGTGGGTGGAAGGAGGAAGG + Intronic
1182905282 22:33930779-33930801 CGGAGTGGGGGGTGGGAGGAAGG - Intergenic
1183094981 22:35546598-35546620 GTGAGTGAGTGGATGAAGGAAGG + Intronic
1183470943 22:38006427-38006449 CTGAGTGAGCGGCTGGAGGGTGG - Intronic
1183718293 22:39547119-39547141 CTGAGTGTGTGTAGAGGGGAGGG + Intergenic
1183936581 22:41265844-41265866 CTTACTGAGTGGTGGGAGGATGG - Intronic
1183950091 22:41347932-41347954 CTGGGTCAGAGGAGTGAGGAAGG - Intronic
1184238573 22:43199749-43199771 CTGCTTGAGAGGAGGGAGGTTGG + Exonic
1184648216 22:45907657-45907679 GTGAGTGAGTGAAGGAATGAAGG - Intergenic
1184685434 22:46094712-46094734 CTGGGTGAGTGGTGGCAGGCAGG + Intronic
1184742998 22:46439924-46439946 CTGTGTGAGGGGTGGGAGGGCGG - Intronic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1184951616 22:47847069-47847091 GTGAGTGAATGGAGAGTGGATGG + Intergenic
1185051199 22:48555177-48555199 CCGAGTGAAGGGAGGGAGGATGG + Intronic
1185056358 22:48580657-48580679 CGGTGTGTGTGGAAGGAGGAGGG + Intronic
950098925 3:10345643-10345665 CTGAGGAAGTGGAGGGAGTGAGG - Intronic
950398164 3:12750003-12750025 CCGGGGTAGTGGAGGGAGGAGGG + Intronic
950554513 3:13687146-13687168 CTCCTTGTGTGGAGGGAGGACGG + Intergenic
951290941 3:20871738-20871760 TTGAGTCAGTGGACTGAGGAAGG + Intergenic
951383194 3:22010903-22010925 GAGGGTGAGTGGTGGGAGGATGG - Intronic
951401785 3:22241462-22241484 CTGAGTCAGTGGATGAAGCAAGG - Intronic
951568198 3:24034264-24034286 ATTAGGGAGTGGAGGGAGGGAGG + Intergenic
951681033 3:25294808-25294830 AAGAGGGAGTGGAGGGGGGAAGG + Intronic
951720454 3:25692235-25692257 AAGAGTGAGAGGAGGAAGGAAGG + Intergenic
952088268 3:29853152-29853174 CTCAGAGAGTGGAGGGTGGGAGG + Intronic
952186326 3:30973542-30973564 CTGAGTGAGTGGGGGGATAGTGG - Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952810246 3:37396240-37396262 AGGAGTGAGTGGAGGTTGGATGG - Intronic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
952867077 3:37861682-37861704 CAGGGTGAGTGGAGGGCGGGAGG - Intergenic
952953880 3:38544776-38544798 CTGAGAGAGTGGAGGGCTGCGGG + Intergenic
953959124 3:47253755-47253777 CTAAGTGAGTTGTGGGATGAGGG - Intronic
954225827 3:49180448-49180470 CTGAGTGACTGGAGAGGGAATGG - Intronic
954345832 3:49998441-49998463 CTGAGGCAGTGGAGGAAGCATGG + Intronic
954580898 3:51702446-51702468 CTGAGTGGGTGGTGGGGGTAGGG + Intronic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
954991376 3:54843503-54843525 GGCAGTGAGTGGAGGGAGGCAGG + Intronic
955026154 3:55169609-55169631 GTGAGTGAATGGATGGATGAAGG - Intergenic
955803965 3:62714523-62714545 CAGTGTGGGTGAAGGGAGGAAGG + Intronic
955895039 3:63689890-63689912 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
956359157 3:68428175-68428197 CAGAGGGAGAGGAGGAAGGAAGG + Intronic
956395030 3:68816165-68816187 TGGAGTGGGGGGAGGGAGGAGGG + Intronic
956513672 3:70022273-70022295 CCGGGTGGGGGGAGGGAGGAGGG + Intergenic
956747976 3:72324417-72324439 CTGAGTGAATGAAGGGATGTTGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958703343 3:97621261-97621283 CTCAGAGAGTGGAGGGTGGGAGG + Intronic
958853683 3:99358750-99358772 GTGAGTGACTGAAGAGAGGAGGG - Intergenic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959387704 3:105732769-105732791 CTGCATGAGTTGAGGAAGGATGG - Intronic
959611653 3:108301723-108301745 CTGCTTGAGTTGAGGGAGAAAGG - Intronic
960197509 3:114787561-114787583 ATGAGTTAGTGGTGAGAGGATGG + Intronic
960253697 3:115487331-115487353 CAAAGTGGGTGGAGGTAGGAGGG - Intergenic
960965424 3:123101051-123101073 CTGGCTGAGTGCAGGCAGGATGG + Intronic
961213530 3:125142907-125142929 CAGAGTCAGGGAAGGGAGGAGGG - Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961637858 3:128344219-128344241 GTGACAGAGTGGAGGGAGGCAGG - Intronic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
962073527 3:132056610-132056632 TTGGGTGAGGGGAGGGGGGAGGG - Intronic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
962317577 3:134368374-134368396 CTGGGTGAGTGGGGGGTGGGGGG - Intronic
962318970 3:134375521-134375543 CAGGGTAAGTGGAGAGAGGAGGG - Intergenic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
962952213 3:140229636-140229658 CTGAGTGAGTGAAGGAGGAAGGG + Intronic
963892716 3:150653589-150653611 ATGTGCGGGTGGAGGGAGGAGGG - Intergenic
965117939 3:164515436-164515458 CAGAGTGAGTGCTGGGAGCAGGG + Intergenic
965567193 3:170132570-170132592 TTGAGTGTGTGGTGGGTGGAGGG - Intronic
965687831 3:171324140-171324162 GTGAAAGAGAGGAGGGAGGAAGG + Intronic
966085124 3:176061648-176061670 CTGAGTCAGTGAAGGGAGATAGG - Intergenic
966128076 3:176603655-176603677 GCGAGGGATTGGAGGGAGGATGG - Intergenic
966537489 3:181050928-181050950 TTGTGTGAGAGGAGGGAGCAGGG + Intergenic
967070769 3:185960742-185960764 CGGAGTGAGAGGAGGGTGGCAGG - Intergenic
967350764 3:188511304-188511326 GGGAGAGAGGGGAGGGAGGAAGG - Intronic
967799308 3:193638244-193638266 CTGAGTGAGGGGAGAGTGGTAGG + Intronic
967970693 3:194996930-194996952 CTGAATAAATGAAGGGAGGACGG + Intergenic
968468854 4:767467-767489 CCCAAGGAGTGGAGGGAGGAGGG - Exonic
968546229 4:1200392-1200414 GGGAGCAAGTGGAGGGAGGAAGG + Intronic
968870422 4:3239235-3239257 CTGGGTGAGGGGAGCGAGGGTGG + Intronic
968882295 4:3307600-3307622 CCGAGTGAGGGGAGGAGGGAAGG - Intronic
968935820 4:3609895-3609917 ATGGATGAGTGGATGGAGGATGG - Intergenic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
969131106 4:4991703-4991725 CACAGAGAGTGGAGGCAGGATGG - Intergenic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
969173759 4:5384126-5384148 CGAAGTGAGTGGAAGGAGGATGG + Intronic
969355121 4:6620649-6620671 CTCAGTTGGTGGTGGGAGGAAGG + Intronic
969432335 4:7162709-7162731 CTTAGGGAGTGGAGGAAGAAGGG + Intergenic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
969523098 4:7690211-7690233 ATGAGTGGGTGGATGGATGATGG + Intronic
969523145 4:7690466-7690488 ATGAGTGGGTGGATGGATGATGG + Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
970211023 4:13710112-13710134 CTGAGTGATTGGCTGAAGGATGG + Intergenic
970499306 4:16661098-16661120 CAGGGTGAGTGTAGGGAGGTGGG - Intronic
971230633 4:24798345-24798367 GAGACTGAGTGGAGGGAGGGTGG - Intronic
973121491 4:46524957-46524979 TTGAGTCAGTGGAGTGAGAAAGG - Intergenic
973780662 4:54285524-54285546 TTCAGTGAGTGGAGTGTGGACGG + Intronic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
974703087 4:65476585-65476607 CGGAGTGAGAGGAGGGATAAAGG + Intronic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975264824 4:72350960-72350982 CTGAGAGCCTGGAGAGAGGAAGG - Intronic
975570127 4:75808058-75808080 CTGAGTAAGTGGTGGGACAATGG - Intronic
975713796 4:77186810-77186832 ATGAGTGTGGGGTGGGAGGAGGG - Intronic
976820990 4:89206882-89206904 CAAAGTGAGTGCAGGGATGAGGG - Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978624857 4:110673698-110673720 GTGAGTGAGTGGTGGGGGAATGG - Intergenic
979273567 4:118791528-118791550 GGGAGAGAGAGGAGGGAGGAGGG - Intronic
981043286 4:140242893-140242915 AGGAAGGAGTGGAGGGAGGAAGG + Intergenic
981502258 4:145464351-145464373 ATGAGTGAGTGGTGGGTGAATGG + Intergenic
981753876 4:148119919-148119941 CTGAGTGGTTGGATGGATGAAGG + Intronic
982181307 4:152751011-152751033 GTGAGTGGGGGGAGGGAGGAGGG + Intronic
983574576 4:169247331-169247353 CTGAGAGAGTGAATGGTGGACGG + Intronic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
984134398 4:175917230-175917252 GTGATTGTGTGGAGGGAGGAGGG - Intronic
984180823 4:176480441-176480463 GTTAGTGAGTGCAGGGAGAAAGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985110291 4:186541062-186541084 CTGAGGGAATGGAGGCAGGGTGG - Intronic
985132033 4:186748441-186748463 TTTAGTGAGTGGAGGGTGGGAGG - Intergenic
985376656 4:189347547-189347569 CTGAGTCAGAGAAGGGAGTAAGG + Intergenic
985586452 5:740122-740144 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985601040 5:832299-832321 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985808871 5:2068672-2068694 GTGAGTCAGTGGAGGGTGGGAGG + Intergenic
985815596 5:2125646-2125668 GTGAGGGAGTGTTGGGAGGAGGG + Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
986752579 5:10802181-10802203 GTGAGAGATGGGAGGGAGGAGGG - Intergenic
987061678 5:14249380-14249402 CAGAGTGAGTGGAGTGGGGGAGG + Intronic
987173318 5:15281471-15281493 GTGAGTGGGGGGTGGGAGGAGGG + Intergenic
987468158 5:18296725-18296747 CTGAGGGAGAGAAGGTAGGATGG + Intergenic
988986227 5:36621455-36621477 AGGAGTCAGTGGAGGGAGTAGGG + Intronic
989045762 5:37271866-37271888 TTGAGTCAGTGGACTGAGGAAGG - Intergenic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989284392 5:39682656-39682678 TGGGGTGAGGGGAGGGAGGAGGG - Intergenic
989604580 5:43231921-43231943 GTGGGTGAGAGAAGGGAGGAAGG - Intronic
989942123 5:50163947-50163969 TTGGGTGAGTGGAGTGGGGAGGG + Intergenic
990222797 5:53612428-53612450 GGGAGTGTGTGGAGTGAGGAAGG + Intronic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
990895293 5:60693305-60693327 CCAAGTGAGTGGATGAAGGAGGG + Intronic
991292743 5:65048541-65048563 CTGAGTCAGTGGTGGGGGCATGG - Intergenic
992648402 5:78833549-78833571 GGGAGGCAGTGGAGGGAGGAAGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
994737699 5:103576052-103576074 GTGAGTGGGTGGAGTGAGGTAGG - Intergenic
995125355 5:108573258-108573280 CTAAGGGAGAAGAGGGAGGAAGG + Intergenic
995815002 5:116158153-116158175 CGGAGGGAGAGGAGGGAGGGAGG - Intronic
995994890 5:118285834-118285856 ATGAGTGACTGGAGGCACGAAGG - Intergenic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
996411224 5:123161665-123161687 CTGAGTGAGTGAGGTGAAGAGGG + Intronic
996595081 5:125191455-125191477 CGGATTGAGAGGAGGGAGGGAGG - Intergenic
996605585 5:125317655-125317677 CTTGGAGAGTGGAGGGAGGGAGG - Intergenic
996924803 5:128811883-128811905 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
996960807 5:129246802-129246824 TTGTGTGAGTGGTGGGAGGTCGG + Intergenic
997782579 5:136675130-136675152 GAGATTGAGTGGTGGGAGGAGGG + Intergenic
998028018 5:138837507-138837529 GAGAGGGAGGGGAGGGAGGAGGG - Intronic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999254235 5:150200929-150200951 CTGGGTGTGTGAAGGGAGGAGGG + Intronic
999558879 5:152776833-152776855 TGGAGTGAGGGGATGGAGGAGGG + Intergenic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
999743970 5:154577628-154577650 AGGAGTGAGTGGTGGAAGGAAGG - Intergenic
1000823058 5:166009317-166009339 ATCAGAGAGTGGAGGGTGGAGGG - Intergenic
1000978549 5:167791929-167791951 ATGAGAGAGTGGATGGAGTATGG - Intronic
1001003777 5:168031698-168031720 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
1001295172 5:170494100-170494122 CTGAGTGAGGAGACTGAGGAAGG - Intronic
1001414554 5:171535800-171535822 CTGAGTGAGTCAGGGGAAGAAGG + Intergenic
1001487503 5:172130013-172130035 CTGGGTGAGAGGGGAGAGGATGG - Intronic
1001571481 5:172733185-172733207 CTGGGAGAGAGGAGGCAGGATGG + Intergenic
1001681253 5:173558542-173558564 CTGAGTCAGGGGTGGGAGGAAGG + Intergenic
1001686386 5:173597680-173597702 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686461 5:173597880-173597902 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686493 5:173597964-173597986 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1002067640 5:176660128-176660150 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067648 5:176660155-176660177 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067656 5:176660182-176660204 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067664 5:176660209-176660231 ATGAGTGAATGGATGGAGGAAGG - Intergenic
1002133577 5:177095507-177095529 CAGAGGGAGTGGAGGGAGCGTGG - Intronic
1002808747 6:604730-604752 GTGGCTGAGTGGAGGGAGGCAGG - Intronic
1003012756 6:2441325-2441347 GTAAGTAAGTGGTGGGAGGAAGG - Intergenic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003098873 6:3162497-3162519 GGGAGGGAGTGGGGGGAGGACGG - Intergenic
1003513752 6:6802204-6802226 ATGAGTGAGTGGAGGCAAGGGGG + Intergenic
1003533645 6:6957462-6957484 ATGAGTGAATGATGGGAGGATGG - Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1004184188 6:13407891-13407913 TTGGGTGAGTACAGGGAGGAGGG - Intronic
1004447058 6:15710145-15710167 GTGAGGGAGGGGAGGGAGGGAGG - Intergenic
1004468758 6:15909508-15909530 CTGAGCACCTGGAGGGAGGAAGG + Intergenic
1005402652 6:25450763-25450785 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
1005894385 6:30165048-30165070 CAGAGAGAGAGGTGGGAGGAAGG - Intronic
1006077380 6:31542440-31542462 CTAGCTGAGGGGAGGGAGGAGGG + Exonic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006323268 6:33333589-33333611 CTGGGGGAGTGGGGGAAGGAAGG + Intergenic
1006407476 6:33853557-33853579 CTGAGTGAGTGGTGGGTGCAGGG + Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006447044 6:34085425-34085447 GTGAGTCAGTAGAGAGAGGAAGG + Intronic
1006510801 6:34520083-34520105 GTGAGTGATGGGAGGGAGGATGG + Intronic
1006592761 6:35170263-35170285 GGGAGTGAGTGGGGGCAGGAAGG + Intergenic
1006782940 6:36644333-36644355 CTGAGTGAGTGGAGTTTGGGAGG - Intergenic
1006907685 6:37544144-37544166 ATGGGAGACTGGAGGGAGGAAGG + Intergenic
1007228909 6:40334542-40334564 AGGAGTGAGAGGAGGGAGAAAGG - Intergenic
1007325042 6:41053301-41053323 CTGAGGGAGAGGAGAGAGGCAGG - Exonic
1007460111 6:42011746-42011768 CTGAGGCAGTGGAGGGAGAGGGG + Intronic
1007627203 6:43253380-43253402 CTTAGAGAGGGGAGCGAGGATGG - Intronic
1007694039 6:43720274-43720296 CTGCTTGAGTGGAAAGAGGATGG + Intergenic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1007722710 6:43894801-43894823 GTGAGTGAGAGGAGGGAGAGGGG + Intergenic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1008883832 6:56410564-56410586 CTGAGCGGGGTGAGGGAGGAGGG - Intergenic
1010372762 6:75130767-75130789 TTGAATGAGTGGTGGGAGGGGGG - Intronic
1010489588 6:76459481-76459503 CTGAGGGAGTGAAAGAAGGAAGG - Intergenic
1010754408 6:79650587-79650609 ATGAGAGAGAGAAGGGAGGAAGG + Intronic
1011164654 6:84432189-84432211 CTGAGTGAATGGTGGATGGATGG + Intergenic
1011396849 6:86919291-86919313 CTGATTGACTGGAGGGTGGTGGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011723512 6:90184467-90184489 GTGAAGGGGTGGAGGGAGGAAGG - Intronic
1012123096 6:95391489-95391511 ATGGGTGAGTGAAGGGATGAAGG + Intergenic
1012565339 6:100642013-100642035 CGGAGTGGGGGGAGGGGGGAGGG + Intronic
1012943153 6:105438513-105438535 GTGAGAGGGAGGAGGGAGGAAGG - Intergenic
1013609084 6:111777568-111777590 CACAGTTAGGGGAGGGAGGAGGG - Intronic
1013718694 6:112995738-112995760 GTCAGGGACTGGAGGGAGGAAGG - Intergenic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1014903840 6:127002624-127002646 CAGAGTGAGAGGAGGGTGGTTGG - Intergenic
1015163966 6:130182625-130182647 AGGAGGGAGGGGAGGGAGGAAGG + Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015428932 6:133107088-133107110 CAGAGCCAGTGGAGGGAGCAGGG - Intergenic
1015455819 6:133424952-133424974 CCAAGAGATTGGAGGGAGGAAGG - Intronic
1015557862 6:134481769-134481791 CTTTTTGAGTGGGGGGAGGAAGG + Intergenic
1015890887 6:137968587-137968609 CTGTGTGAGTGTAGGGAGAGGGG + Intergenic
1016317776 6:142808776-142808798 ATGAATGGATGGAGGGAGGAAGG + Intronic
1016395302 6:143617631-143617653 CTGCTAGACTGGAGGGAGGAAGG - Intronic
1016438694 6:144063116-144063138 CTGAGTGAGAGGAGTGTGGCAGG - Intronic
1016439327 6:144067286-144067308 GTGAGAGCGAGGAGGGAGGAGGG + Intergenic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017300794 6:152855482-152855504 GTGAGGGAGAGGAGTGAGGATGG + Intergenic
1017397503 6:154019555-154019577 GTGAGAGATTGGAGGGAGGGAGG - Intronic
1017869846 6:158478098-158478120 GAGAGTGGGAGGAGGGAGGAGGG + Intronic
1018326707 6:162677980-162678002 ATGGGTGAGTGGAGGGTGGGAGG - Intronic
1018418008 6:163618046-163618068 ATCAGAGAGTGGAGGGTGGAGGG - Intergenic
1018544770 6:164923431-164923453 TTGAGTGCGTGGAGGAATGAAGG + Intergenic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1018923010 6:168188793-168188815 CTCAGTGGGAGGATGGAGGATGG + Intergenic
1019050819 6:169181985-169182007 TGGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019103418 6:169650106-169650128 ATGAGTGAGTGGATGGATGGAGG - Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019463210 7:1172444-1172466 CTGAGTGAGTAGGGGGAAGCTGG - Intergenic
1019463237 7:1172561-1172583 CTGAGTGAGTGGGGAGGGGCTGG - Intergenic
1019486962 7:1293743-1293765 CTGAGTGAGTGGGGAAGGGAGGG + Intergenic
1019510480 7:1415193-1415215 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019510510 7:1415289-1415311 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019815380 7:3196119-3196141 CTGAGTGCTGGAAGGGAGGATGG - Intergenic
1019935008 7:4249091-4249113 GTGAGTGTGGGGAGGGAGGGAGG + Intronic
1020569772 7:9844744-9844766 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1021586844 7:22218107-22218129 CTGGGTGAGAGGAGGGGGTAGGG - Intronic
1021791284 7:24208304-24208326 CTGGGTGAGAGGAGGAGGGATGG + Intergenic
1022003481 7:26246760-26246782 CTTAGTGTGTGGAGGCGGGAGGG - Intergenic
1022012295 7:26319069-26319091 CTGTGTCAGTGGAGGAAGGGAGG + Intronic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1022509463 7:30925938-30925960 GTGAGTGGAGGGAGGGAGGAAGG - Intergenic
1022694974 7:32696105-32696127 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
1023857032 7:44190169-44190191 CCCAGTGAGTGGATGGAGCAGGG + Intronic
1023917019 7:44597121-44597143 GAGAGTGAGGGAAGGGAGGAGGG + Intergenic
1023920926 7:44629323-44629345 CTGAGGGAGTGGAAGGAGCTGGG + Intronic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1025189887 7:56888376-56888398 CTGAGTGAGTGGAGACAGATGGG - Intergenic
1025682052 7:63688545-63688567 CTGAGTGAGTGGAGACAGATGGG + Intergenic
1025875516 7:65477142-65477164 CTGGGTGGTTGGAGAGAGGAGGG - Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026124718 7:67569435-67569457 ATGAGTGGGTGGGAGGAGGAGGG - Intergenic
1026159302 7:67854514-67854536 CTGACTAAGTGAAAGGAGGAAGG - Intergenic
1026395796 7:69953040-69953062 CTAATTTAGGGGAGGGAGGAGGG - Intronic
1026774680 7:73223957-73223979 GTGAGTGTGGGGACGGAGGAGGG + Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027015539 7:74777348-74777370 GTGAGTGTGGGGATGGAGGAGGG + Intronic
1027072493 7:75168609-75168631 GTGAGTGTGGGGACGGAGGAGGG - Intergenic
1027337586 7:77170123-77170145 ACTAGAGAGTGGAGGGAGGAAGG - Intronic
1028350213 7:89837684-89837706 ATGAGTCATTGGAGGGAGGAAGG - Intergenic
1028385013 7:90244958-90244980 ATGAGTGGGTGGAGGGGTGAGGG - Intergenic
1029098367 7:98107080-98107102 CTGAGGCAGCGGAGGGAGGCAGG + Exonic
1029251986 7:99243436-99243458 TGGGGTGAGTGGGGGGAGGAAGG + Intergenic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029778156 7:102700679-102700701 ACTAGAGAGTGGAGGGAGGAAGG + Intergenic
1029907350 7:104104876-104104898 ATGAGTGAGAGGAGGAAGGAAGG + Intergenic
1030614330 7:111722562-111722584 GAGAGTGAGGGGAGGGAGAATGG + Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031913419 7:127540842-127540864 GTAAGTGAGTGGGGGGAGGGAGG + Intergenic
1032057204 7:128693357-128693379 CGGAGTGAGAGGAGGGATGGAGG - Intergenic
1032086433 7:128886379-128886401 CTGGCTGAGGGGAGGGAGGTGGG + Intronic
1032158647 7:129492363-129492385 CAGAGGGAGTTGAGGGAGAAGGG - Intergenic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032632559 7:133669419-133669441 CTGTGTGGGTGTGGGGAGGACGG + Intronic
1032667279 7:134049296-134049318 ATGGGTGAGTGGAAGGATGAAGG - Intronic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1032689005 7:134263941-134263963 CTGAGGGATTGGAGGGAGGGTGG - Exonic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033275309 7:139967227-139967249 ATGACAGGGTGGAGGGAGGAAGG - Intronic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1033514665 7:142094243-142094265 CTGCGTGATTGGAGGGAACACGG - Intronic
1033676817 7:143549616-143549638 GAGAGTGGGTGGAGGGAGAAAGG - Intergenic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034347917 7:150398278-150398300 CAGCGTGGGTTGAGGGAGGAGGG + Exonic
1034433778 7:151053560-151053582 CAGAGTGAGGGGAGCAAGGATGG - Intergenic
1034438247 7:151073958-151073980 CTCAGTGAGTGTCGGGTGGAAGG - Intronic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1034883634 7:154780991-154781013 ATGAGTGAATGGATGGATGATGG + Intronic
1034934887 7:155192566-155192588 CTGTGTGAGAGGAGAAAGGAAGG + Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035278964 7:157765505-157765527 GTGGGTGAATGGATGGAGGAAGG - Intronic
1035279030 7:157765788-157765810 GTGAGTGAATGGATGGAGGAAGG - Intronic
1035286899 7:157812386-157812408 ATGAGGGAGGTGAGGGAGGAGGG + Intronic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1036048797 8:5172969-5172991 ATGAGTGTCTGGAGGGAGAAGGG - Intergenic
1036157828 8:6358812-6358834 CTGAGTTAGTGGAGAAAGCAGGG + Intergenic
1036401627 8:8413837-8413859 CTGGGTGCCTGGGGGGAGGAGGG + Intergenic
1036648433 8:10626225-10626247 CAGAGTGAATAGCGGGAGGATGG + Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037646630 8:20798324-20798346 GTGAGTGAGTGCAGGTAGGCAGG + Intergenic
1037654202 8:20868889-20868911 GGGAGGGAGTGGAGGGAGGTGGG - Intergenic
1037703508 8:21296043-21296065 CTGGGTGAGATGAGGGAGGGAGG - Intergenic
1037883782 8:22585823-22585845 CTGAGTCAGAGGAGGAAGGGAGG - Intronic
1037918900 8:22790204-22790226 ATGAGTGAATGAAGGAAGGAAGG - Intronic
1038007239 8:23442718-23442740 CTGAGTGAATGGAGGGATAAAGG - Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038179218 8:25210868-25210890 CTGAATGAGGGGAGGGGGAAGGG + Intronic
1038239191 8:25792509-25792531 CTGATGGAGTGAAGAGAGGAAGG + Intergenic
1038721196 8:30037078-30037100 TGGAGTCAGGGGAGGGAGGATGG - Intergenic
1038773748 8:30509259-30509281 CTGAGAGAGGGAAGGGAGGAGGG - Intronic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039494249 8:37968899-37968921 TTGAGTGAGGGCAGGGAGAAGGG - Intergenic
1039518952 8:38154572-38154594 TTGAATGAATGGAGGGAGGGAGG - Intergenic
1040860080 8:51990105-51990127 GTCAGTGGGTGGAGGGAGAAGGG - Intergenic
1041230738 8:55748556-55748578 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
1041274815 8:56146292-56146314 TTGAGTGGGGGGAGGGCGGAGGG - Intergenic
1041282223 8:56222136-56222158 CTCAGTGGGTTGGGGGAGGATGG + Intergenic
1041293068 8:56325781-56325803 GTGAGTGAGGGCAGGAAGGAGGG - Intergenic
1041309930 8:56506266-56506288 CTGAGCCAGTGGAGGGAAAAGGG - Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041527594 8:58824448-58824470 CTGAGTGAATGGAGAGAGTGTGG - Intronic
1041933093 8:63308712-63308734 CTGAGTGAATGAAGCAAGGATGG - Intergenic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043909484 8:85844613-85844635 ATGAGTGGGTGGATGGATGATGG + Intergenic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1044294697 8:90513875-90513897 CAGAGTGTGGGGTGGGAGGAGGG + Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044734037 8:95259347-95259369 GTGAGAAAGTGGAGGCAGGAAGG + Intronic
1044829189 8:96229383-96229405 CCGGGTGGGTGGAGGGAGGCTGG - Intronic
1045035490 8:98173445-98173467 ATGGCTGACTGGAGGGAGGAAGG + Intergenic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1046025755 8:108721584-108721606 CAAAGTGACTGGAGTGAGGATGG - Intronic
1046130103 8:109956117-109956139 CTGAGTGGGGGGAGGGGGGAGGG - Intergenic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1047325796 8:123834713-123834735 GTGAGTGAGAGGACAGAGGATGG - Intergenic
1047471662 8:125179777-125179799 CTGAGTGGGGGCAGTGAGGATGG - Intronic
1047690328 8:127345858-127345880 CCAAGTGGGTGGAGGGAGGAAGG - Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048339053 8:133524989-133525011 CGTGGTGAATGGAGGGAGGAGGG + Intronic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048525512 8:135198833-135198855 CTGACTGAGTGTGGGGAGGATGG - Intergenic
1049199226 8:141331727-141331749 CGGGGTGTGTGGAGGAAGGAAGG + Intergenic
1049465023 8:142747146-142747168 ATGAGTGGGTGGGTGGAGGAGGG + Intergenic
1049783469 8:144439492-144439514 CTGACTGAGTGGTGGGTGGCAGG - Intronic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1050119862 9:2297154-2297176 CAGAGTGACTGGAGTGAGGCTGG + Intergenic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1050412629 9:5382571-5382593 CTGAGGTAATGGAGGAAGGAGGG + Intronic
1050619248 9:7435278-7435300 CTCAGTGGGTGTGGGGAGGAGGG - Intergenic
1050707910 9:8424723-8424745 AAGAATGAGTGAAGGGAGGAGGG + Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1051002957 9:12307401-12307423 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1051306982 9:15720830-15720852 TGGGGTGGGTGGAGGGAGGAGGG - Intronic
1051459321 9:17294773-17294795 GGGAGTGAGGGGAGGGAGGGGGG + Intronic
1051459372 9:17294867-17294889 CGGAGGGAGTGGGGGGAGGGGGG + Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1052462367 9:28782342-28782364 GTGAATGAATGAAGGGAGGAAGG - Intergenic
1053054264 9:34984906-34984928 CAGAGTCAGAGGAGGGAGGCAGG + Intergenic
1053484713 9:38443007-38443029 ATGAGTGAGTGAAGGAAGGAAGG - Intergenic
1054750338 9:68898700-68898722 AAGAGGGAGAGGAGGGAGGAAGG - Intronic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1055067578 9:72134077-72134099 GTGAATTAGTGGAGGGAGTAGGG + Intronic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1055616124 9:78074729-78074751 GTGAGTGAGTGAATGGATGAGGG - Intergenic
1055782527 9:79834737-79834759 GTGAGAGAGGGGAGGGAGGGAGG + Intergenic
1056135396 9:83625057-83625079 CTGAGTGAGGGGAAGCATGATGG + Intronic
1056544973 9:87605961-87605983 GTGAGTGCCTTGAGGGAGGAGGG + Intronic
1056819722 9:89830335-89830357 CTAAGTAAATGGATGGAGGATGG - Intergenic
1057008709 9:91583258-91583280 ATGAGTGGGTGGAGGTTGGATGG + Intronic
1057008726 9:91583320-91583342 ATGAGTGGGTGGAGGATGGATGG + Intronic
1057008742 9:91583382-91583404 ATGAGTGGGTGGAGGTTGGATGG + Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057284173 9:93735687-93735709 ATCAGAGAGTGGAGGGTGGAAGG + Intergenic
1057519798 9:95751821-95751843 CTGAGCCACAGGAGGGAGGATGG + Intergenic
1057944576 9:99314168-99314190 AAGAGAGAGAGGAGGGAGGAAGG - Intergenic
1058017247 9:100048171-100048193 TTGGGTGGGTGGAGGGGGGAGGG + Intronic
1058837245 9:108869096-108869118 CTGAGTGACTGCAGTTAGGAGGG - Exonic
1058843375 9:108932840-108932862 TTGAATCAGTGGAGGCAGGAAGG - Intronic
1059695936 9:116730542-116730564 GAGATTGTGTGGAGGGAGGAAGG + Intronic
1060040925 9:120300282-120300304 ATGAGTCAGTGGATGGATGATGG + Intergenic
1060105524 9:120870424-120870446 CTGGGTGAGTGGAGCGAGCAGGG - Exonic
1060124850 9:121033877-121033899 AAGAGGGAGGGGAGGGAGGAAGG - Intronic
1060162735 9:121380923-121380945 GTGAGAGATTGGAGGGAGGGAGG + Intergenic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060372960 9:123091926-123091948 CCTAGTGAGTGGAGGGAGGCAGG + Intronic
1060742526 9:126109010-126109032 TTCAGTAGGTGGAGGGAGGATGG - Intergenic
1060813148 9:126621221-126621243 CTCAGCCAGGGGAGGGAGGAAGG + Intronic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1060877860 9:127096141-127096163 CTGAGGGAGTGGTGGGGGAAAGG - Intronic
1061207869 9:129174924-129174946 CCCAGTGGATGGAGGGAGGAAGG - Intergenic
1061246862 9:129405008-129405030 CTGAGTGAGTGGGGGGCTGCTGG + Intergenic
1061256519 9:129456734-129456756 GTGGGTGAATGGAGGGTGGATGG + Intergenic
1061294956 9:129671993-129672015 CTGAGTAGGTGGGGGCAGGAAGG + Intronic
1061516756 9:131094625-131094647 CTGAGAAACTGGAGGGAGGCGGG - Intergenic
1061520471 9:131114631-131114653 TTGAGTGTGTTTAGGGAGGAGGG + Intronic
1061716240 9:132520133-132520155 CTGAGTGAGAGGAGAGGGGAGGG - Intronic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1062123619 9:134847862-134847884 CAGAGGGAGTGGGGAGAGGAAGG + Intergenic
1062388759 9:136325880-136325902 CTGGGTTAGTGGTGGGAGGCTGG - Intergenic
1062445270 9:136591052-136591074 CTGAGTGTGTGGTTGGAGGAAGG + Intergenic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1203358693 Un_KI270442v1:191237-191259 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
1203618246 Un_KI270749v1:89704-89726 TTGAGTCAGAGGAGGGGGGAGGG + Intergenic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1185547134 X:954557-954579 CTCAGTGAGTGAAGGAAGGATGG - Intergenic
1185547812 X:959679-959701 CTGAGTGAGGGAGGGGGGGAAGG - Intergenic
1185583090 X:1226126-1226148 ATGGGTGGGTGGAGGGAGGAAGG + Intergenic
1185908416 X:3959584-3959606 TTCAGAGAGTGGAGGGAGGGAGG - Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186303421 X:8227137-8227159 ATGAAGGAGAGGAGGGAGGAAGG - Intergenic
1187043871 X:15626018-15626040 CTGATTGAGTTAAGGGAGCAGGG - Intergenic
1187323911 X:18268617-18268639 CTCGGTGGGGGGAGGGAGGAGGG + Intronic
1187495846 X:19794845-19794867 CTGAATGAATGGAAGGAGTAAGG - Intronic
1188153094 X:26703750-26703772 GTATGTGAGTGGAGGGAGGGAGG + Intergenic
1188456203 X:30369364-30369386 CTGAGTGTGTGTTGTGAGGAGGG - Intergenic
1188553514 X:31386226-31386248 TGGGGTGAGGGGAGGGAGGAGGG + Intronic
1188570388 X:31578395-31578417 ACAAGTGAGTGGAGGCAGGATGG - Intronic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1188966450 X:36559331-36559353 CTGAGGGTGTGGGGAGAGGAGGG - Intergenic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189444819 X:41070776-41070798 CTGAATGACTGCATGGAGGAAGG - Intergenic
1189676224 X:43463432-43463454 CAGAGAGAGTGAAGGAAGGAAGG + Intergenic
1190397646 X:50000976-50000998 CTGAGAGTGAGGAGGAAGGAAGG - Intronic
1191044427 X:56120650-56120672 GTGAGTGAGTGGCAGCAGGAAGG - Intergenic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1191101608 X:56735566-56735588 CCGGGTGGGTGGAGGGAGGCTGG - Intergenic
1192086157 X:68099502-68099524 CTAAGTGAGTGGCGGGAAAATGG - Intronic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1193535357 X:82709049-82709071 CTAAGTGAGAGGACAGAGGAAGG - Intergenic
1193579539 X:83247183-83247205 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1193743448 X:85244884-85244906 CCAAGTGAGAGGAGGGAGGAGGG + Intronic
1194975922 X:100396031-100396053 GTGTGTGAGAGGTGGGAGGATGG - Intronic
1195006469 X:100690419-100690441 CTAAGAGAATGGAGGGAGGGAGG + Intronic
1195162530 X:102184564-102184586 GTGAGTTGGGGGAGGGAGGAGGG + Intergenic
1195726960 X:107927849-107927871 GTGCGTGACAGGAGGGAGGAAGG - Intergenic
1195831627 X:109065723-109065745 GAGAGTGGGTGGTGGGAGGAAGG + Intergenic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196544003 X:116941421-116941443 GTGAGTGGGGGGAGGGAGGAGGG - Intergenic
1196778102 X:119359620-119359642 CTCAGGGAGTGGAGGGTGGCAGG + Intergenic
1197321019 X:125031104-125031126 CTTAGAGTGGGGAGGGAGGAGGG - Intergenic
1197520019 X:127485974-127485996 GTCAGTGGGTGGAGGGAGAAGGG - Intergenic
1197640655 X:128964262-128964284 AGGAGTGAGGGGAGGGAAGAGGG + Intergenic
1197720624 X:129742363-129742385 GGGAGGGAGTGGAGGGGGGAGGG - Intronic
1197862046 X:130981142-130981164 GTGAGAGGGTGGAGGGAGGTGGG + Intergenic
1198533500 X:137566496-137566518 CAGAGGGATAGGAGGGAGGAGGG - Exonic
1198716873 X:139566960-139566982 GAGAGAGAGAGGAGGGAGGAAGG + Intergenic
1198756654 X:139989145-139989167 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG + Intergenic
1199613246 X:149635176-149635198 CTGAGAGAGAAGAGGGAGGGAGG + Intergenic
1199846332 X:151695077-151695099 CTGGCCGAGTGGAGGAAGGAGGG - Intergenic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1200354873 X:155538119-155538141 GTGATTGAGGGGAGGGAAGATGG - Intronic
1201144717 Y:11057971-11057993 GTGAATGAGTGGATGGAGGGAGG + Intergenic
1201144719 Y:11057975-11057997 ATGAGTGGATGGAGGGAGGGAGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1201672862 Y:16543828-16543850 CAGAGTGAGGGGTAGGAGGAAGG - Intergenic
1201743053 Y:17343956-17343978 CTGATTGTGTGGAGCTAGGAAGG + Intergenic