ID: 906320184

View in Genome Browser
Species Human (GRCh38)
Location 1:44810796-44810818
Sequence CTGTGTGTGCTGTGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 598}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906320177_906320184 -8 Left 906320177 1:44810781-44810803 CCATGCATGCCTGCCCTGTGTGT 0: 1
1: 1
2: 1
3: 37
4: 303
Right 906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG 0: 1
1: 0
2: 6
3: 68
4: 598
906320176_906320184 9 Left 906320176 1:44810764-44810786 CCTGTGTGCAAAAGGATCCATGC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG 0: 1
1: 0
2: 6
3: 68
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906320184 Original CRISPR CTGTGTGTGCTGTGGGAAGA GGG Intronic
901050172 1:6421986-6422008 CTAGGGGTGCTGTGGGCAGAAGG + Intronic
901388394 1:8926240-8926262 CGGAGTGAGGTGTGGGAAGACGG - Intergenic
901417992 1:9129865-9129887 CTGTGTGTGTTGTGAGTGGAAGG + Intergenic
901439866 1:9271400-9271422 CTGTGTGTGTTCTTGGAGGAGGG + Intergenic
901508100 1:9699375-9699397 CTTTGGCTGCTGTGGGAAAATGG - Intronic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
904227304 1:29033263-29033285 CTGTGTCTGGTTTGGGAGGAAGG - Intronic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904596587 1:31650125-31650147 CTGTGGATGCTGTGGGAGCAGGG + Intergenic
904629427 1:31829976-31829998 CTTTATGAGCTGTGGGAAGGAGG + Intergenic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
905013557 1:34762455-34762477 CTGTGTGTGTTGGGGGGTGATGG - Exonic
905037249 1:34926259-34926281 CTGTCTGTGACATGGGAAGAAGG + Intronic
905607030 1:39310427-39310449 TGGTGTGTGCACTGGGAAGAGGG + Exonic
906200541 1:43957388-43957410 CTCTGTGTGCTGGGGAAAGAGGG - Exonic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
906574557 1:46876029-46876051 CTGGTCGTGCTATGGGAAGAGGG - Intergenic
906868263 1:49447078-49447100 GGGTGTGTGCAGTGGGAAGAGGG + Intronic
907794026 1:57696329-57696351 CTGTGGGAGATGTGGGAAGCAGG + Intronic
908029510 1:59984875-59984897 TTGTGTGTGTTGTGGGAGGAGGG + Intergenic
909269149 1:73600815-73600837 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
910508403 1:87976818-87976840 GTGTGTGTGGTGGGGGAAGGGGG - Intergenic
911053516 1:93692256-93692278 CTGTGTGTGCACTGGGGAGGGGG - Intronic
911221298 1:95250248-95250270 CTGTGTGTGAAATGGGGAGAGGG + Intergenic
911549537 1:99262958-99262980 CTGTGTGTGGTGGGGGGTGAGGG + Intergenic
912084535 1:105982273-105982295 CTGGGGGAGCTGTGAGAAGAGGG + Intergenic
913370096 1:118089145-118089167 CTGTGTGTTGTGTGGGGAGAGGG + Intronic
913706788 1:121433698-121433720 CTCTGGGTGCTGTGGGAGGGGGG + Intergenic
915217510 1:154349909-154349931 GTGTGTGTGTTGGGGGCAGAGGG - Exonic
915328456 1:155093475-155093497 ATGTCTGTGGTGTGGGAAGAGGG - Intergenic
915528455 1:156490148-156490170 CTGTGTGTGGGATGGGGAGAGGG - Intronic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
916171765 1:162006540-162006562 CTGTGTGCTCTGAGCGAAGATGG - Intronic
916288052 1:163132511-163132533 CTATTTGAGCTGTGGGAAGGGGG + Intronic
916443346 1:164848830-164848852 CTGTGTGTGCTCAGGGGAGCAGG + Exonic
916584185 1:166135851-166135873 CTGTGTGTGTTCTGCAAAGATGG + Intronic
916695516 1:167231993-167232015 GTGTGTGTGTTGGGGGAGGAGGG - Intronic
917081560 1:171261298-171261320 CTGTGTGTGTTGGGGAAGGAGGG - Intronic
918273852 1:182931673-182931695 TTGTGTGTGCGGGGGGAACAAGG - Intronic
918311296 1:183287406-183287428 GTGTTTGTGCTGCGGGAAGCAGG + Intronic
920204822 1:204283780-204283802 CTGTGTGTGATGTGGGCTGGGGG + Intronic
920748065 1:208647617-208647639 GTGTGTGTTGTGTAGGAAGAGGG - Intergenic
921232199 1:213084186-213084208 ATGTGTGTGCTGGGGGAGAAAGG - Intronic
921487657 1:215733954-215733976 CTGTTGGAGCTGTGGGAAGGGGG - Intronic
922042808 1:221913619-221913641 CAGTGTGTGATATGGGAAGATGG - Intergenic
922857541 1:228787988-228788010 CTGAGTGCACTGTGGGTAGATGG - Intergenic
922900814 1:229135107-229135129 CTGTGGGAGCTGTGAGAAGAGGG + Intergenic
924085495 1:240447251-240447273 CTGTGTGTGTTGGGGGATGTTGG + Intronic
924258823 1:242209279-242209301 CAGGGAGTCCTGTGGGAAGACGG - Intronic
924317848 1:242817112-242817134 CTGCATGTGCACTGGGAAGATGG - Intergenic
924784512 1:247183128-247183150 CTGAGTGTGGGGTGGGAGGAAGG - Intergenic
1062785075 10:257799-257821 CTGTGTGGGATGTGGGATGTCGG + Intergenic
1063494944 10:6498422-6498444 AAATGTGGGCTGTGGGAAGAAGG + Exonic
1063601677 10:7487345-7487367 GTGTGTGTGGTGAGAGAAGAAGG - Intergenic
1064068830 10:12207690-12207712 CTGTCTGTGTTGTGGGAGCAGGG + Intronic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1067250102 10:44578762-44578784 TTCTGTGTGCTGGGGGAGGAAGG + Intergenic
1067297727 10:44984364-44984386 CTGTGTGTGCTATGGGAAACAGG + Intronic
1068052533 10:51968485-51968507 CTGTGTGTGCTGAGTGGCGATGG + Intronic
1068620667 10:59177346-59177368 GTGTGTGTGTTGGGGGAAGGGGG - Intronic
1068665291 10:59668462-59668484 GTGTGTGTGCTGGGGAGAGAGGG - Intronic
1068753605 10:60624957-60624979 GTGTGTGTGCACAGGGAAGAAGG - Intronic
1069780783 10:70954103-70954125 ATGGATGTGCTGAGGGAAGAAGG - Intergenic
1069846361 10:71374527-71374549 GTGTGTGTGTTGTGGGAAGCAGG + Intergenic
1069871329 10:71534985-71535007 CTGTGTGGGCTGTCAGGAGAGGG + Intronic
1070649984 10:78228415-78228437 CTTTGTGTGCTGGGAGAAGGAGG + Intergenic
1070658744 10:78289710-78289732 CTGTGTGTGCTGGTGGGAGCTGG + Intergenic
1071415153 10:85434139-85434161 CTGTGTGGGTTGTGGGAGGATGG - Intergenic
1071665431 10:87551184-87551206 TTGTGTGTGTTGGGGGCAGAGGG + Intronic
1071769662 10:88713053-88713075 CTGTGTCTCCTGTGTGATGATGG - Intergenic
1071849544 10:89554654-89554676 ATGTGTGTGTTGTGGGGAAACGG + Intronic
1072623577 10:97096706-97096728 CTGGGTTTGCTGGGGGAAGGGGG - Intronic
1072650803 10:97293648-97293670 CTGTGGGTTCTCTGGGAAGTTGG - Intergenic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1072809980 10:98453966-98453988 CAGGGTGTTCTGTGGGGAGAGGG - Intergenic
1072845418 10:98825184-98825206 ATGTGTGTGAGGTGGGGAGAGGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074116014 10:110458000-110458022 CTGGGTGTGGAGTGGGGAGAGGG + Intergenic
1074290347 10:112133511-112133533 TCGTCTGTGCTGGGGGAAGAAGG - Intergenic
1075242696 10:120792941-120792963 GTGTGTGTGTTGTGGGAGGGGGG - Intergenic
1075242758 10:120793181-120793203 GTGTGTGTGTTGTGGGAGGGGGG - Intergenic
1076314531 10:129531244-129531266 CTGTGCGGGCTGTTGGGAGAGGG + Intronic
1076326468 10:129627183-129627205 ATGGGTGTGCTGGGGGATGAGGG + Intronic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076869248 10:133185496-133185518 CAGTGTGTGCAGTGTGAAGTAGG + Intronic
1077267665 11:1660070-1660092 CTGTCTCTGCTGTGTGATGAGGG + Intergenic
1077523210 11:3048618-3048640 CTCTGGGTGCTGGGGGATGAGGG + Intronic
1077774795 11:5258847-5258869 CTGTGGCTACTGTGGGAGGATGG - Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1077999037 11:7478313-7478335 CTCTGTGTGATGGGGGAAGGTGG + Intergenic
1078045138 11:7906719-7906741 CTGTGTGTGCTGCCAGTAGATGG - Intergenic
1078650092 11:13182469-13182491 GTGTGTGTGTTGTGGGAGGGAGG + Intergenic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1078673112 11:13382510-13382532 GTGTGTGTGTTGTGGGCAGGGGG - Intronic
1079013773 11:16851400-16851422 GTGTGTGGGTTGTGGGAGGATGG - Intronic
1079117005 11:17646279-17646301 GGGTGAGAGCTGTGGGAAGATGG + Intronic
1079310219 11:19358740-19358762 CTGTGTAAGAGGTGGGAAGAGGG - Intronic
1079457311 11:20648047-20648069 CTGTGTTTGCAGTGTGAAGTGGG - Intronic
1080505723 11:32911282-32911304 CTGGGGGTGGTGGGGGAAGACGG + Intronic
1080714367 11:34784366-34784388 CTGTGTGTGCTGTGGAGGTAAGG + Intergenic
1081626076 11:44655977-44655999 GTGTGTGTGTTGGGGGCAGAGGG + Intergenic
1081963636 11:47156298-47156320 CTGGGGGTGCTGTGAGAAGAGGG - Intronic
1081968762 11:47184939-47184961 CTGTGTTTGCTCTGGGAGGCCGG - Intronic
1082097091 11:48139715-48139737 CACTGTGTCCTGTGGAAAGATGG + Exonic
1082874364 11:57972825-57972847 CTGTGTATGCTGAGGGGAGTGGG + Intergenic
1082896004 11:58190734-58190756 CTGGCTGTGCTGTGGGAGCACGG + Exonic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083878066 11:65535129-65535151 ATGGGTGTGCTCTGGGATGAGGG + Intronic
1084018309 11:66400519-66400541 CTGTGTGTGGTGTCAGCAGAGGG - Intergenic
1084182522 11:67454059-67454081 CTGCCTGAGCTGTGGGAAGCGGG - Intronic
1084380253 11:68807408-68807430 CAGTTTGGGCTTTGGGAAGAAGG - Intronic
1084536598 11:69761023-69761045 GTGTGTGTACTGGGGGAACAGGG - Intergenic
1084861914 11:72024531-72024553 CTGTGTGGTGGGTGGGAAGAGGG + Intronic
1087118710 11:94550381-94550403 GTGTGTGTGGTGTTGGAGGAGGG - Intronic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1088100082 11:106144975-106144997 CTGTGTGAGCTCTGTGAAGGTGG - Intergenic
1088259478 11:107930131-107930153 GTGTGTGTGAAGTGGAAAGATGG + Intronic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089092188 11:115887388-115887410 GTGTGTGTGCTTGGGGAAGGTGG + Intergenic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1090762494 11:129849588-129849610 CTGTATGAGCTGTGGGAGCACGG - Intronic
1090940798 11:131386515-131386537 CTGTCTGTGGTGTAGGAAGGAGG + Intronic
1091198128 11:133749122-133749144 CACTGTGTGCTGTGGGGAGAGGG + Intergenic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1091664978 12:2412247-2412269 CGGTGTGTGCTGTGGAAGGACGG - Intronic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1092261565 12:6955853-6955875 CTGTGGGGGGTGTGGGGAGATGG - Intronic
1092337108 12:7642850-7642872 CTGGTTGTGCTATGGGAAGAGGG - Intergenic
1093866028 12:24228524-24228546 GTGTGTGTGGTGGGAGAAGAGGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1093958824 12:25251045-25251067 CTGAGGGCGGTGTGGGAAGAGGG + Intergenic
1093998375 12:25667073-25667095 TTGTGCCTGCTGTGGGAAAATGG - Intergenic
1094034619 12:26054608-26054630 CTCTTTGTCCTGTGGGGAGAGGG + Intronic
1094110450 12:26856327-26856349 CTTTGTCTGCTGTGTGAAGAAGG + Intergenic
1094150048 12:27272744-27272766 CTGTGTGTGTTGGGGGAAAGAGG - Intronic
1096345433 12:50842343-50842365 CCGTGTGGGCTGTGGGAAGTTGG - Intergenic
1096429391 12:51530791-51530813 GTGTGTGTGCGGTGGGATGGGGG + Intergenic
1096480301 12:51935861-51935883 CTCTGTGTGCATAGGGAAGAAGG - Intergenic
1096623034 12:52876439-52876461 TGGTGCGTGCTGTGGGAGGAAGG - Intergenic
1097223394 12:57463068-57463090 CTGTGTGGTCTGTGTGTAGAAGG - Intronic
1097237691 12:57550923-57550945 GTGTGTGTGTTGTGGGGAGTAGG + Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1098532596 12:71557752-71557774 CTGAGTGTGCTGGGAGAGGAGGG + Intronic
1099526801 12:83726603-83726625 CTGGTCGTGCTGTGAGAAGAGGG + Intergenic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1099950053 12:89291888-89291910 GTGTGACTGCTGTGGAAAGAAGG + Intergenic
1100032412 12:90209289-90209311 CCTAGTGAGCTGTGGGAAGAGGG + Intergenic
1100355652 12:93826753-93826775 CGATGTTTGCTGTGTGAAGATGG - Intronic
1100960032 12:99952590-99952612 CTTTCTCTGCTGTGGGAAGTTGG - Intronic
1101652477 12:106690066-106690088 GTGTGTGTGTTGTGGGAAGGGGG + Intronic
1101654449 12:106707724-106707746 CTGTCTGTGATGTGGGAGAAAGG + Intronic
1101658730 12:106747544-106747566 CTGTGTGTGACGGAGGAAGAAGG - Exonic
1101817948 12:108160168-108160190 CTGTGAGTTCTGCAGGAAGATGG + Intronic
1101879839 12:108618657-108618679 CTGGGGGTGCTGATGGAAGAAGG - Intergenic
1102564203 12:113784251-113784273 GTGTGTGTGCTGTGTTAAGCAGG - Intergenic
1103529467 12:121590635-121590657 CTTTTTGTGCTGTTGGAACAGGG + Intergenic
1103955833 12:124576303-124576325 GTGTCTGTGCCCTGGGAAGAAGG - Intergenic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104477009 12:129078963-129078985 ATGTGTGGGGTGTGGGGAGAGGG - Intronic
1104545993 12:129713460-129713482 CTTTGTGTGTTTTGGGAAGGAGG + Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105450422 13:20494475-20494497 GTGTGTGTTCAGTGGAAAGATGG - Intronic
1105465654 13:20637325-20637347 CTGTGAGTGTTATGGGAAAAGGG + Intronic
1106559017 13:30833011-30833033 CTCTGTGTGCTGCGGGGACAGGG - Intergenic
1107501436 13:40981336-40981358 GTGTGTGTGTTGTGGGGAGGGGG + Intronic
1108283804 13:48885904-48885926 GTGTGTTTGCTGTGGGAGCAGGG - Intergenic
1109018185 13:57048008-57048030 TTGTGTTTGTTGTGGGAACATGG - Intergenic
1109276141 13:60306392-60306414 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
1109658822 13:65431421-65431443 GTGTGTGTACTGGGGGCAGAGGG + Intergenic
1110181772 13:72625979-72626001 CTGTGGGTTCTGTGGGAGCAGGG + Intergenic
1110267875 13:73558887-73558909 TGGTGTGTGCTGAGGAAAGAGGG - Intergenic
1111128579 13:83944345-83944367 CTGTGTGTGTGGTGGGGTGATGG + Intergenic
1111251044 13:85601756-85601778 CTGTGTGTACACTGTGAAGAGGG - Intergenic
1111619719 13:90708422-90708444 CTGTGTGTGTTGTAGAAGGAGGG - Intergenic
1112274869 13:98007204-98007226 CTGTGTGTGGTGGGGAAAGGAGG - Intronic
1113005589 13:105698446-105698468 CAGTGTGCTCTGTGGGAATATGG - Intergenic
1113336082 13:109377215-109377237 GTGTGTCTGCTGAGGCAAGAGGG - Intergenic
1113343538 13:109450424-109450446 CTGGGAGTGCTGGGGGCAGAAGG - Intergenic
1113383220 13:109823216-109823238 CTGTGTGGGGTGGGGGAAGTGGG - Intergenic
1113667891 13:112153608-112153630 GGGTGTGTGCTGTGGGCAGGTGG + Intergenic
1113882878 13:113637470-113637492 CAGGATGGGCTGTGGGAAGAGGG + Intronic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1118350381 14:64969567-64969589 CTCTGTGTCCTGTGGAAAGGGGG + Intronic
1118456433 14:65948982-65949004 GTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1119474220 14:74917917-74917939 GTGGGGGTGCTGTGGGAAGCGGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119655093 14:76411602-76411624 CTGTGTGTGTTGCAGGAAGGAGG + Intronic
1119871975 14:78025829-78025851 GTGTGTGTGTTGGGGGAGGAGGG + Intergenic
1120710065 14:87784088-87784110 GTGTGTAGGTTGTGGGAAGATGG + Intergenic
1121001833 14:90456652-90456674 CTGTCTGTGCAGTGGGGAGGTGG - Intergenic
1121115202 14:91338447-91338469 CTGTGTGTCCTGGGGGTAGCAGG - Intronic
1121481609 14:94281751-94281773 CAGTGTATGTGGTGGGAAGAAGG + Exonic
1121616855 14:95319466-95319488 GTGTGTGTGTTGTGGGGCGAGGG - Intronic
1121626182 14:95387066-95387088 GTGTGTGTGCAGTGGGGAGCAGG - Intergenic
1122117125 14:99533336-99533358 CTCTGTGTGGTGTGGCAGGAGGG - Intronic
1122328060 14:100894575-100894597 TACTGTGTGCTGAGGGAAGATGG - Intergenic
1122737240 14:103849734-103849756 CCGTGTGTGCTCCAGGAAGATGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123015468 14:105371904-105371926 CTGTGTGTTGTGTGGTGAGAGGG + Intronic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1125186163 15:36933036-36933058 CTGTGGGTGCTGAGAGAAGGGGG - Intronic
1125250288 15:37694177-37694199 GTGTGTGTGTTGTGGGTGGAAGG - Intergenic
1125325903 15:38535594-38535616 GTGCTTCTGCTGTGGGAAGAGGG - Intronic
1125740029 15:41956044-41956066 CTGTGTGTGCTGCGGGGAGCTGG - Intronic
1126660831 15:51031487-51031509 ATATGTGTGCTTTGGGGAGAGGG - Intergenic
1127273786 15:57424425-57424447 GTGTGGGTTCTGTGGGAAAAAGG + Intronic
1127690363 15:61389617-61389639 CTGTGGGTGGTTTGTGAAGAAGG + Intergenic
1128055990 15:64700561-64700583 CCGTGTGTGCTGAGGATAGATGG - Intronic
1128065179 15:64760098-64760120 CTGTGTGTGCCCTGGAAGGAGGG - Intronic
1128523352 15:68390207-68390229 TTGTGAGTGAGGTGGGAAGAAGG + Intronic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129279561 15:74473606-74473628 CTGGGAGTGATGTGGGAAAATGG - Intergenic
1129291061 15:74568043-74568065 CTCTGTCTTCTGGGGGAAGATGG + Intronic
1130085249 15:80772563-80772585 CTTTGTGTGCTTTGAAAAGAAGG + Intergenic
1130624883 15:85503960-85503982 CTTTGTGTGCTGTGTGTTGAAGG + Intronic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131403639 15:92145966-92145988 CTCTGTGTTCTGTGGGGAGAGGG + Intronic
1131939533 15:97545748-97545770 CTTTCTGTGCTGTGAGAAAATGG - Intergenic
1131995081 15:98125559-98125581 CTGGGAGTGCTCTGGGAAGGTGG + Intergenic
1132012832 15:98290999-98291021 TTGTGTGTGCTGTGGGGATGGGG + Intergenic
1132764117 16:1525802-1525824 TTGTGTGTGCTGTGGTGAGGTGG - Intronic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1133488006 16:6239116-6239138 CAGTGTATGCTGTGGGAATGGGG - Intronic
1134108603 16:11500825-11500847 ATCTGTGGGCTGTGGGAGGAAGG + Exonic
1134444474 16:14320458-14320480 CTGTGGGCGCTTAGGGAAGAAGG - Intergenic
1135169166 16:20167967-20167989 CAGTGTGTGTTGTGGTAAGATGG + Intergenic
1135664575 16:24325150-24325172 CTGTGTCTACTGGGGGAAGAGGG + Intronic
1136186293 16:28590759-28590781 GTGTGTCTCCTGGGGGAAGAGGG - Exonic
1136417387 16:30112425-30112447 CTGGGGGTGGTGTGGGAAAAGGG + Intronic
1136448305 16:30337359-30337381 CAGTGTGTCCTGTGCGAACACGG - Intergenic
1137347236 16:47675472-47675494 GTGTGTGTGTTGGGAGAAGAGGG - Intronic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1137645319 16:50068107-50068129 CTCTGTATGCTGTGGGAGGAAGG - Intronic
1137733674 16:50708733-50708755 CTGTGTGTGGTGCTGGCAGATGG + Intronic
1138644868 16:58417379-58417401 CTGATAGTGCGGTGGGAAGAGGG - Intergenic
1138799500 16:60010754-60010776 GTGTGTGTGTTGTGTTAAGAAGG - Intergenic
1138865219 16:60810041-60810063 ATGTGTGAACTGTGGCAAGAGGG + Intergenic
1139250645 16:65492222-65492244 GTGTGTGTGGTGTGGCAGGAGGG - Intergenic
1140462036 16:75147665-75147687 TTGTGTGTGCTGGGGGGACATGG + Intergenic
1140825567 16:78702800-78702822 CTCTGTGTGCTGCGGGTCGAGGG + Intronic
1141362379 16:83407953-83407975 CTGGGAATGTTGTGGGAAGAGGG - Intronic
1141559051 16:84854588-84854610 GGTTGTGTGCTGTGGGAAGCGGG - Intronic
1142169593 16:88614786-88614808 CTGTGTGTGCTGTAGGGGAAGGG - Intronic
1142183058 16:88681044-88681066 CGGTCTGGGCTGGGGGAAGAGGG - Intronic
1142358821 16:89616680-89616702 CGGAGTGTGCTGAGGGGAGAAGG - Intronic
1142606449 17:1084020-1084042 GTGTGTGTGCTGGGGGGAGCTGG + Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1143021848 17:3921010-3921032 CTGGGGGTGCTGAGGAAAGATGG - Intergenic
1145956868 17:28860717-28860739 CTGTGTCTTCTGTTGGAAGAAGG + Exonic
1146019165 17:29261073-29261095 CTGTGTATTTTGTGGGAAAAGGG + Exonic
1146194511 17:30800110-30800132 CTGGGAGTGGTGTGGGAAAAAGG - Intronic
1146229388 17:31095010-31095032 CTGTGATGGCTGTGGGGAGACGG + Exonic
1146720149 17:35118474-35118496 GTGTGTGTACTTGGGGAAGAAGG - Intronic
1147914808 17:43879913-43879935 CTTTGTGTCCCGTGGGGAGATGG - Exonic
1148778826 17:50110482-50110504 CTTTGTGGGCTGGGGGAATAAGG - Exonic
1148921216 17:51036545-51036567 CTGTGTGTGGTAGGGGGAGAGGG - Intronic
1148958603 17:51374446-51374468 CTGGCAGTCCTGTGGGAAGAAGG - Intergenic
1150700758 17:67444929-67444951 TAGTGTGCGCTGTGGGAGGAGGG + Intronic
1151387078 17:73761447-73761469 CAGTGGGTGCTGTGTCAAGATGG + Intergenic
1151446025 17:74164633-74164655 GTGTGTGTGTTGTGGGGGGATGG - Intergenic
1151518675 17:74613530-74613552 CTGTGGGGTCTGTGGGGAGATGG - Intronic
1151635398 17:75344218-75344240 CTGTGTGGACTGTGAGTAGAAGG + Intronic
1151655616 17:75494608-75494630 CTGTGTGTCCTGCCTGAAGAAGG + Exonic
1151905291 17:77044147-77044169 CTGTGTGCACTGTGGGCAGAGGG + Intergenic
1152120178 17:78413679-78413701 CTGGGTGCCCTGTGGGAGGAAGG + Intronic
1152394797 17:80025797-80025819 CTGTTCCTGCTGTGTGAAGAAGG - Intronic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1152607656 17:81301068-81301090 ATGTGTGTGGTGTGGGTGGATGG + Intergenic
1152775030 17:82195822-82195844 CTGTGTGGGCTCTGGGATGCTGG - Intronic
1154513567 18:15135994-15136016 CTGGTGGAGCTGTGGGAAGAGGG - Intergenic
1155060425 18:22223511-22223533 CTGTGCGTGCTGGGGGAACAAGG + Intergenic
1156372936 18:36487815-36487837 CTGTGTGTCCTCTGGTAAGGAGG - Intronic
1156585444 18:38426347-38426369 CTGCATGTGTTGGGGGAAGATGG + Intergenic
1157234379 18:45950019-45950041 TTGAGTGTGTTATGGGAAGAGGG - Intronic
1157287465 18:46386826-46386848 TCCTGTCTGCTGTGGGAAGAAGG - Intronic
1157454035 18:47810333-47810355 GTGAGTGTGCAGTGGGAGGAGGG - Exonic
1157546567 18:48550623-48550645 CAGACTGTGCTGTGGGAAGAGGG - Intronic
1159319608 18:66830253-66830275 CTATTTGAGCTGTGAGAAGAGGG - Intergenic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1159968145 18:74617026-74617048 ATGTGTGTGCTGTGTGGATATGG - Intronic
1160227821 18:77024945-77024967 CTGCGGGTGCTGTGGGTGGAAGG - Intronic
1160512964 18:79462850-79462872 CAGTGTGTGCAGTTGGAAGCTGG + Intronic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161445607 19:4317323-4317345 CTCTGGGGGCTGTGGGAGGAAGG - Intronic
1162140080 19:8580441-8580463 CTGTGTCTGCTATGGGAGGGGGG - Exonic
1163601612 19:18252390-18252412 CTGTGGGTGCTGTGGGCGAAGGG + Intronic
1164679551 19:30124522-30124544 CTGTGTTTGCCTTGGAAAGAGGG - Intergenic
1165976628 19:39681897-39681919 CTGTGTCTGCTCTGGGGAAAGGG + Intergenic
1166199484 19:41227150-41227172 GTGTGTGTGCTGGGGGAGGGGGG + Intronic
1166275730 19:41752532-41752554 TTGTCTGGCCTGTGGGAAGATGG - Intronic
1166283584 19:41810448-41810470 CTGTGTGTTTTGGGGGAAGGTGG - Intronic
1166290729 19:41861547-41861569 CTGTGTGTCCTCTGGCAAGTTGG + Intronic
1166438695 19:42791579-42791601 ATGGTTGTGCTATGGGAAGAGGG + Intronic
1166487654 19:43227433-43227455 ATGGTTGTGCTATGGGAAGAGGG + Intronic
1166494489 19:43289305-43289327 ATGGTTGTGCTATGGGAAGAGGG + Intergenic
1166514721 19:43437801-43437823 CTGTGCCTGCTGTTGGTAGAAGG - Intergenic
1166803038 19:45469677-45469699 CTGTGTGTGCCTGGAGAAGAGGG - Intronic
1167384063 19:49153830-49153852 CTGTGTGTCCTGGGGGGTGATGG + Exonic
1167530934 19:50015980-50016002 CTGTTTCTGCGGTGGGAATAAGG - Intronic
1168193547 19:54757049-54757071 CTGTGTGTGCTGGGGTCACAGGG - Intronic
1168241573 19:55091620-55091642 CTGTGGGGGCTGTGGGCAGAGGG - Intronic
1168283991 19:55321411-55321433 CTGGGTGAGCTTAGGGAAGAAGG + Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
1168431310 19:56283198-56283220 GTGTGTGTGCAGTGGGAGCAGGG - Intronic
1168483039 19:56737357-56737379 CAGGGTGGGCTGTGGGAAGTGGG - Intergenic
925123447 2:1437419-1437441 CTGGGTGTGCTGAGGTCAGAAGG + Intronic
925441906 2:3895319-3895341 CTGCAGCTGCTGTGGGAAGATGG + Intergenic
925652329 2:6104332-6104354 CTGTGGCTGCTGTGGGGGGATGG + Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
926174543 2:10578281-10578303 CTGTTCATGCTGTGGGATGATGG - Intronic
926526849 2:13991955-13991977 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
927217066 2:20673754-20673776 TTGTGAGTGGTGTGGGAAGTAGG + Intergenic
928435795 2:31253730-31253752 GGGTGTGTCTTGTGGGAAGAAGG + Intronic
928475627 2:31624509-31624531 CTGTGTGGGGTGGGGGGAGAGGG - Intergenic
929117738 2:38458331-38458353 CTGTGTGTGCTGAGAGGGGATGG - Intergenic
930058707 2:47271686-47271708 ACGTGTGAGGTGTGGGAAGATGG + Intergenic
930168074 2:48222818-48222840 CTGTCTGTTTTGTGGGAAGGTGG - Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
930512129 2:52358737-52358759 CTGTTGGAGCTGTGAGAAGAGGG + Intergenic
931257686 2:60587721-60587743 CTCTGTGGGTTGTGGGTAGATGG + Intergenic
931944351 2:67288414-67288436 GTGTCTGTGCTTGGGGAAGAAGG + Intergenic
932108605 2:68972241-68972263 CTTTGTGTGGTGTGGGAGGTTGG - Intergenic
932114303 2:69032309-69032331 CTATCTGAGCTGTGGGATGATGG + Intronic
932143090 2:69296831-69296853 CTGTGGCTGGTGTGGAAAGAGGG - Intergenic
932197309 2:69795912-69795934 ATGGTTGTGCTATGGGAAGAGGG + Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932481557 2:72042419-72042441 GTGTGTGTGGTGTGGTAAGAGGG + Intergenic
933150682 2:78911308-78911330 GTGTGTGTGATGGGGGAAGGGGG - Intergenic
934900268 2:98154420-98154442 ATGTGTGCGCTAAGGGAAGAGGG - Intronic
935134259 2:100285621-100285643 CTGTCTGGGCTGTGGTCAGAGGG + Intronic
935531520 2:104238553-104238575 CTGTATGTACTGTGGGCTGAGGG - Intergenic
935638847 2:105271569-105271591 CTGTGTGACCTGTGGCAAGCGGG + Intronic
936343161 2:111655369-111655391 ATGGCTGTGCTGTGGGAGGAAGG + Intergenic
936743895 2:115549936-115549958 ATGTGTGTGATGTGGGAAAAAGG - Intronic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937322089 2:120966945-120966967 CTGTGTGTACTGTGAGCAGGAGG + Intronic
937726765 2:125175976-125175998 CTAGGGGAGCTGTGGGAAGAGGG + Intergenic
938065682 2:128280855-128280877 GTGTGTGTCCTGAGGCAAGAGGG - Intronic
939112812 2:138028642-138028664 CTCTGTGTGCTGTGGAAAAGTGG + Intergenic
940154699 2:150643201-150643223 GTGTGTGTGCTGGGGGAGGATGG - Intergenic
940415576 2:153415772-153415794 CTGTTTCTGCTGTGAGAATAGGG + Intergenic
940989842 2:160086046-160086068 ATGGTTGTGCTATGGGAAGAGGG + Intergenic
941079517 2:161044451-161044473 GTATGTGTGCTTTTGGAAGATGG - Intergenic
942264724 2:174211168-174211190 GTGTGTGTGTTGTGGGGAGGAGG - Intronic
942428990 2:175889424-175889446 ATGGGTGTGCTGCAGGAAGACGG - Intergenic
942485252 2:176432521-176432543 GTGTGTGTATTATGGGAAGAAGG - Intergenic
942662581 2:178281994-178282016 CTGTGTGTACTCCGGGAAGCAGG - Intronic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
943226430 2:185185026-185185048 CTGAGTCTGCGGTGGGAGGAGGG - Intergenic
944300572 2:198120049-198120071 CTATGTGTCATTTGGGAAGATGG + Intronic
945437243 2:209833094-209833116 CTTTGGGTTCTGTGGGAAGCAGG - Intronic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
946053156 2:216880603-216880625 CAGAGTGGGCTTTGGGAAGAAGG + Intergenic
946081899 2:217127781-217127803 CTGTGTTTGCTCAGGGAAAATGG + Intergenic
946148340 2:217747705-217747727 CTTTGTGTGATGTGAGAAGCAGG - Intronic
946167412 2:217873458-217873480 CTAACTGTGCTGTGGGAACAGGG + Intronic
947017541 2:225638184-225638206 GTGTGTGTGGTGTGGGAGGGGGG + Intronic
947712583 2:232324541-232324563 CTGAGTGTCCTGTGTGAGGAAGG + Intronic
947794612 2:232886331-232886353 CAGTGTGTACTGTGTGATGAGGG + Intronic
947924713 2:233911250-233911272 CTGTGTGTGCTGCAGCCAGAAGG + Intergenic
948139143 2:235660078-235660100 CTGTGTGTGCTGAGGGGTGGGGG - Intronic
1168997404 20:2143680-2143702 CTGTGTGTGCTGGGGGCTGTGGG - Intronic
1169529315 20:6467127-6467149 CTTTGTGTCTTGTGGGAAGCAGG + Intergenic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1169927594 20:10799135-10799157 CTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1169965637 20:11214498-11214520 CTATGAGTGCTGTAGGAAGAAGG + Intergenic
1170001883 20:11623936-11623958 CTGTGGGTGCTATGAGAAGAGGG + Intergenic
1170342661 20:15346591-15346613 ATGTGTGTGCCGGGGGAAGGAGG + Intronic
1172298835 20:33833505-33833527 CTCTGGCTGCTGTGGGGAGAAGG - Intronic
1172384367 20:34523288-34523310 CTCTGGCTGCTGTGGGGAGAAGG - Intronic
1172969999 20:38866283-38866305 GTGTCTGTGCAGCGGGAAGAAGG + Intronic
1173290801 20:41713315-41713337 GTGTGTGTGTCTTGGGAAGAAGG - Intergenic
1173903641 20:46609800-46609822 CTCTCTGTGGTGTGGGAAGTTGG - Intronic
1174529785 20:51202267-51202289 GTGTGTTTGCCGTGGGGAGAGGG + Intergenic
1174798004 20:53538726-53538748 GTGTGTTTGCTTTGGGCAGAAGG + Intergenic
1174845698 20:53941120-53941142 GTGTGTGTGAAGTGGGAGGAGGG + Intronic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1175925518 20:62469444-62469466 CTGTGTGTGCTAAGGGGTGATGG - Intronic
1176884438 21:14237532-14237554 CTGGATGTTCTGTGGGTAGAAGG - Intergenic
1178704835 21:34864574-34864596 CTGTGTGTGCTGCTGGAAGTCGG + Intronic
1179010259 21:37551164-37551186 GTGTGCGTGCTGTGGGAGGGGGG - Intergenic
1179032878 21:37735640-37735662 GTGTATGGGCTGTGGGAGGAAGG + Intronic
1179035440 21:37755555-37755577 CTGTGTGTGCTTTGCCATGAGGG + Intronic
1179153713 21:38831515-38831537 CTGTGTGTTCTTTGGGTAGGAGG - Intergenic
1179157986 21:38867161-38867183 TTGTGTGTGGTGTGAGACGAGGG - Intergenic
1179190973 21:39121458-39121480 CTGTGACTGCTGTGGGCAGGGGG - Intergenic
1179224817 21:39444244-39444266 CTGTCTTTGCGCTGGGAAGAAGG + Intronic
1179381224 21:40901123-40901145 CTGTGTGTGTTGTGGGGGGGGGG - Intergenic
1179487964 21:41722846-41722868 GTGTGTGTGCGGGGGGAAGTGGG - Intergenic
1179560176 21:42210795-42210817 CTGTGTGTGCTTGGTGAAGAAGG + Intronic
1179658222 21:42858861-42858883 CTTTGTGTGGTGTGGCAGGATGG - Intronic
1181283939 22:21739017-21739039 CTGAGTGGGCTGTGGGAAAGTGG - Intergenic
1181465147 22:23106922-23106944 CTGTGTGTGCAGTGTGGAGGGGG - Intronic
1181537566 22:23554433-23554455 CTGGCTGTGCTGTGGGGATAGGG - Intergenic
1181644954 22:24226112-24226134 GTGTCTGTGCTGGGGGAGGATGG - Exonic
1183501132 22:38180101-38180123 GTGTGTGTGCTGGGGGAAGTAGG - Intronic
1183952279 22:41358484-41358506 CTGTGTGAGGTGTGGGAGGTGGG + Exonic
1184631560 22:45784642-45784664 CTGTGTGTCCTCTGGGCACAGGG - Intronic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1185254836 22:49826573-49826595 CTGGGCGGGCGGTGGGAAGATGG - Intronic
949408525 3:3739699-3739721 GTGTGTGTGTTGGGGGAGGAAGG - Intronic
950259991 3:11536653-11536675 CTATGGGTGCAGTGGCAAGAGGG - Intronic
950335848 3:12192308-12192330 TTATGTGTGTTGTGGGAGGAGGG - Intergenic
950419154 3:12886753-12886775 CTGGGGGTGCTACGGGAAGAAGG + Intergenic
950666947 3:14503489-14503511 GTGTGTGTGCAATGGGAGGAAGG - Intronic
951304341 3:21039913-21039935 AGATTTGTGCTGTGGGAAGAAGG + Intergenic
951387970 3:22065686-22065708 ATGTGTGTGCTGTGGGGGAATGG + Intronic
952124841 3:30288635-30288657 GTGTGTGTGTTGTGGGGCGATGG + Intergenic
952819480 3:37473472-37473494 CTGGGGGTGCTGTGGGAAGGGGG + Intronic
952883544 3:37999450-37999472 CTGGGTTAGCTGGGGGAAGATGG + Intronic
953075306 3:39564587-39564609 CGTTGTGTGCTCTGGGAAGCAGG + Intergenic
953747331 3:45585249-45585271 CTGTGTGTCATGTAGGGAGAGGG + Intronic
953777016 3:45828119-45828141 CTCTGCAGGCTGTGGGAAGAAGG + Intronic
954132075 3:48566018-48566040 CTGTGTGGGGAGTGGGATGATGG - Intronic
954195947 3:48997322-48997344 CTATGTGTTGAGTGGGAAGATGG - Intronic
954331840 3:49895365-49895387 CAGGGAGTGCTGTGGGGAGAGGG + Exonic
954574145 3:51665816-51665838 GTGTGTGTGTTGTCGGGAGAAGG + Exonic
955156820 3:56425199-56425221 GTGTGTGTTTTGTGGGGAGATGG - Intronic
955286094 3:57643408-57643430 GTGTGTGTGTTGTGGGGGGAGGG - Intronic
955784933 3:62527439-62527461 CTGTGTGTGCTGGGGGTGGGGGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957579437 3:82051826-82051848 CTGTGTGTGCTGTGAAAAAGTGG + Intergenic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
960466089 3:117997726-117997748 CTGTGTTTGCTGAGAGCAGAGGG - Intergenic
960730544 3:120722046-120722068 GAGAATGTGCTGTGGGAAGAAGG - Intronic
962237431 3:133718460-133718482 CTGTGTTTTCTCTGGGAAGCAGG + Intergenic
962361748 3:134748888-134748910 CAGTGGGTTCTGTGGGCAGATGG + Intronic
962405050 3:135093361-135093383 GTGTGAGTGGTGTGGCAAGAAGG - Intronic
962776660 3:138667422-138667444 GTGTGTGTGTTGTGGGGAGGAGG + Intronic
964187652 3:153965884-153965906 CTGTGTGGGGTGGGGGAAGGGGG + Intergenic
964398318 3:156272070-156272092 CTGTGTGAGCTGTGTGGAGCTGG + Intronic
964501697 3:157355036-157355058 CCGTCTGTCCTGTGGAAAGAAGG - Intronic
965957575 3:174389466-174389488 CTATTTGAGCTGTGAGAAGAGGG - Intergenic
966049047 3:175590901-175590923 GTGTGTGTGCTTAGGGATGAAGG + Intronic
966159605 3:176953972-176953994 CTGTGTGTTCTCAGAGAAGAAGG - Intergenic
967359383 3:188612238-188612260 CTGTCTGTGCTTTGGGAAAGGGG + Intronic
968121656 3:196130191-196130213 TTGCGTGTGGTGTGGGACGAAGG + Intergenic
968767213 4:2478841-2478863 CTGGTAGAGCTGTGGGAAGAGGG + Intronic
968769122 4:2492583-2492605 CTGTGAATGGTATGGGAAGATGG + Intronic
968903867 4:3443036-3443058 CGGTGAGTGCTGTGGGGAGGGGG - Exonic
969407278 4:7001924-7001946 CGGTCTGAGCTGTGGAAAGACGG + Intronic
969414163 4:7047986-7048008 CTGTGGGTGATGTGGGAACGTGG + Intronic
969604437 4:8195472-8195494 CTGGGTGTGCTGTGTGGAGTCGG + Intronic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970769987 4:19600747-19600769 CTATGTGTGTTGTGGGGATAGGG + Intergenic
970999307 4:22304165-22304187 CTGAGGGAGCTGTGGGAAGAGGG + Intergenic
971026164 4:22589927-22589949 TTGTGTGTGTTGTGTGATGAGGG - Intergenic
971124568 4:23739308-23739330 ATGTGTATGTTGTGGGAAGGAGG - Intergenic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
971385069 4:26134796-26134818 CTGGGTGTGCTGTGAGGAAATGG + Intergenic
971978145 4:33717815-33717837 TTGTGTGTGATGTGAGATGAGGG + Intergenic
972163523 4:36254534-36254556 CTATGTGTGCTGTGAGGAGGAGG + Intergenic
972691500 4:41403202-41403224 CTGGGGGTGGTGGGGGAAGATGG + Intronic
972898187 4:43649846-43649868 TTGTTTCTGCTTTGGGAAGATGG - Intergenic
974763115 4:66305082-66305104 CTGTGGGTGCTGTGGGGGTAGGG + Intergenic
975539494 4:75491540-75491562 GTGTGTGTGGTGTGGGGAGGTGG - Intronic
975651851 4:76601252-76601274 CTGTGTGTGGTGTGGGGAGGGGG + Intronic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
977227131 4:94405988-94406010 GTGTGTGTGATGGGGGAGGATGG - Intergenic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
979988877 4:127350409-127350431 CTGTGTCTTTTGTGGGAACATGG + Intergenic
981309748 4:143285642-143285664 CTGTATGGGGTGGGGGAAGAGGG - Intergenic
981784357 4:148461176-148461198 GTGTGTGTGTTGGGGGCAGAGGG + Intergenic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
982865250 4:160501968-160501990 CTCTGGCTGCTGTGGGAAGAAGG + Intergenic
983062469 4:163174897-163174919 ATGATTGTGCTATGGGAAGAGGG - Intergenic
983217357 4:165014277-165014299 TTGAGGGTGCTATGGGAAGATGG + Intergenic
983991070 4:174120610-174120632 GTGTGTGTGGTGTAGGGAGAGGG + Intergenic
984034251 4:174646653-174646675 CTATGTGTCCTGTGTGATGAGGG + Intronic
985173600 4:187177573-187177595 CTGTGTGTGGTGGGGGAAGTTGG - Intergenic
985215386 4:187647916-187647938 CTGTGTGTGGTGTGAGATGGTGG - Intergenic
985382313 4:189407426-189407448 ATGTCTGTGCTTTGGGCAGAAGG + Intergenic
985489345 5:170193-170215 CACTGAGTGCTGTGGGCAGATGG + Intronic
985909738 5:2869498-2869520 GGATGTGTGCTGAGGGAAGATGG + Intergenic
985936552 5:3101952-3101974 CTGTGTGTTCTCTGTGAAGATGG - Intergenic
986615701 5:9615159-9615181 CTGTGTGTGTTCTGGGCAAAGGG + Intergenic
986684406 5:10263381-10263403 CTGTATGTGCTGTGAGATGATGG + Intronic
986811507 5:11364717-11364739 CGGTGTGTGCTGGCGGCAGAGGG + Exonic
987226130 5:15843301-15843323 GTGTGTGTGCTGTGGTGAAAGGG - Intronic
987544348 5:19293205-19293227 GTGTGTGTGGTGGGGGGAGATGG + Intergenic
987591411 5:19932555-19932577 GTGTGTGTATTGTGGGGAGAGGG - Intronic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
988415923 5:30947153-30947175 CTGGGTGTGATGTGAGAGGAAGG - Intergenic
988599506 5:32626385-32626407 ATGTCTGTCATGTGGGAAGAAGG - Intergenic
989246654 5:39262938-39262960 GTTTCTGTGCTGTGGGAAGGAGG + Intronic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990698406 5:58448468-58448490 CTATATGTGCTCTGAGAAGAAGG - Intergenic
991388794 5:66120205-66120227 CTGTGTGTTCGATGGGAACATGG + Intergenic
991533156 5:67637571-67637593 CTGGGTGTGCCCTGGGGAGATGG + Intergenic
991959005 5:72022879-72022901 GTGTGTGTGTTGGAGGAAGAGGG - Intergenic
992090164 5:73309979-73310001 CTGTCTGTGCTGCTGGAAAAGGG + Intergenic
992896940 5:81253730-81253752 CTTTGGGAGCTGTGGGAAGTGGG - Intronic
992979191 5:82149814-82149836 CTGTCTGTCCTATGGGAAGGTGG + Intronic
993068131 5:83126642-83126664 CTGGTAGAGCTGTGGGAAGAAGG + Intronic
994548768 5:101205197-101205219 CTATTGGAGCTGTGGGAAGAGGG + Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
994900397 5:105762563-105762585 CTGGGGGAGCTGTGAGAAGAGGG - Intergenic
994957069 5:106545842-106545864 TAGGGTGTGCTGTGGGATGAAGG + Intergenic
995725298 5:115175768-115175790 ATGTATGTGCTGTGGGGAGTAGG - Intronic
995870610 5:116739917-116739939 GTGTGTGTGCCAGGGGAAGAGGG + Intergenic
996537007 5:124587985-124588007 GTGTGCATGCTGGGGGAAGATGG - Intergenic
997500698 5:134371377-134371399 GTGTGAGTGCTGGGGGAGGAGGG - Exonic
997527925 5:134565435-134565457 CTTTTTGTCCTCTGGGAAGAGGG - Intronic
998011991 5:138702854-138702876 CTGTGTGTTCTGAGGGAGTAAGG + Intronic
998495971 5:142589742-142589764 ATGTTTGTGATGTGGGAAGGAGG - Intergenic
998842615 5:146271602-146271624 CTGTTAGTGCTTTGGGACGATGG - Exonic
998874269 5:146583599-146583621 ATCTGTGAGCTGTGTGAAGATGG + Intronic
999716572 5:154365741-154365763 CTGAGTGTGGTGTGGAAGGAAGG - Intronic
999964911 5:156798840-156798862 CTGTGTGTGGCGTGGGGGGATGG + Intergenic
1000872538 5:166594910-166594932 TTGTGTGACCTTTGGGAAGAAGG + Intergenic
1000879685 5:166682898-166682920 CTGTATATGTTGTGGGGAGAGGG + Intergenic
1001917461 5:175573865-175573887 CTGTGGGTGCTGTGGGGGGCAGG - Intergenic
1002096094 5:176831792-176831814 TTGAGTGGGCTTTGGGAAGATGG - Intronic
1002177482 5:177409450-177409472 CGGTGAGTGCTGTGGGAACCAGG - Exonic
1002426912 5:179181978-179182000 GGGTGTGTGCGGTGGGAAGCTGG - Intronic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1002783643 6:385047-385069 CTGTGTGTACTGATGGAAAATGG + Intergenic
1003480000 6:6522158-6522180 GTGTGAGTGCAGTGGGGAGAAGG - Intergenic
1003887662 6:10535758-10535780 CTTTGTGGGCGGTGGGAGGAAGG + Intronic
1003930486 6:10919747-10919769 CTGTGGCTGCTGTGGGGATATGG + Intronic
1004286077 6:14322190-14322212 CTGGGAGTGCTGCTGGAAGATGG - Intergenic
1004672320 6:17809253-17809275 TTGTGTGTGCTGAGGGAGGGTGG + Intronic
1004989440 6:21120321-21120343 CTGAATTTGCTGTGGGATGATGG - Intronic
1006110428 6:31741169-31741191 CTGTGTGTGCTGTGGAATTCAGG + Exonic
1006299258 6:33185157-33185179 CTGTCTGTGCTGGGGGATGGGGG + Intronic
1006471400 6:34231249-34231271 CTGTGTGGGCTGTGGAGATACGG - Intergenic
1007693672 6:43718460-43718482 CTGTGTGTGGTGTAGGGAGATGG + Intergenic
1008517968 6:52335994-52336016 TGGTAGGTGCTGTGGGAAGATGG - Intergenic
1009502076 6:64426361-64426383 CTGTGTCAGTTGTGGGAACATGG + Intronic
1010169133 6:72954291-72954313 GTGTAAGTGCTGTGGGAGGAAGG + Intronic
1011316541 6:86038467-86038489 CTGTGTGTGGAGTGGGGGGATGG - Intergenic
1013820229 6:114145744-114145766 GTGGGGGTGCTGTGGGAAGCAGG + Intronic
1014145008 6:117987503-117987525 CTGGGTGTCCTGGAGGAAGAGGG - Intronic
1014198366 6:118583343-118583365 ATGGTTGTGCTCTGGGAAGAGGG - Intronic
1014564586 6:122932065-122932087 GTGTGTGTGTTGTGGTGAGAGGG + Intergenic
1014883034 6:126746404-126746426 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
1015133628 6:129842229-129842251 ATGTGTGTGTTTTGGGTAGAGGG - Intronic
1016645972 6:146408727-146408749 CCGTGTGAGATGTGTGAAGAAGG + Intronic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017406950 6:154129839-154129861 GTGTGTGTGCTGGGGGGGGAGGG - Intronic
1017590835 6:155976498-155976520 CAGTGTGTATTCTGGGAAGAGGG - Intergenic
1017650529 6:156577400-156577422 CTGTGTGTGATGGGGGGAAAGGG + Intergenic
1018049482 6:159996769-159996791 ATGTGTGTGCTTTGGGTTGAGGG - Intronic
1018980630 6:168599077-168599099 CGGTGTGTGTTGGGGGAAGTGGG - Intronic
1019188281 6:170234065-170234087 CTGTGTGTTCTGTGTGGGGAGGG - Intergenic
1019272753 7:159742-159764 CTGTGTGTGCAGTGGACAGGTGG - Intergenic
1020375674 7:7482919-7482941 GTGTTTGTGTGGTGGGAAGAAGG + Intronic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1021168135 7:17365567-17365589 GTGTGTGTGTTGGGGGCAGAAGG - Intergenic
1021270416 7:18577963-18577985 ATGTGTGTGTTTTGGGGAGAGGG - Intronic
1022030606 7:26488460-26488482 CTGGGTGGGTTGGGGGAAGAAGG + Intergenic
1022229982 7:28405329-28405351 CTCTGAGTGATGTGGGCAGAAGG + Intronic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1023071521 7:36439598-36439620 CTGTGTGTGGGGTGGGATAAAGG + Intronic
1023089825 7:36607506-36607528 ATGAGTGTGCAGTGGGAAAAAGG - Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1026390697 7:69898648-69898670 CTGTGTGTGGTTGGGGATGAGGG - Intronic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027241192 7:76330353-76330375 TTGTGTGGGCTGGGGGAAGGGGG + Intronic
1027259916 7:76457450-76457472 CTGTGTATGTTGTGGGGAGTGGG + Intergenic
1027282556 7:76619440-76619462 CTGTGTATGTTGTGGGGAGTGGG - Intronic
1027311288 7:76955554-76955576 CTGTGTATGTTGTGGGGAGTGGG + Intergenic
1028619062 7:92803679-92803701 ACATGTGTGATGTGGGAAGAAGG + Intronic
1029642691 7:101831112-101831134 GTGTGTCTGCTGTGTGAACAGGG + Intronic
1030014619 7:105206205-105206227 GTGTGTGTGCTGGGGGAGGAGGG + Intronic
1030020076 7:105265092-105265114 GTGTGTGTGTTGTGTGTAGAAGG - Intronic
1030105536 7:105983903-105983925 CTGTTTGAGGTGGGGGAAGAAGG - Intronic
1030333147 7:108294682-108294704 ATTTGTGTGCTGTGAGGAGAGGG + Intronic
1030766626 7:113418625-113418647 CTGTGTTTGATGTGGGGATAGGG + Intergenic
1031533404 7:122904154-122904176 TTGTGTGTGGTGTGAGAGGATGG - Intergenic
1031920652 7:127598333-127598355 ATGAGTGGGATGTGGGAAGAGGG + Intronic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1032098800 7:128955611-128955633 CTGAGTGTGCTGTGGAAACAAGG + Intronic
1032457905 7:132087547-132087569 CTGTGTGTGCTGCTGGAGGTGGG - Intergenic
1032478347 7:132227299-132227321 GTGGGTGTGTTATGGGAAGAGGG - Intronic
1032510864 7:132471351-132471373 TTGTGTGTGTTGTGTGAAGTTGG + Intronic
1033363140 7:140652054-140652076 GTGAGTGTGGGGTGGGAAGAGGG + Intronic
1033367381 7:140681948-140681970 CTCTGTGTGCTGTGAGAAGAAGG + Intronic
1033591453 7:142812224-142812246 CTATGTGTGCCGTGGGGAGGGGG - Intergenic
1033662671 7:143413145-143413167 CCGTGTGGGCTGTGGGAGGGAGG + Intergenic
1034105404 7:148485472-148485494 CTCTGTGTCCTTTAGGAAGAGGG + Intergenic
1034277210 7:149829206-149829228 CTGAGGGGACTGTGGGAAGAGGG - Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035655500 8:1302048-1302070 CTGTGTGTGCTGGGGGAAAAGGG + Intergenic
1035923076 8:3699826-3699848 TGGTGTGTCGTGTGGGAAGAGGG - Intronic
1036019816 8:4831978-4832000 CTATGTGTGCAGTGGGAATTTGG - Intronic
1036076950 8:5512751-5512773 CTGTGTGTGCTGTGGCAATGTGG + Intergenic
1036599244 8:10244344-10244366 GTGTGTGTGCTCTTGGGAGATGG + Intronic
1037810661 8:22084833-22084855 ATGTGTGTGTTGTGGGGAGGAGG - Intergenic
1038276109 8:26122237-26122259 CTGTGTGTGCTGGAGGGACATGG - Intergenic
1039165170 8:34670933-34670955 ATGTGTGTGGTGGGGGAAGCAGG - Intergenic
1039378467 8:37061482-37061504 CAGGATGTGCTGGGGGAAGAGGG + Intergenic
1039442223 8:37603000-37603022 CTGTGGGTGCTGTGGGAGCAAGG - Intergenic
1039647788 8:39306089-39306111 GTGTGTGAGCTGTGGGAGCATGG - Intergenic
1039896766 8:41722237-41722259 CTGTGTGTGCTGTTGCATGAGGG - Intronic
1039970901 8:42320865-42320887 CTGTGTGTGCTGGGCACAGAGGG - Intronic
1040060629 8:43100284-43100306 CAGTGTGTGCTTAGGGAAGTGGG + Intronic
1041113922 8:54515679-54515701 CTGTGTGTGGTGTTGGCAGAGGG + Intergenic
1041127612 8:54660538-54660560 CTGTATGTGCTGGGGGTAGGAGG + Intergenic
1041141181 8:54820845-54820867 CTGAGTGTGTTCTGGGAAGGAGG - Intergenic
1041290154 8:56301046-56301068 CTGTGTGTCCTCTGGAGAGAGGG + Intronic
1041306835 8:56470488-56470510 CTGTGTGTGTGATGGGAATAAGG + Intergenic
1041627873 8:60051814-60051836 CTGTGAGTGGGGTGGGAAGTGGG - Intergenic
1041832040 8:62164967-62164989 CTGTGGCTGCTGTGGGGATAGGG - Intergenic
1042702647 8:71633455-71633477 GTGTGTGTGTTGGGGGGAGATGG + Intergenic
1042914293 8:73859898-73859920 CTGTGTGTGCTTAGGGGAGATGG - Intronic
1043464196 8:80487976-80487998 CTGTATGTGTTGTGGGGGGAAGG + Intronic
1044309034 8:90671335-90671357 GTGTGTGTGTTGGGGGAAAAGGG + Intronic
1046193282 8:110827512-110827534 ATGTGTGTGGTGTGGGAGGAGGG - Intergenic
1046368692 8:113271729-113271751 CTTAGTGAGCTGTGAGAAGAGGG + Intronic
1046728789 8:117703283-117703305 CAGGGTGTGGTGTGGGGAGAGGG - Intergenic
1047157536 8:122337594-122337616 CGGTGGGTGGTGGGGGAAGATGG + Intergenic
1047457361 8:125028245-125028267 CTGTGCTTGCTGTGGGAACCAGG + Intronic
1047782936 8:128124444-128124466 CTGTGTGTGCTGAGTGCACATGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048994220 8:139781728-139781750 CTGTGTGTGCGGTGGGAGGGAGG + Intronic
1049258098 8:141624578-141624600 TGGTGGGTGCTGTGGGCAGACGG + Intergenic
1049791142 8:144473252-144473274 GTGTCGGTGCTGAGGGAAGAAGG - Exonic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1052584959 9:30415011-30415033 CAGGATGTGCTGTGGGAAGGAGG + Intergenic
1053294347 9:36902272-36902294 TTGTCTGTGATTTGGGAAGAAGG - Intronic
1055126008 9:72718878-72718900 CTGTGGCTGCTGTGGGGATAGGG + Intronic
1055545189 9:77363962-77363984 CTATGTGTGGTGGGGTAAGAGGG + Intronic
1056714681 9:89019364-89019386 CTGTGTGGCCTGTGGTCAGAAGG + Intronic
1056779515 9:89538858-89538880 CAGTGTGTGCAGTGGGGTGATGG + Intergenic
1057236688 9:93366838-93366860 CTGTGTGGGCTGGGGCAGGAGGG - Intergenic
1057258084 9:93567131-93567153 TTCTCTGTGCTGTGAGAAGATGG + Intergenic
1057287399 9:93769243-93769265 CTGTGTGTGTTGGGGCAAGCGGG + Intergenic
1057577421 9:96254660-96254682 CTCTGTGGGCTGGGGGAAGCAGG - Intronic
1057797941 9:98171717-98171739 CTGTCTGTGGTGTGCGGAGATGG + Intronic
1060754721 9:126204294-126204316 CTGTGTGTGCTGTGGGGGTAGGG - Intergenic
1061100252 9:128486736-128486758 ATGAGTGTGGTGTGGGAAAAAGG - Intronic
1061371681 9:130201030-130201052 CTTTGTGGGCTGTGGGCTGATGG + Intronic
1061544833 9:131298621-131298643 CTATGTGCACTGCGGGAAGAGGG - Intronic
1061802928 9:133121893-133121915 CTGTGTGTGCAGTGGGGGAAAGG + Intronic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1062572964 9:137194037-137194059 CTGTGTGAGCTGTGCTGAGAGGG - Intronic
1062610747 9:137372356-137372378 CTGGGGGTGCTGTGGGAGGCGGG + Intronic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1186543591 X:10425939-10425961 CTGAGGTTGCTCTGGGAAGAGGG + Intergenic
1187955064 X:24509477-24509499 ATGTGTGTGTTGGGGGAAGAGGG - Intronic
1188314077 X:28652298-28652320 CTGTGTGTGCTATGGGAGTTAGG - Intronic
1189194806 X:39143854-39143876 CTGTGTTTGCAGTGGGAGCATGG + Intergenic
1189241707 X:39529667-39529689 GTGTGTGTGGTGGGGGTAGATGG - Intergenic
1189292454 X:39895837-39895859 CTGTCTGTGCCAGGGGAAGAAGG + Intergenic
1189805609 X:44732694-44732716 CTGAGTGTGCTTTGGGAACTGGG + Intergenic
1189946082 X:46180309-46180331 CTGTGGCTGCTGTGGGAGTAGGG + Intergenic
1190190718 X:48274675-48274697 ATGTGTGGGCTGTGAGCAGATGG + Intronic
1190198099 X:48336819-48336841 ATGTGTGGGCTGTGAGCAGATGG + Intergenic
1192117439 X:68424818-68424840 CTGTGGCTGCTGTGGGAACTAGG - Intronic
1192261455 X:69508147-69508169 CTGGGTCTTTTGTGGGAAGAAGG + Intronic
1193018172 X:76759376-76759398 CGCTGTGGGCTGGGGGAAGAGGG + Intergenic
1194598698 X:95892565-95892587 ATGTGTGTGTTGGGGGAGGAAGG + Intergenic
1195010371 X:100727854-100727876 CAGGGAGTGCTGAGGGAAGAGGG + Intronic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1195964213 X:110415566-110415588 TTCTGGGTGCTGTGGGGAGATGG + Intronic
1196644605 X:118103728-118103750 CTGTGTGTGTTGGGGGAGGCAGG - Intronic
1196732523 X:118955289-118955311 CTTTGTGGGCTGTTGGACGAAGG - Intergenic
1196921234 X:120587208-120587230 CTGTGAGAGCTGTGAGAAGTGGG + Intergenic
1197630081 X:128848346-128848368 GTGTGTGTGTTGGGGGTAGATGG + Intergenic
1197839272 X:130728166-130728188 CTGTGTGTGCTGTGGGAACTGGG - Intronic
1198556905 X:137804530-137804552 CTGTATGTGTTGTGGGATGGTGG + Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1199928458 X:152494251-152494273 CTGTTGGAGCTGTGAGAAGAGGG + Intergenic
1199983447 X:152933827-152933849 CTGGGTGTGCTGAGGGAAGTAGG - Intronic
1200213418 X:154356885-154356907 CTGCGTGGGCTGAGGGAACAAGG - Intronic
1201931515 Y:19354669-19354691 CTGGTGGAGCTGTGGGAAGAGGG - Intergenic