ID: 906322919

View in Genome Browser
Species Human (GRCh38)
Location 1:44827836-44827858
Sequence GTCTTACCTTAGCATGTGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 53}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906322913_906322919 12 Left 906322913 1:44827801-44827823 CCCAGAGATGCTAAGTCTCTGCC 0: 1
1: 0
2: 1
3: 12
4: 178
Right 906322919 1:44827836-44827858 GTCTTACCTTAGCATGTGACTGG 0: 1
1: 0
2: 0
3: 7
4: 53
906322916_906322919 -10 Left 906322916 1:44827823-44827845 CCTGCTCTGCCCAGTCTTACCTT 0: 1
1: 0
2: 2
3: 32
4: 322
Right 906322919 1:44827836-44827858 GTCTTACCTTAGCATGTGACTGG 0: 1
1: 0
2: 0
3: 7
4: 53
906322910_906322919 30 Left 906322910 1:44827783-44827805 CCTCTCTGCCCTTCTGGGCCCAG 0: 1
1: 0
2: 11
3: 62
4: 553
Right 906322919 1:44827836-44827858 GTCTTACCTTAGCATGTGACTGG 0: 1
1: 0
2: 0
3: 7
4: 53
906322912_906322919 21 Left 906322912 1:44827792-44827814 CCTTCTGGGCCCAGAGATGCTAA 0: 1
1: 0
2: 0
3: 17
4: 181
Right 906322919 1:44827836-44827858 GTCTTACCTTAGCATGTGACTGG 0: 1
1: 0
2: 0
3: 7
4: 53
906322914_906322919 11 Left 906322914 1:44827802-44827824 CCAGAGATGCTAAGTCTCTGCCC 0: 1
1: 0
2: 0
3: 9
4: 158
Right 906322919 1:44827836-44827858 GTCTTACCTTAGCATGTGACTGG 0: 1
1: 0
2: 0
3: 7
4: 53
906322911_906322919 22 Left 906322911 1:44827791-44827813 CCCTTCTGGGCCCAGAGATGCTA 0: 1
1: 0
2: 1
3: 25
4: 225
Right 906322919 1:44827836-44827858 GTCTTACCTTAGCATGTGACTGG 0: 1
1: 0
2: 0
3: 7
4: 53
906322915_906322919 -9 Left 906322915 1:44827822-44827844 CCCTGCTCTGCCCAGTCTTACCT 0: 1
1: 0
2: 2
3: 40
4: 436
Right 906322919 1:44827836-44827858 GTCTTACCTTAGCATGTGACTGG 0: 1
1: 0
2: 0
3: 7
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906322919 Original CRISPR GTCTTACCTTAGCATGTGAC TGG Exonic
901339537 1:8483299-8483321 GTTTTCCCTAAGCATGTGAGAGG - Intronic
906322919 1:44827836-44827858 GTCTTACCTTAGCATGTGACTGG + Exonic
906396293 1:45468233-45468255 GTATTACTTTAGCATGTGATAGG - Intronic
907851753 1:58261418-58261440 GTCTTACCTTGGCAGGTATCAGG - Intronic
909672077 1:78200554-78200576 GTCTTTCATTAGCTGGTGACTGG - Intergenic
923970339 1:239195292-239195314 GTCTTGTCTTCTCATGTGACTGG + Intergenic
1064207819 10:13339113-13339135 GTATTACTGTAGCGTGTGACTGG + Intronic
1081445057 11:43123168-43123190 GTTTTACCCTGGCATCTGACTGG - Intergenic
1081811436 11:45916385-45916407 GTCTGAGCAGAGCATGTGACAGG - Intronic
1089562195 11:119349281-119349303 GTCTTACTTTAGCTTGTAAAGGG + Intergenic
1092380941 12:7996577-7996599 TTCTTACCAGAGAATGTGACGGG - Intergenic
1095813513 12:46396947-46396969 GTCCTACCTTACCCTGGGACAGG + Intergenic
1097956678 12:65494055-65494077 CTATTACATTAGCATGTGACAGG - Intergenic
1107718384 13:43222851-43222873 TTCTTACCTGTGCATGTGAGGGG + Intronic
1110268672 13:73568604-73568626 TTATTAACTCAGCATGTGACAGG + Intergenic
1111197325 13:84892300-84892322 GTCTTACCTCTGCGTGTGTCTGG + Intergenic
1118009125 14:61591811-61591833 GTCTCACCTTAGAATCTCACAGG - Intronic
1120627296 14:86844189-86844211 GTCTTGCATCAGAATGTGACTGG - Intergenic
1122580406 14:102768252-102768274 GTCTTTCCTCAGTATGTGAAAGG - Intergenic
1126568323 15:50123991-50124013 TCCTTACCTCAGCAGGTGACAGG + Intronic
1128812414 15:70582223-70582245 TTTTTACCTTACCATGTGCCAGG - Intergenic
1129224476 15:74160144-74160166 ATCTTACTTTAGCATGGGACAGG + Intergenic
1135564138 16:23498953-23498975 TTCTGACTTCAGCATGTGACTGG + Intronic
1147762280 17:42806803-42806825 GTCTTACCCTTGCAGCTGACTGG - Exonic
1158966039 18:62623133-62623155 GTCTTACCCTAGCATTTGGGAGG - Intergenic
1160222688 18:76988870-76988892 GTCTTACCTTTCCCTGCGACGGG + Intronic
1161728131 19:5942402-5942424 GCCTTCCCTCAGCCTGTGACTGG - Intronic
936087224 2:109477491-109477513 GTCTCACCTCAGCATGTGTCTGG - Intronic
939012078 2:136858482-136858504 GTATTACCTAAGCATTTCACAGG - Intronic
943299638 2:186181880-186181902 GTATTACCTCAGCATGTAACGGG + Intergenic
943622602 2:190167143-190167165 GACTTACAGTTGCATGTGACTGG + Intronic
1175607264 20:60321235-60321257 CTCTTGCCTTAGAATATGACTGG + Intergenic
1179958778 21:44756703-44756725 GTCTAGTCTTAGCATGTGATGGG + Intergenic
1184047007 22:41977840-41977862 GTCTTTGCTTAGCATGGGAATGG + Intronic
950494457 3:13325460-13325482 GTCTTAGCCTTGCAGGTGACAGG + Intronic
953829050 3:46279543-46279565 GTTTTCCCTTAGCATGAGAAAGG + Intergenic
955396672 3:58562629-58562651 GGCTGACCTTAGGATGTGAAGGG - Intergenic
960603020 3:119477224-119477246 GTCTTACTTTAAAATGTGAATGG + Intronic
974078494 4:57189669-57189691 CTTTTACCTTGCCATGTGACAGG + Intergenic
974271663 4:59657692-59657714 GGCTTGCCTTTGCAGGTGACTGG - Intergenic
974472828 4:62340253-62340275 CTCTAACCTTGGTATGTGACAGG + Intergenic
974732299 4:65884172-65884194 GTCTTAACTTGGAATGTGATAGG + Intergenic
977153151 4:93539521-93539543 GTTTTCCCTTAGCATGTGTTAGG + Intronic
977611032 4:99031726-99031748 GTCTAAGCTTTGCATGGGACAGG - Intronic
986976106 5:13396121-13396143 ATCTTACCTTATCCTGTGTCTGG + Intergenic
993597089 5:89870745-89870767 GTTTTACATAAGCATGTGAAAGG + Intergenic
999368036 5:151035575-151035597 CTCTTACCTGGGCATTTGACAGG + Exonic
1003379747 6:5613601-5613623 TTCTTACCTTAGCATGTTCCAGG + Intronic
1004453268 6:15767289-15767311 GTCCTTCCTTGGCTTGTGACAGG - Intergenic
1011466539 6:87663379-87663401 ATCTGACTTTAGCATGTGAAGGG - Intronic
1013142134 6:107347734-107347756 GTCTTACTTTAGTATGTTCCTGG - Intronic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1021700802 7:23317781-23317803 GCCTAACATTTGCATGTGACTGG + Intronic
1036075321 8:5492995-5493017 TTCTTACCTTAGAATGTGATTGG + Intergenic
1037508357 8:19555676-19555698 GACTTCACTTAGCATGTTACGGG + Intronic
1055499004 9:76884825-76884847 GTGTTACCTTAGCAAATAACTGG - Intronic
1061007289 9:127935371-127935393 GTCCAACGTCAGCATGTGACAGG + Exonic
1189732531 X:44036462-44036484 CTCTAACCTTAGCCTGAGACTGG + Intergenic
1192604185 X:72497013-72497035 GTCTTTCCTTAGAATATGCCAGG - Intronic
1196483507 X:116178922-116178944 GACTTACAGTTGCATGTGACTGG - Intergenic
1198073380 X:133171268-133171290 CTCGTACCTTAGAATGTGGCTGG - Intergenic