ID: 906323952

View in Genome Browser
Species Human (GRCh38)
Location 1:44832745-44832767
Sequence GCCTCCCTATTGGCCCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906323952_906323956 -9 Left 906323952 1:44832745-44832767 CCAATAGGGGCCAATAGGGAGGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 906323956 1:44832759-44832781 TAGGGAGGCTGCTGCTAGGAGGG 0: 1
1: 0
2: 0
3: 24
4: 243
906323952_906323963 25 Left 906323952 1:44832745-44832767 CCAATAGGGGCCAATAGGGAGGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 906323963 1:44832793-44832815 AACAGGTGTAGGGCTAGGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 236
906323952_906323961 20 Left 906323952 1:44832745-44832767 CCAATAGGGGCCAATAGGGAGGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 906323961 1:44832788-44832810 AAAAGAACAGGTGTAGGGCTAGG 0: 1
1: 0
2: 2
3: 31
4: 400
906323952_906323958 14 Left 906323952 1:44832745-44832767 CCAATAGGGGCCAATAGGGAGGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 906323958 1:44832782-44832804 TTTCCTAAAAGAACAGGTGTAGG 0: 1
1: 0
2: 3
3: 23
4: 251
906323952_906323962 21 Left 906323952 1:44832745-44832767 CCAATAGGGGCCAATAGGGAGGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 906323962 1:44832789-44832811 AAAGAACAGGTGTAGGGCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 184
906323952_906323959 15 Left 906323952 1:44832745-44832767 CCAATAGGGGCCAATAGGGAGGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 906323959 1:44832783-44832805 TTCCTAAAAGAACAGGTGTAGGG 0: 1
1: 1
2: 1
3: 16
4: 201
906323952_906323955 -10 Left 906323952 1:44832745-44832767 CCAATAGGGGCCAATAGGGAGGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 906323955 1:44832758-44832780 ATAGGGAGGCTGCTGCTAGGAGG 0: 1
1: 0
2: 2
3: 15
4: 167
906323952_906323957 8 Left 906323952 1:44832745-44832767 CCAATAGGGGCCAATAGGGAGGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 906323957 1:44832776-44832798 GGAGGGTTTCCTAAAAGAACAGG 0: 1
1: 0
2: 1
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906323952 Original CRISPR GCCTCCCTATTGGCCCCTAT TGG (reversed) Intronic
900424731 1:2571340-2571362 GCCTCTCTATTTACCCCTCTTGG - Intergenic
901325610 1:8363496-8363518 GCCTCCCTTATGGCCCCTTCTGG - Intronic
903070387 1:20724260-20724282 GCCTGCCTGTGGGCCCCTCTTGG - Intronic
903581369 1:24373357-24373379 CCCTCCCCAGTGGCCCCTAATGG + Intronic
904757131 1:32774123-32774145 GCTTCCCCATTGGCCCCTGTGGG + Exonic
906323952 1:44832745-44832767 GCCTCCCTATTGGCCCCTATTGG - Intronic
912436794 1:109667970-109667992 GCCTCCAGATTGGCCCGTTTCGG + Intronic
920261443 1:204690746-204690768 GCCTCCCTTTTTGCCCATACAGG - Intergenic
922729693 1:227943085-227943107 GCCTCCCTCTTGGACCCTGCGGG + Intronic
1063048113 10:2415189-2415211 GACTCCCTAGTAGCCCCCATTGG - Intergenic
1070143842 10:73759644-73759666 GGGTCCCCATTGGCCCCTGTGGG + Exonic
1076781592 10:132727697-132727719 GCCTCCCTGGTGGCCCCTCCAGG + Intronic
1084562280 11:69911695-69911717 GCCTCCCCATTGGCCTCCCTGGG - Intergenic
1085253167 11:75156802-75156824 GCCTCCCTTTTAGACCATATAGG + Intronic
1107567584 13:41621794-41621816 GCCTCCCTCATGGCCATTATAGG - Intronic
1111812294 13:93106093-93106115 GCTTCCCTATTGGCATGTATGGG + Intergenic
1112207257 13:97337073-97337095 GCCTCCCCATAGGCCCTTAGAGG - Intronic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1122847107 14:104506068-104506090 ACCTCCCTCTTGGCCCCTCAGGG - Intronic
1124103115 15:26713594-26713616 CCCACCCTGTTGGCCCCTCTTGG - Intronic
1127331428 15:57943791-57943813 GCCTCTCTGCTGGCCCCTCTGGG - Intergenic
1136011338 16:27365236-27365258 GCCTCCCTTTTAGACCATATAGG + Intergenic
1137716836 16:50603307-50603329 GCCTTCCTCTTGTCCCCTCTCGG - Intronic
1152438314 17:80289283-80289305 GCCTCCACATTGACCCCTACAGG - Intronic
1156733367 18:40223168-40223190 ATCTCCCTCTTGGCCCCTACAGG - Intergenic
1161067961 19:2247816-2247838 GCCTCCCTGCTGGCCCCCCTGGG + Exonic
1164625996 19:29728405-29728427 GCCTGCCTATTGGCTTCTACTGG + Intergenic
1165763056 19:38333784-38333806 TCCTACCTCTTGGCCCCTCTAGG - Intergenic
1168173408 19:54606393-54606415 TCCTCCCTAATGACCCCTAATGG + Intronic
1168464214 19:56589175-56589197 GCCTCCCTCCTTGCCCCTGTGGG - Intergenic
1168465380 19:56597160-56597182 ACCTTCCTATGGGCCCCTAAAGG + Intronic
926863122 2:17329864-17329886 GCCTTCCTATTTGCTCCTACTGG + Intergenic
927000292 2:18787925-18787947 GGCTCCCTGGTGGCCCCTCTGGG + Intergenic
948042772 2:234916860-234916882 GCCTCCCTGTTGTCACCTAGTGG - Intergenic
1172614675 20:36275325-36275347 GCCTCCCTGCTGGCCCCTGGTGG - Intergenic
1177431784 21:20998670-20998692 GCCTCCCTCTTTGCCTCTCTTGG - Intronic
1180222203 21:46366145-46366167 CCCTCCCCATGGGCCCCCATGGG + Intronic
958892299 3:99795270-99795292 GCTTCCCCCTTGGGCCCTATGGG - Exonic
962033502 3:131626275-131626297 GCCTAGCTATTGGCCTCTTTAGG - Intronic
966493359 3:180552754-180552776 GCCTCCCTAATGGGGCCAATGGG + Intergenic
967972087 3:195006434-195006456 GCCTCCCTATCTGGCCATATTGG + Intergenic
969477916 4:7431738-7431760 GCCTCAGAAGTGGCCCCTATTGG - Intronic
973334769 4:48944835-48944857 GCCTCTCTAGTGCCCCCTATTGG + Intergenic
983671792 4:170246446-170246468 GCCTCCCCATAGGCCCATAAAGG + Intergenic
985994514 5:3590439-3590461 GCCTCCCGCTTGGGGCCTATCGG - Intergenic
1002509114 5:179701240-179701262 CCCTCCCAATTGCCCCCTAAAGG - Intronic
1004546347 6:16602211-16602233 GCCTCCCCATTGGGCCCCAGGGG + Intronic
1011726277 6:90213458-90213480 ACCTGCCTCTTGGCCCCTCTGGG + Intronic
1020991689 7:15204946-15204968 GCCTCCCTAGTTGGGCCTATAGG + Intronic
1023942953 7:44781827-44781849 GCCTCGCTCTTGTCCCCCATGGG + Intergenic
1025231148 7:57203992-57204014 GGCTCCCCCTTGGCCACTATGGG - Intergenic
1049835564 8:144733489-144733511 CCCTCCCTCTTGGTCCCTGTGGG + Intronic
1058204959 9:102092525-102092547 GCCTTCCTCTTTGGCCCTATAGG + Intergenic
1061359422 9:130131665-130131687 CCCTCCCCATTGTTCCCTATAGG + Intronic
1062153553 9:135033738-135033760 GCCTCACTCTCGGCCACTATGGG - Intergenic
1186553108 X:10527786-10527808 GCCTCCCAATTGCGCCCTGTGGG - Intronic
1190136657 X:47804862-47804884 TCCTCCCTTTTCTCCCCTATGGG - Intergenic
1198485281 X:137081002-137081024 GCCTCCCTATTAGCTACCATAGG + Intergenic