ID: 906326167

View in Genome Browser
Species Human (GRCh38)
Location 1:44847448-44847470
Sequence TGGCCCCTAAATATAACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906326167_906326173 7 Left 906326167 1:44847448-44847470 CCACCTGTTATATTTAGGGGCCA No data
Right 906326173 1:44847478-44847500 GTATGTATGCTCCTTCCCTGTGG No data
906326167_906326177 18 Left 906326167 1:44847448-44847470 CCACCTGTTATATTTAGGGGCCA No data
Right 906326177 1:44847489-44847511 CCTTCCCTGTGGGCAGGTTGAGG No data
906326167_906326174 8 Left 906326167 1:44847448-44847470 CCACCTGTTATATTTAGGGGCCA No data
Right 906326174 1:44847479-44847501 TATGTATGCTCCTTCCCTGTGGG No data
906326167_906326175 12 Left 906326167 1:44847448-44847470 CCACCTGTTATATTTAGGGGCCA No data
Right 906326175 1:44847483-44847505 TATGCTCCTTCCCTGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906326167 Original CRISPR TGGCCCCTAAATATAACAGG TGG (reversed) Intergenic
No off target data available for this crispr