ID: 906326173

View in Genome Browser
Species Human (GRCh38)
Location 1:44847478-44847500
Sequence GTATGTATGCTCCTTCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906326161_906326173 15 Left 906326161 1:44847440-44847462 CCCCATCACCACCTGTTATATTT No data
Right 906326173 1:44847478-44847500 GTATGTATGCTCCTTCCCTGTGG No data
906326162_906326173 14 Left 906326162 1:44847441-44847463 CCCATCACCACCTGTTATATTTA No data
Right 906326173 1:44847478-44847500 GTATGTATGCTCCTTCCCTGTGG No data
906326167_906326173 7 Left 906326167 1:44847448-44847470 CCACCTGTTATATTTAGGGGCCA No data
Right 906326173 1:44847478-44847500 GTATGTATGCTCCTTCCCTGTGG No data
906326160_906326173 24 Left 906326160 1:44847431-44847453 CCTGGGCAGCCCCATCACCACCT No data
Right 906326173 1:44847478-44847500 GTATGTATGCTCCTTCCCTGTGG No data
906326163_906326173 13 Left 906326163 1:44847442-44847464 CCATCACCACCTGTTATATTTAG No data
Right 906326173 1:44847478-44847500 GTATGTATGCTCCTTCCCTGTGG No data
906326168_906326173 4 Left 906326168 1:44847451-44847473 CCTGTTATATTTAGGGGCCAAGC No data
Right 906326173 1:44847478-44847500 GTATGTATGCTCCTTCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906326173 Original CRISPR GTATGTATGCTCCTTCCCTG TGG Intergenic
No off target data available for this crispr