ID: 906326174

View in Genome Browser
Species Human (GRCh38)
Location 1:44847479-44847501
Sequence TATGTATGCTCCTTCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906326160_906326174 25 Left 906326160 1:44847431-44847453 CCTGGGCAGCCCCATCACCACCT No data
Right 906326174 1:44847479-44847501 TATGTATGCTCCTTCCCTGTGGG No data
906326161_906326174 16 Left 906326161 1:44847440-44847462 CCCCATCACCACCTGTTATATTT No data
Right 906326174 1:44847479-44847501 TATGTATGCTCCTTCCCTGTGGG No data
906326162_906326174 15 Left 906326162 1:44847441-44847463 CCCATCACCACCTGTTATATTTA No data
Right 906326174 1:44847479-44847501 TATGTATGCTCCTTCCCTGTGGG No data
906326168_906326174 5 Left 906326168 1:44847451-44847473 CCTGTTATATTTAGGGGCCAAGC No data
Right 906326174 1:44847479-44847501 TATGTATGCTCCTTCCCTGTGGG No data
906326167_906326174 8 Left 906326167 1:44847448-44847470 CCACCTGTTATATTTAGGGGCCA No data
Right 906326174 1:44847479-44847501 TATGTATGCTCCTTCCCTGTGGG No data
906326163_906326174 14 Left 906326163 1:44847442-44847464 CCATCACCACCTGTTATATTTAG No data
Right 906326174 1:44847479-44847501 TATGTATGCTCCTTCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906326174 Original CRISPR TATGTATGCTCCTTCCCTGT GGG Intergenic
No off target data available for this crispr