ID: 906326175

View in Genome Browser
Species Human (GRCh38)
Location 1:44847483-44847505
Sequence TATGCTCCTTCCCTGTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906326163_906326175 18 Left 906326163 1:44847442-44847464 CCATCACCACCTGTTATATTTAG No data
Right 906326175 1:44847483-44847505 TATGCTCCTTCCCTGTGGGCAGG No data
906326161_906326175 20 Left 906326161 1:44847440-44847462 CCCCATCACCACCTGTTATATTT No data
Right 906326175 1:44847483-44847505 TATGCTCCTTCCCTGTGGGCAGG No data
906326168_906326175 9 Left 906326168 1:44847451-44847473 CCTGTTATATTTAGGGGCCAAGC No data
Right 906326175 1:44847483-44847505 TATGCTCCTTCCCTGTGGGCAGG No data
906326160_906326175 29 Left 906326160 1:44847431-44847453 CCTGGGCAGCCCCATCACCACCT No data
Right 906326175 1:44847483-44847505 TATGCTCCTTCCCTGTGGGCAGG No data
906326167_906326175 12 Left 906326167 1:44847448-44847470 CCACCTGTTATATTTAGGGGCCA No data
Right 906326175 1:44847483-44847505 TATGCTCCTTCCCTGTGGGCAGG No data
906326162_906326175 19 Left 906326162 1:44847441-44847463 CCCATCACCACCTGTTATATTTA No data
Right 906326175 1:44847483-44847505 TATGCTCCTTCCCTGTGGGCAGG No data
906326171_906326175 -8 Left 906326171 1:44847468-44847490 CCAAGCCTGGGTATGTATGCTCC No data
Right 906326175 1:44847483-44847505 TATGCTCCTTCCCTGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906326175 Original CRISPR TATGCTCCTTCCCTGTGGGC AGG Intergenic
No off target data available for this crispr