ID: 906326177

View in Genome Browser
Species Human (GRCh38)
Location 1:44847489-44847511
Sequence CCTTCCCTGTGGGCAGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906326168_906326177 15 Left 906326168 1:44847451-44847473 CCTGTTATATTTAGGGGCCAAGC No data
Right 906326177 1:44847489-44847511 CCTTCCCTGTGGGCAGGTTGAGG No data
906326172_906326177 -7 Left 906326172 1:44847473-44847495 CCTGGGTATGTATGCTCCTTCCC No data
Right 906326177 1:44847489-44847511 CCTTCCCTGTGGGCAGGTTGAGG No data
906326163_906326177 24 Left 906326163 1:44847442-44847464 CCATCACCACCTGTTATATTTAG No data
Right 906326177 1:44847489-44847511 CCTTCCCTGTGGGCAGGTTGAGG No data
906326171_906326177 -2 Left 906326171 1:44847468-44847490 CCAAGCCTGGGTATGTATGCTCC No data
Right 906326177 1:44847489-44847511 CCTTCCCTGTGGGCAGGTTGAGG No data
906326162_906326177 25 Left 906326162 1:44847441-44847463 CCCATCACCACCTGTTATATTTA No data
Right 906326177 1:44847489-44847511 CCTTCCCTGTGGGCAGGTTGAGG No data
906326167_906326177 18 Left 906326167 1:44847448-44847470 CCACCTGTTATATTTAGGGGCCA No data
Right 906326177 1:44847489-44847511 CCTTCCCTGTGGGCAGGTTGAGG No data
906326161_906326177 26 Left 906326161 1:44847440-44847462 CCCCATCACCACCTGTTATATTT No data
Right 906326177 1:44847489-44847511 CCTTCCCTGTGGGCAGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906326177 Original CRISPR CCTTCCCTGTGGGCAGGTTG AGG Intergenic
No off target data available for this crispr