ID: 906326460

View in Genome Browser
Species Human (GRCh38)
Location 1:44849186-44849208
Sequence CAGGGGTTCTAAGGGCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906326457_906326460 -8 Left 906326457 1:44849171-44849193 CCTCTGTCTCACTGTCAGGGGTT 0: 1
1: 0
2: 8
3: 19
4: 176
Right 906326460 1:44849186-44849208 CAGGGGTTCTAAGGGCTCCATGG 0: 1
1: 0
2: 1
3: 9
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906326460 Original CRISPR CAGGGGTTCTAAGGGCTCCA TGG Intergenic
900282021 1:1876092-1876114 CAGTGCTTCTGAAGGCTCCAAGG - Intronic
900467464 1:2832834-2832856 CAGGAGTTCTAAGGAGTGCAAGG + Intergenic
900829758 1:4957609-4957631 CACAGCTTCTCAGGGCTCCATGG + Intergenic
903683229 1:25111664-25111686 CAGGAGTTCAAAGGGAGCCAGGG + Intergenic
904089527 1:27935043-27935065 CAGGTGTTCCAAGTCCTCCAAGG - Exonic
904343156 1:29851124-29851146 CAGTGGTTCTAAGGGTCCCAAGG + Intergenic
905435746 1:37954061-37954083 CAAAGGTTCAAAGGGCTCAAAGG + Intergenic
906326460 1:44849186-44849208 CAGGGGTTCTAAGGGCTCCATGG + Intergenic
908477975 1:64507540-64507562 CATGGGCTCTAAAGCCTCCAGGG + Intronic
911219604 1:95233598-95233620 CAGGGTTGCTAACAGCTCCACGG + Intronic
915734978 1:158078791-158078813 CAGGGCTTCCAAGAGCTGCAGGG - Intronic
918133167 1:181646614-181646636 CAGGGTTCCCCAGGGCTCCATGG - Intronic
918330646 1:183457459-183457481 CAGGGGGTCTCAGGTCTACATGG - Intergenic
919856958 1:201712609-201712631 CTGGGGTTCAGAGGGCTCAATGG + Intronic
922571645 1:226637994-226638016 CATGGGTTTATAGGGCTCCATGG - Intronic
1063636694 10:7788690-7788712 CAGGGTTTCAAAGGGCGTCAAGG - Intronic
1067108902 10:43384744-43384766 CATGGGTGGAAAGGGCTCCAGGG - Intergenic
1068884948 10:62088501-62088523 CAGGGTTTCTATGGACTCCAGGG - Intronic
1073301558 10:102474032-102474054 CAAGGGCTCTTAAGGCTCCAGGG + Intronic
1076732169 10:132444394-132444416 CTGGGGTCCTGAGGTCTCCAAGG + Intronic
1076840513 10:133043063-133043085 CAGGGGTTCGAGGAGCTGCAGGG - Intergenic
1077026334 11:441656-441678 CCGGGATTCTGAGGGCACCAGGG - Intronic
1078043377 11:7890263-7890285 CTGGGGTTCCACGGGCTGCAGGG + Intergenic
1078225232 11:9385252-9385274 CAGGGTTTGGAAGGGCTCCTGGG + Intronic
1083366382 11:62143890-62143912 CAGGGGCTCTAAGCCCTCCCTGG - Intronic
1083608113 11:63991166-63991188 CAGGGGATCCAAGAGCTTCAGGG - Intronic
1086605702 11:88693651-88693673 CTGGGGTTCTAAGGCTTACATGG - Intronic
1087971867 11:104494226-104494248 CTGGGGTTCCAAGGCTTCCATGG - Intergenic
1090583758 11:128187875-128187897 CAGATGTTCCAAAGGCTCCATGG - Intergenic
1090894059 11:130953615-130953637 CATGGGCTCCATGGGCTCCATGG + Intergenic
1091363184 11:134994442-134994464 CAGGGCTCCTAAGGGGTACAGGG + Intergenic
1095683009 12:45000561-45000583 CAGGGCTTCCAAGGTCACCATGG + Intergenic
1097078304 12:56411006-56411028 CAGGGTTCCCAATGGCTCCATGG + Intergenic
1100935736 12:99663106-99663128 CCGGGGATCTAAGGGCTTAATGG + Intronic
1101993842 12:109510467-109510489 CAGGGGTGAGGAGGGCTCCATGG + Intronic
1116232003 14:42229393-42229415 CTGGGGTGCTCAGGGATCCAAGG + Intergenic
1119262228 14:73244680-73244702 CAGGGGCTCCACTGGCTCCAGGG - Exonic
1122142650 14:99672131-99672153 CCAGGATTCTAAGAGCTCCAGGG - Intronic
1122307898 14:100777083-100777105 CAGTTTTCCTAAGGGCTCCACGG + Intergenic
1122540124 14:102493427-102493449 CAGGGGATGCAGGGGCTCCAGGG - Intronic
1123989519 15:25673098-25673120 CAGGGGCTCTGAGGGCTGCAGGG + Intergenic
1126819691 15:52490108-52490130 CAGAGGTTCTAATTTCTCCAGGG - Intronic
1128073431 15:64811363-64811385 CAGAGGTTCTAAGAGCTTCTGGG + Intergenic
1128218360 15:65949966-65949988 CAGGGTTGCGAAGGGCTCCTGGG - Intronic
1128847868 15:70917388-70917410 CAGGGCTTTTATGGGCTTCAGGG - Intronic
1129429868 15:75491921-75491943 CAGGGTCTCAAAGGTCTCCAGGG + Intronic
1130764106 15:86852627-86852649 GAGGGGTTCTAAATGCCCCAGGG + Intronic
1130833612 15:87628302-87628324 CAGGGTTTCTACTGGCTCCTTGG - Intergenic
1130873863 15:87995166-87995188 CAGGTGCTCTCTGGGCTCCATGG - Intronic
1132402884 15:101524359-101524381 CAGGGCTTCAGAGGCCTCCACGG - Intronic
1132605704 16:792895-792917 CAGGGGTTACCAGGGTTCCATGG - Intronic
1132753421 16:1469994-1470016 CAGGGGACCTGACGGCTCCAGGG - Intronic
1133052180 16:3123622-3123644 CACGGGTTCCAAGGGCCCCGTGG + Intergenic
1133117687 16:3587519-3587541 CGGGGGCTCAAAGGGCTCCATGG - Intronic
1135342972 16:21664389-21664411 CAGCGGCTTTAAGGGCTCCTGGG + Intergenic
1135581762 16:23633602-23633624 CAGTGTCTCTAAGGCCTCCAAGG - Intronic
1136455902 16:30379397-30379419 CAGGGGTCCTAAGGCCAGCAGGG - Intronic
1137444455 16:48523290-48523312 CAGGATCCCTAAGGGCTCCAGGG + Intergenic
1139146174 16:64327979-64328001 CACAGGTAATAAGGGCTCCAAGG - Intergenic
1139223177 16:65205786-65205808 GTGGTCTTCTAAGGGCTCCAGGG + Intergenic
1140548604 16:75837814-75837836 CAGAGGTTCAGAGGGCTCAAGGG - Intergenic
1141489312 16:84361229-84361251 CAGCGGTTGTCAGGGGTCCAGGG + Intergenic
1141806568 16:86345708-86345730 CAGAGGGTCTGAGGGCTCCGAGG - Intergenic
1145761121 17:27425923-27425945 CAGAGGTACTCAGGGCCCCATGG - Intergenic
1146161169 17:30560081-30560103 CAGAGGTGCTCAGGGCCCCATGG - Intronic
1146891629 17:36510147-36510169 CAGGCCTTGTAAGGGCTTCAGGG - Intronic
1147571884 17:41576507-41576529 CCGGGGTGCCATGGGCTCCATGG - Intergenic
1151441216 17:74130442-74130464 GAGGGGTGCTGAGTGCTCCAGGG + Intergenic
1152569652 17:81116111-81116133 CAGGGGTACCCAAGGCTCCATGG - Intronic
1152623679 17:81378902-81378924 CAGGGAGTCTCAGGGCTCCCAGG + Intergenic
1153005117 18:491151-491173 CAGGGGTCCTGATGGCCCCAGGG - Intronic
1154008964 18:10559531-10559553 CAGGGGTGCAAGGGGCTCCCAGG - Intergenic
1155065578 18:22266265-22266287 CTTGGGTCCTAAGGTCTCCAGGG - Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1158773681 18:60552612-60552634 CAGGGCTCCCAATGGCTCCATGG - Intergenic
1160396986 18:78579954-78579976 CAGGGGTCCCCAGGACTCCAAGG + Intergenic
1160665242 19:325083-325105 CAGGGCCTGCAAGGGCTCCAGGG + Intronic
1161581239 19:5082210-5082232 CAGCGGCTCCAGGGGCTCCAGGG - Intronic
1165423320 19:35732827-35732849 CAGGGGTCCTTGGGGCTGCAGGG + Exonic
1165437192 19:35802457-35802479 GAGGAGGTCTGAGGGCTCCAGGG - Intronic
1165686372 19:37824461-37824483 CAGGGCTTCTGTGGCCTCCATGG + Intergenic
1166295070 19:41884885-41884907 CAGTGGGTCTAAAGGATCCAGGG - Intronic
1167013018 19:46821524-46821546 CAGGGCTTCCACCGGCTCCATGG - Intergenic
1167234920 19:48308639-48308661 CAGGGCTCCTACCGGCTCCATGG - Intronic
931424980 2:62162540-62162562 CAGGGTTTCTGTGGCCTCCAAGG + Intergenic
935927248 2:108082925-108082947 TAGGGGTTCTAAGTTCTTCATGG + Intergenic
937986351 2:127639886-127639908 CAGGGGGTCTAGGGGATCCAGGG - Intronic
941173153 2:162164140-162164162 CAGTGTTTCTAAGGGATCTATGG + Intergenic
947307943 2:228767822-228767844 CAGTTGTTTTAAGGGCACCATGG + Intergenic
948040907 2:234900776-234900798 CTGGGGTTCTGAGGGCTTCTGGG + Intergenic
948646537 2:239408567-239408589 CAGGGTTTGTAATGGCACCAGGG + Intergenic
948947834 2:241230115-241230137 CAGGGCGCCTCAGGGCTCCAAGG + Intronic
1169917067 20:10694121-10694143 CAGGTAGTCTAAGGGCTCAATGG - Intergenic
1170984975 20:21249367-21249389 CAGAGATTCTGAGGGCTCAAAGG - Intergenic
1171058935 20:21937123-21937145 AAGTGGTTCCAAGGGCTCCTGGG + Intergenic
1172183435 20:33017147-33017169 GGAGGGTTCTAGGGGCTCCAGGG - Intronic
1174429356 20:50456538-50456560 CATGGTTTCTCAGGGCTCCTGGG + Intergenic
1174578914 20:51557058-51557080 CTTGGTTTTTAAGGGCTCCATGG - Intronic
1175232275 20:57481460-57481482 CAGGGGTCCCAAGGGATCCTTGG - Intergenic
1176020157 20:62958653-62958675 CAGAGGTTCTAGGGGAGCCATGG - Intronic
1176959239 21:15140674-15140696 CAGGGGTTCTAAGGCTGCCGTGG - Intergenic
1177823301 21:26055521-26055543 CAGGGTTTCTGAGGGCTCTCAGG + Intronic
1178665200 21:34540580-34540602 GAAGGGTTTTAAGGGTTCCAGGG - Intronic
1179438779 21:41379323-41379345 CGCGGGTTCTCAGGGCTTCACGG + Intronic
1179971991 21:44841158-44841180 CAGGGCTTCTGAGAGCTGCATGG + Intergenic
1180158875 21:45990263-45990285 CAGGGGACCCAAGGGCTACAAGG + Exonic
1182417140 22:30228849-30228871 CAGGGGTGCTGGTGGCTCCATGG - Intergenic
1182550809 22:31099960-31099982 CAGGGGTTCTCAGGGCAACTGGG - Intronic
1183668734 22:39259700-39259722 CAGGGATGCTAAGGACGCCAAGG - Intergenic
1183733565 22:39631295-39631317 CAGGTGTCCTGAGGACTCCAGGG + Intronic
1184795214 22:46728235-46728257 CGGGGTGTCCAAGGGCTCCAGGG + Intronic
950805850 3:15602509-15602531 CAGAGGGTCTAATGACTCCAAGG - Intronic
951956558 3:28261794-28261816 CATGGGTTCTGAGGGGCCCATGG - Intronic
952809157 3:37385983-37386005 CTGGGATTCTGAGGGCTTCAGGG - Intergenic
953024784 3:39138500-39138522 GAGGGGTTCTCAGGTCACCAGGG + Intronic
953535435 3:43773667-43773689 CCTGGGTTCTCAGGGATCCAGGG - Intergenic
956074237 3:65488054-65488076 CAGTGGTTCTAAGGGAAACAGGG + Intronic
959832645 3:110882498-110882520 GAGAGGTTGTAAGGTCTCCAAGG - Intergenic
960048324 3:113218175-113218197 CGGGGGCTCCAAGGCCTCCACGG - Intronic
961523060 3:127479122-127479144 CAGGGGTTCTGAGGGGTCAGCGG - Intergenic
961523372 3:127481214-127481236 AAGGGGCTCCATGGGCTCCAGGG - Intergenic
963080022 3:141382806-141382828 CAGAGGTAGTCAGGGCTCCAAGG + Intronic
966330599 3:178808068-178808090 CAAGGATTTTAAGGGCTCAATGG - Intronic
967868610 3:194211150-194211172 CATGGCTTCTAAGGGCCCTAGGG + Intergenic
968337449 3:197925481-197925503 GATGGGAACTAAGGGCTCCAGGG + Intronic
969617576 4:8262567-8262589 CAGGGGTGCTGGGGGCTGCATGG - Intergenic
971389784 4:26175275-26175297 CTGAGGTTCTGAGGGCTCCTGGG + Intronic
972543429 4:40057930-40057952 CAGTGGTTGTAATGTCTCCATGG + Intronic
981817004 4:148842415-148842437 CAGTGGTTCTAAAAGGTCCATGG + Intergenic
985339448 4:188933839-188933861 CAGGGGTTCTGAGGCTTGCATGG - Intergenic
985729706 5:1540326-1540348 CTGTGGTTCCATGGGCTCCAGGG + Intergenic
998072454 5:139208739-139208761 CAGAGTGGCTAAGGGCTCCAAGG - Intronic
1002854463 6:1024716-1024738 CAGGGGTTCTTAGAGCTTGAAGG + Intergenic
1008534802 6:52499672-52499694 CAGGGGTTCTTAGGGTCCCAGGG + Exonic
1009243352 6:61204866-61204888 CAGGGTTTCTGTGGGCTTCAGGG + Intergenic
1010835214 6:80578662-80578684 AACAGGTTCAAAGGGCTCCAGGG + Intergenic
1013296957 6:108766322-108766344 CAGGGGTTTTAAGGCCTGTAAGG + Intergenic
1014683079 6:124457821-124457843 CAGAGGTACTAAGAACTCCAAGG - Intronic
1016164483 6:140923315-140923337 CAGAGTTTCTAAGTGCTCAAGGG + Intergenic
1017514710 6:155145720-155145742 CAGGGCTTCTGAGGGCACCCAGG - Intronic
1022357820 7:29632365-29632387 CAGGGTTTTTAAGAGCTCCCCGG - Intergenic
1023788974 7:43737190-43737212 CAGGGGTCCCACTGGCTCCATGG - Intergenic
1025245320 7:57312653-57312675 CAGGGTTTCTCAGGGCTCCTGGG - Intergenic
1026329438 7:69338962-69338984 CTGGTCTTCTGAGGGCTCCAGGG + Intergenic
1031080432 7:117252180-117252202 GAGGGGACCCAAGGGCTCCATGG + Intergenic
1033535762 7:142310333-142310355 CACAGGTTCTCAGGGCTCCTTGG + Intergenic
1034030226 7:147754002-147754024 CAGTGGTACTTAGGGCTGCAGGG - Intronic
1034844413 7:154431149-154431171 CAGCTGTTCTCAGGGCACCACGG - Intronic
1036061832 8:5331427-5331449 CTGTGGTTCTTTGGGCTCCATGG + Intergenic
1036706247 8:11049203-11049225 CTGGGGTTCTAATGGCTGCAAGG + Intronic
1038884804 8:31651532-31651554 CAGCAGTTCTAATGGCTGCAGGG + Intronic
1043364203 8:79513021-79513043 CAGGGGTTCTACGGCATCCAGGG - Intergenic
1045476877 8:102560771-102560793 CAGGGGTTGCAGGGGCTGCAGGG - Exonic
1046724462 8:117659274-117659296 CAGGGATTATAAAAGCTCCAAGG - Intergenic
1047509656 8:125506418-125506440 CAGGAGAGCTGAGGGCTCCATGG - Intergenic
1048011255 8:130458052-130458074 TAGAGGCTCTAAGGGATCCATGG - Intergenic
1053650604 9:40164899-40164921 CAGGGTCTCTGAAGGCTCCAGGG + Intergenic
1054533979 9:66211303-66211325 CAGGGTCTCTGAAGGCTCCAGGG - Intergenic
1056402699 9:86243418-86243440 CAGGGGTTTTAGGTGCTCTATGG - Intronic
1059299227 9:113298960-113298982 CTGGGCTTCTGTGGGCTCCAGGG + Exonic
1059436895 9:114282498-114282520 CAGGGGGTCCAGGGTCTCCAGGG - Exonic
1203787859 EBV:137617-137639 CAGGTGGTCTTAGGGCGCCAGGG + Intergenic
1186443044 X:9602451-9602473 AAGGGCTTCTAAGGGATACAAGG - Intronic
1190110032 X:47583414-47583436 CAGGGGCTCAAAGGGGGCCATGG - Exonic
1190116044 X:47626907-47626929 CAGGGGCTCACAGGGCCCCAAGG + Exonic
1194403615 X:93467818-93467840 CAGGGGTTCTCAGGGATCCAAGG - Intergenic
1195287633 X:103401000-103401022 CAGGGGTCCTGAAGGCACCAAGG - Intergenic
1197563118 X:128048167-128048189 CTGGGGTTTTCAGGGATCCAAGG + Intergenic
1197850753 X:130857459-130857481 CAAGGGTTCTAAGGGCTGTGAGG + Intronic
1198603260 X:138308287-138308309 CAGGGCTTCTGAAGGCTTCATGG - Intergenic
1200133023 X:153861888-153861910 CAGGGCTGCTAAGGGGTCCTGGG + Exonic
1200756319 Y:6993346-6993368 AAGGGCTTCTAAGGGATGCAAGG - Intronic