ID: 906326742

View in Genome Browser
Species Human (GRCh38)
Location 1:44850905-44850927
Sequence CTGTGGCTTTGGAGGCCAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906326732_906326742 29 Left 906326732 1:44850853-44850875 CCTTCTTTATTGGGAAATAAATA 0: 1
1: 1
2: 2
3: 44
4: 536
Right 906326742 1:44850905-44850927 CTGTGGCTTTGGAGGCCAAAAGG 0: 1
1: 0
2: 1
3: 18
4: 287
906326731_906326742 30 Left 906326731 1:44850852-44850874 CCCTTCTTTATTGGGAAATAAAT 0: 1
1: 1
2: 2
3: 50
4: 430
Right 906326742 1:44850905-44850927 CTGTGGCTTTGGAGGCCAAAAGG 0: 1
1: 0
2: 1
3: 18
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906326742 Original CRISPR CTGTGGCTTTGGAGGCCAAA AGG Exonic
900897627 1:5494795-5494817 CTCTGGGTTGGGAGGCCACACGG - Intergenic
901012595 1:6210004-6210026 CTGAGGCCATGGAGGCCAAGGGG - Intronic
901014189 1:6218406-6218428 ATGTGGCTTCTGAGGCCAACAGG + Intronic
901794185 1:11671101-11671123 CTGCGGCTGTGGACACCAAAGGG - Intronic
902136348 1:14309483-14309505 CAGGGGCCTTGGAGGCCACAGGG + Intergenic
902802526 1:18839288-18839310 CTTTGTCTTTGGAGACCAATAGG + Intergenic
903995139 1:27300815-27300837 ATGTGGCTTTGAAGGCCAGCCGG + Intronic
906096147 1:43225343-43225365 TTTTGGCTTTGGAGGCCATGTGG + Intronic
906326742 1:44850905-44850927 CTGTGGCTTTGGAGGCCAAAAGG + Exonic
906676356 1:47696507-47696529 CTTTGGCTTGGCAGGCCATAAGG + Intergenic
907466867 1:54643889-54643911 CTGAAACTATGGAGGCCAAAAGG - Intronic
907713520 1:56906556-56906578 CTTCAGCTTTGGAGTCCAAAAGG - Intronic
907971126 1:59382748-59382770 CTCTGGATTTGCAGGCCAATGGG - Intronic
908466465 1:64401314-64401336 CTGTGGCATTGGGTGCCCAAAGG - Intergenic
908904491 1:68992548-68992570 CTGTGGCTTTGGGTTACAAAAGG - Intergenic
908942753 1:69455244-69455266 CTGAGGTCTTGGAGGCCCAACGG + Intergenic
909984111 1:82139546-82139568 GAGTGGCTTTTGAGGCCATACGG + Intergenic
910873588 1:91856748-91856770 CTGTCTCTTCTGAGGCCAAAGGG + Intronic
912883656 1:113445708-113445730 CAGAAACTTTGGAGGCCAAAAGG + Intronic
914281190 1:146174718-146174740 CTGTGGATTGGGGGGCCAAGAGG - Intronic
915218677 1:154356733-154356755 CTGGGGGCTGGGAGGCCAAAGGG - Intergenic
915237948 1:154499559-154499581 CTGTGGCTTTAGAGCATAAAGGG + Intronic
915374797 1:155384377-155384399 CTGAATCTATGGAGGCCAAATGG - Intronic
915444194 1:155965573-155965595 GTGTGGCAGTGGAGGCCAAGGGG - Intronic
915543142 1:156581553-156581575 GTGGGGCCTTGGAGGCCAGAAGG - Exonic
919516990 1:198538018-198538040 CTGTGGCTTCTGAGGCAAAGAGG + Intronic
920192643 1:204203286-204203308 ATGTGGCTTTTGAGGACAAGAGG - Intronic
920266508 1:204727739-204727761 TTGAGGCTTTGCAGGCCATAAGG + Intergenic
921678235 1:218001395-218001417 CTGTGGCTGTAAAGACCAAAAGG + Intergenic
924062199 1:240186658-240186680 CTGTGGCTTTGGCGGCCCTATGG + Intronic
1063987483 10:11520817-11520839 CTTTGGCTTTGTAGGTCATACGG - Intronic
1065511176 10:26479970-26479992 CTGGGCCTTTGGATGCCACAGGG - Intronic
1065593293 10:27287490-27287512 CTGTGGATTTGGTGACCCAATGG + Intergenic
1065657082 10:27962797-27962819 CTGTGGATTTGGTGACCCAATGG - Intronic
1065864405 10:29901289-29901311 CTATCTCTTTGGTGGCCAAAAGG + Intergenic
1066380058 10:34893529-34893551 TTGTGTCTGTGGAGTCCAAAAGG - Intergenic
1067002998 10:42635273-42635295 TTGGGGCTTTGCAGGCCAAAAGG + Intronic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1067698422 10:48551907-48551929 GTGTGGCTTTGGAAGCCAGATGG + Intronic
1069079844 10:64077050-64077072 TTTTGGCTTTGCAAGCCAAATGG + Intergenic
1069642990 10:69968313-69968335 CTGGAGCTTTGGAGGCCATATGG - Intergenic
1070313221 10:75288614-75288636 CTGGGGCTCTGCAGGCCAAGTGG - Intergenic
1070811656 10:79301128-79301150 CAGTGGCTTTGAAGGCCCAACGG - Intronic
1073231435 10:101974440-101974462 CTGTGGCTTTTGAGACCTGATGG - Intronic
1074762296 10:116676138-116676160 CTCTGACTTTTGAGGCCAAACGG + Intronic
1075026255 10:118985723-118985745 CTGAAACTTTGGAGGCCAGAAGG + Intergenic
1075206600 10:120454657-120454679 AAGTGGTTTTGGAGGGCAAAAGG - Intergenic
1077579027 11:3405048-3405070 ATGTGGCTCTGGAGGCCACTTGG + Intergenic
1078584441 11:12569881-12569903 TTTTGGCTTTGCAGGCCATATGG - Intergenic
1080330265 11:31129441-31129463 TTTTGGCTTTGTAGGCCATAAGG + Intronic
1080447296 11:32349285-32349307 CTATAGGTTTGGAGGCCAATTGG - Intergenic
1082003012 11:47404101-47404123 CAGTTGGTTTGGAGGCCATAGGG - Intergenic
1083535706 11:63464896-63464918 CTGTGGCTTTGCAGGGGATAAGG - Intronic
1086369798 11:86145023-86145045 CTTTGGCTTTGGACACCAAGAGG - Intergenic
1088728484 11:112659915-112659937 GTGTGGCTCTGTAGACCAAAGGG - Intergenic
1089634675 11:119804559-119804581 CTGTGTCTTTGCAGGCCATTAGG - Intergenic
1091523452 12:1271982-1272004 CTGTGGCTTTCCAGTTCAAAAGG + Intronic
1092620261 12:10257031-10257053 CAGAAGCTTTGGAGGCCACAAGG - Intergenic
1093861044 12:24167943-24167965 CTTTGCCTTTGGGGGCCAGATGG - Intergenic
1097469905 12:59976535-59976557 CTTTGGCTTTGGGGAACAAAAGG + Intergenic
1098992246 12:77076581-77076603 CAGTGGCTTGAGAGGCCATAAGG + Intergenic
1099016022 12:77345249-77345271 CTCTGGATGTGGAGGCCACATGG + Intergenic
1100687147 12:96998960-96998982 GTGTGGCTTTTGAGGACTAAAGG + Intergenic
1100757651 12:97769665-97769687 CAGGGGCTATGGAGACCAAACGG - Intergenic
1101651363 12:106680397-106680419 CTGTGGCATTTGAGGACTAAGGG - Intronic
1104510384 12:129372454-129372476 CAGTGGCATTAGAGGCCACATGG + Intronic
1105733723 13:23246347-23246369 CTGTTGCTTTGGCTGCCAGAGGG - Intronic
1106315116 13:28586715-28586737 CTGAGGCTTTTGAAGCCAACAGG + Intergenic
1108255906 13:48611129-48611151 CTGTGGAGTTGGTGGCCACAAGG - Intergenic
1108427973 13:50324571-50324593 GTAGGGCTTTGGAGGCCAAATGG - Intronic
1109077690 13:57858606-57858628 CTGTGGGATTGGAGGGCAAGAGG + Intergenic
1112197722 13:97242190-97242212 ATGTGTCTTTGGAACCCAAAAGG + Intronic
1112821661 13:103345228-103345250 CTGTGGCTTGGGTTGCCAAGGGG + Intergenic
1113522425 13:110950356-110950378 GTGTGGCTTTTGGGGCCCAAAGG + Intergenic
1113905966 13:113819320-113819342 CTGTGGCTTTGAAGGCCACAGGG - Intergenic
1113930417 13:113965311-113965333 CTGTGGCTCTGAGGGCAAAAGGG + Intergenic
1114364749 14:22014031-22014053 CTCTGGCACTGCAGGCCAAAAGG - Intergenic
1114600521 14:23952669-23952691 GTCTGGCTTTGGAGGCCAGTGGG + Intergenic
1114604755 14:23987813-23987835 GTCTGGCTTTGGAGGCCAGTGGG + Intronic
1115730038 14:36258789-36258811 CTTAGGCTTTGCAGGCCATATGG - Intergenic
1116557354 14:46328206-46328228 CTGTGGCTTCGGACCTCAAATGG + Intergenic
1117754963 14:58965163-58965185 TTTAGGCTTTGGAGGCCACAAGG - Intergenic
1118498127 14:66329078-66329100 CTCTGGCTGTGGAAGCCAACTGG - Intergenic
1119056492 14:71427362-71427384 CAGAAACTTTGGAGGCCAAAAGG - Intronic
1122035595 14:98946971-98946993 CTGATGGTTTGGAGGCCAACAGG + Intergenic
1124076239 15:26447337-26447359 TTTTGGCTTTGCAGGCCATATGG - Intergenic
1125796788 15:42409286-42409308 CTGTGGCTGTGGAGGCACAAAGG - Exonic
1126914025 15:53445176-53445198 CTGTAACTTGGGAGGTCAAATGG - Intergenic
1127697911 15:61469976-61469998 CTGGGGCTTCATAGGCCAAAGGG + Intergenic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1128327598 15:66735189-66735211 GTGTGGCTTTGGTGGCCAGCAGG - Intronic
1129663303 15:77565308-77565330 CTGGGGATTGGGAGGCCCAAGGG - Intergenic
1130991563 15:88878919-88878941 CTGTGGGTTTGGTGGCCACCTGG - Intronic
1131589443 15:93732096-93732118 CTGTGTCTTTGGAGGTCAGGGGG + Intergenic
1132305014 15:100804800-100804822 CTGTGGCTTTGGGGCCTGAAGGG + Intergenic
1132842981 16:1987261-1987283 CTCTGGCTGGGGAGGCCCAAAGG - Exonic
1133344348 16:5060076-5060098 CTGTGGCATGGGAGGCCAGCGGG + Intronic
1133458710 16:5967144-5967166 TTGTGGCTTTGCGGGCCAGATGG - Intergenic
1134196391 16:12162435-12162457 TTTTGGCTTTGCAGGCCATATGG + Intronic
1136592034 16:31223351-31223373 CTGTGGCTGGGGAGGCCCAAGGG + Intronic
1137231123 16:46568882-46568904 CTCTGGCTTCGGGGGCCAGAAGG - Intergenic
1137527932 16:49253104-49253126 TTTTGGCTTTGCAGGCCATATGG + Intergenic
1138075692 16:54040280-54040302 CAGTGGCTTTGAAATCCAAATGG + Intronic
1138153021 16:54676882-54676904 CTGTGGCAGTGCTGGCCAAATGG + Intergenic
1140730637 16:77852731-77852753 TTGTGGATCTGTAGGCCAAAAGG - Intronic
1140980675 16:80105863-80105885 TTTAGGCTTTGCAGGCCAAATGG + Intergenic
1141462608 16:84186721-84186743 CTGTAGCCTTGGAGGTCTAAAGG - Intronic
1141660866 16:85440835-85440857 CTGTGCCCTGGGAGGCCAACTGG + Intergenic
1142217049 16:88834905-88834927 CGGAGGCTTTGGAGGCCGCATGG - Intronic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1142670255 17:1484812-1484834 CAGGTGCTTTGGAGGACAAATGG + Intronic
1143298228 17:5887423-5887445 TTTAGGCTTTGGAGGCCATATGG - Intronic
1143526950 17:7478738-7478760 CTGTGGCTTTGGGTGACAGATGG - Intronic
1144086395 17:11812749-11812771 TTGTGGCATTGGAGGAGAAAAGG - Intronic
1144235750 17:13258680-13258702 CTGTGACTTTGGAAGCCACAGGG + Intergenic
1144688810 17:17245435-17245457 CTTAGGCTTTGGAGGTCATATGG - Intergenic
1144772362 17:17766902-17766924 TTGTGGCTTTGGAAGCCCATGGG + Intronic
1146803390 17:35845009-35845031 AGGTGGCTATGGAGGCAAAATGG + Exonic
1147893247 17:43732488-43732510 TTGAGGCTTTGCAGGCCATAAGG - Intergenic
1148045207 17:44739484-44739506 CGCTGGCTTTGGTGGCCCAAAGG + Intronic
1149544897 17:57496259-57496281 CTGTGGCTCTGTAGGGCACACGG - Intronic
1150930047 17:69574922-69574944 GTGTGGCTTTGGGGTCCAAGGGG + Intergenic
1151023967 17:70655720-70655742 TTTTGGCTTTGCAGGCCATATGG + Intergenic
1151310825 17:73291554-73291576 CTATGGTTTGGGAGGCCACAGGG + Intronic
1151737443 17:75953044-75953066 CTGTGGCTATGAATGCAAAAGGG + Intronic
1153197563 18:2617429-2617451 TTCTGGCTTTGCAGGCCACATGG - Intergenic
1153926467 18:9839295-9839317 CTGTGGCTTCGGGGGCAAACAGG + Intronic
1155017077 18:21854270-21854292 TTTTGGCTTTGTAGGCCACATGG + Intronic
1155618057 18:27744100-27744122 CTTAGGCTTTTGAGGCCATATGG - Intergenic
1156591348 18:38492475-38492497 CTGAAACTGTGGAGGCCAAAGGG + Intergenic
1157826639 18:50818317-50818339 CTGTGTCTTTGGCTTCCAAATGG - Intronic
1157964530 18:52192770-52192792 CATTGGCTTTGGGGGACAAAAGG + Intergenic
1158385035 18:56980001-56980023 CTGTGGCTTTGGCAGAAAAAAGG - Intronic
1158484574 18:57854327-57854349 CTGTGAGTTTGAAGGCTAAATGG - Intergenic
1158982787 18:62781035-62781057 CACTGGCTTTGGAATCCAAAAGG + Intronic
1159565008 18:70037989-70038011 CCGTGGTATTGGTGGCCAAAAGG + Intronic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1159913379 18:74167061-74167083 CAGGGGTTTTGGAGGCCAGAGGG - Intergenic
1163554162 19:17983152-17983174 CTGAGGCTCTGGGGGACAAAGGG + Intronic
1164008692 19:21176944-21176966 CAGTGCTTTGGGAGGCCAAAGGG - Intronic
1164591686 19:29511041-29511063 ATGTGGATTTGTAGGCCATAAGG - Intergenic
1165154018 19:33776825-33776847 CTGGGGCTTGGGAGCCCCAAAGG + Intergenic
1167823356 19:51949744-51949766 CTGGAGCTTTGGAGGCCCAAGGG + Intergenic
1167999436 19:53432648-53432670 CTGTGACTGTGTGGGCCAAAGGG + Intronic
1168175612 19:54625478-54625500 CTGTGCCTCTGTAGGCCAAGGGG + Intronic
924981751 2:229038-229060 CTGTGGCTTTGGGTGCACAAAGG - Intronic
927170822 2:20367899-20367921 CTGTGGCTTTGCAGGGTACACGG + Intergenic
927364632 2:22279796-22279818 TTCTGGCTTTGCAGGCCATATGG - Intergenic
927517838 2:23682440-23682462 GAGTGGCTTGGGAGGCCAATGGG - Intronic
927831961 2:26359151-26359173 TTGAGGCTTTGCAGGCCATATGG - Intronic
928035020 2:27814778-27814800 CTATGGATTTGGAGATCAAAGGG - Intronic
928077767 2:28280812-28280834 CTTTGTTTCTGGAGGCCAAATGG - Intronic
928337885 2:30413675-30413697 CTAGCACTTTGGAGGCCAAAGGG + Intergenic
929260102 2:39857029-39857051 TTTTGGCTTTGCAGGCCATATGG + Intergenic
931533725 2:63248280-63248302 CAGAAGCTTTGGAGGCCAGAAGG - Intronic
933668984 2:84988827-84988849 ATGTGGCTTTGTAGGCCACATGG + Intronic
936392129 2:112084926-112084948 TTTTGGCTTTGCAGGCCATATGG + Intronic
936511235 2:113149348-113149370 CTGTGGCAATGGTGGCCATAAGG - Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937992870 2:127674148-127674170 CTGTGGCTTTGCTGGGGAAAGGG - Intronic
938937005 2:136136007-136136029 CTGTGGCCTTGCAGGCCATCTGG + Intergenic
939350908 2:141036564-141036586 CTTTGCCTTTGGAGGAAAAAGGG - Intronic
939436316 2:142181923-142181945 ATATGGCTTGGGAGGCCAAGGGG - Intergenic
940202619 2:151167985-151168007 CTGTGACTTTGGATTCCCAAGGG - Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
942699238 2:178685953-178685975 CTGTAGATTTGAAGGCCACAGGG + Intronic
942834464 2:180277237-180277259 CTGTGGCAGTGGTGGCCACAGGG - Intergenic
945204123 2:207313464-207313486 CTGTCACTTTTGAAGCCAAAGGG - Intergenic
946252068 2:218419797-218419819 CAGTGGCTGGGGAGGCCAATGGG - Intronic
946604810 2:221391995-221392017 CAGTGGTTTTGGAGCGCAAAGGG - Intergenic
947344541 2:229177255-229177277 CTGGGGCTTGGGAGGCGATATGG - Intronic
947485094 2:230540708-230540730 CTTTGGCTATTGAGTCCAAATGG + Intronic
947693692 2:232164026-232164048 TTTTGGCTTTGCAGGCCATATGG - Intronic
947772166 2:232679102-232679124 TTGTGGCTTAAGGGGCCAAATGG + Intronic
948292741 2:236838480-236838502 ATGTGGCTTTGGGGGAAAAAAGG - Intergenic
1169407835 20:5338392-5338414 CAGAAACTTTGGAGGCCAAAAGG + Intergenic
1171508141 20:25656177-25656199 CTGTGTCTTTAGAGGTGAAATGG + Intergenic
1173900738 20:46586841-46586863 TTTTGGCTTTGCAGGCCACATGG + Intronic
1173991115 20:47304346-47304368 TTGAGGCTTTGCAGGCCATAAGG + Intronic
1174820336 20:53721366-53721388 TTTAGGCTTTGGAGGCCAGATGG + Intergenic
1175461804 20:59157416-59157438 CTCTGGCTTGGGAGGCGAATTGG + Intergenic
1175651606 20:60729472-60729494 CTTTGGCTTTGAATGCCATATGG + Intergenic
1175653198 20:60746776-60746798 CTGTGGCTTCATAGGGCAAATGG - Intergenic
1176698937 21:10019171-10019193 GTGGGCCTTTGGAGGTCAAAAGG + Intergenic
1177919113 21:27128427-27128449 CTTAGGCTTTGTAGGCCATAAGG - Intergenic
1179082921 21:38190093-38190115 CTTTGGCTTTGCGGGCCATATGG - Intronic
1179159208 21:38878119-38878141 CTCTGGCTTTGGAGGTCATATGG + Intergenic
1180173103 21:46071041-46071063 CTGTGGATTTGGAAGCAAGAAGG + Intergenic
1181344305 22:22206956-22206978 CTGTGGGTTCAGAGCCCAAAGGG - Intergenic
1181879852 22:25969558-25969580 CTTGGACTTTGTAGGCCAAATGG - Intronic
1182517120 22:30865198-30865220 CTCTGGCTGAGGAGGCCACAGGG - Intronic
1182730628 22:32488648-32488670 TTGTTGCTTTGAAGGCCTAAAGG + Intronic
1182843075 22:33407780-33407802 CTTTGGCTTTGGAAGCGAAAAGG + Intronic
1183498270 22:38162911-38162933 CTGAGGCTCTGGAGGACACACGG + Intronic
1184502588 22:44882881-44882903 CTGTGAATTTGGAGGGCACAGGG + Exonic
952464615 3:33568717-33568739 ATGTGGCTTTGCAGACCATAAGG - Intronic
956748286 3:72326910-72326932 CTGTGACTTTGGAAACCAGATGG - Intergenic
956778471 3:72586192-72586214 CTGTGCCAAAGGAGGCCAAAAGG + Intergenic
956894749 3:73648538-73648560 CTGGGGCTTTGAGGGCCAAGGGG - Intergenic
957002634 3:74903994-74904016 TTTTGGCTTTGCAGGCCAAATGG - Intergenic
957552711 3:81727851-81727873 CTGTTACTTTGGAGGCCATCAGG - Intronic
959010404 3:101069387-101069409 CCTTGGTTTTGGAGGCCAACAGG - Intergenic
959734280 3:109640094-109640116 CTGTGGCCATGTAGGCCAATTGG + Intergenic
959806560 3:110561845-110561867 CTGGGGCATTGGTGGCCACAGGG - Intergenic
960256536 3:115516793-115516815 CTGAGGCTTTCTAGGCCAACAGG + Intergenic
960701206 3:120441024-120441046 CTGTGGCCTTGGCTCCCAAAGGG + Intronic
961566257 3:127765459-127765481 TGGGGGCTTTGGAAGCCAAATGG - Intronic
963929426 3:150987938-150987960 CAGAAGCTTTGGAGGCTAAAAGG - Intergenic
966347748 3:178997819-178997841 CCGTGGGGTTGGAGCCCAAAAGG + Intergenic
966667206 3:182484915-182484937 CTGTAAATTTGGAGGCCAATTGG - Intergenic
968912907 4:3484971-3484993 CTGTGGCCTTGGAGCCCTGAGGG + Intronic
969613300 4:8238650-8238672 CTGGGACTTGGGAGGCCACAGGG - Intronic
971039620 4:22737224-22737246 TTGAGGCTTTGCAGGCCATATGG - Intergenic
971174173 4:24264823-24264845 CTGTTGTTTTTGTGGCCAAATGG + Intergenic
973173695 4:47177223-47177245 CTGTGGCTTTGAAGATAAAAAGG - Intronic
973318651 4:48787389-48787411 TTTTGGCTTTGCAGGCCATATGG + Intergenic
974666496 4:64969236-64969258 CTGTGGCTTTGTAGGGTACAGGG + Intergenic
974921525 4:68246708-68246730 TTGAGGCTTTGTAGGCCATATGG + Intergenic
975789934 4:77938236-77938258 TTTAGGCTTTGCAGGCCAAATGG - Intronic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
976098863 4:81539122-81539144 CTGAGGCCTTGGAGGCAAGAAGG - Intronic
976277837 4:83295714-83295736 TTCTGGCTTTGGAGTCCATATGG - Intronic
979442988 4:120774508-120774530 CTGTAGCCTGGGAGGGCAAATGG + Intronic
984031119 4:174605361-174605383 TTGTGGCTTTATAGGCCAGATGG + Intergenic
987221638 5:15796431-15796453 TTTAGGCTTTGCAGGCCAAATGG - Intronic
992638961 5:78752278-78752300 CTTTGGCTTTGAAGGCCCTAAGG + Intronic
998168069 5:139855847-139855869 CTATGGCTTTGGGGGCAAAGGGG - Intronic
999833513 5:155343122-155343144 CTGAGGCTTCACAGGCCAAAGGG + Intergenic
1001235417 5:170025385-170025407 TTTAGGCTTTGGAGGCCAGATGG - Intronic
1001531966 5:172469691-172469713 CAGTGGCAGTGGAGGCCACATGG - Intergenic
1005570391 6:27139602-27139624 CTATGGCTTCGGCGGCTAAATGG + Exonic
1006011407 6:31045687-31045709 CTGAGGCTGGGGAGGCCGAATGG + Intergenic
1007113398 6:39326759-39326781 CTGTGGCTTTTGTGGCCCTAGGG - Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1011870424 6:91886085-91886107 CTGAGGCTTAGGAGGAAAAATGG + Intergenic
1012009750 6:93768319-93768341 CTTTGGCTTTGTGGGCCATATGG + Intergenic
1012827403 6:104163219-104163241 CTGGGGCATTGGTGGCCACAGGG + Intergenic
1014520768 6:122439396-122439418 CTGTGACTTTGCAGGGTAAAGGG - Intergenic
1015032831 6:128616377-128616399 TTGAAACTTTGGAGGCCAAAAGG - Intergenic
1015366157 6:132400801-132400823 CTTTGGCTTTGGGGACCTAATGG - Intronic
1015658341 6:135545307-135545329 TTATGGCTTTGCAGGCCACATGG - Intergenic
1015890068 6:137961573-137961595 TTTTGGCTTTGTAGGCCATATGG - Intergenic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1016392747 6:143591627-143591649 CTAGGGCTGTGAAGGCCAAATGG + Intronic
1017746550 6:157451968-157451990 CTGGGGCTGTGGGGCCCAAAGGG + Intronic
1017769938 6:157637194-157637216 CTGTGGCTTTGGAGGTGGCATGG + Intronic
1019042187 6:169116475-169116497 CTGTTGCTCTGGGGTCCAAAAGG - Intergenic
1019268133 7:130418-130440 CGGTGGCTTTGGAGGCTTCAGGG + Intergenic
1019423561 7:962902-962924 CTGTGGCTCTGCTGCCCAAAGGG + Intronic
1019655819 7:2194592-2194614 TTGTAGCTTTGGGGGCCATAAGG - Intronic
1020699185 7:11456663-11456685 TTTTGGCTTTGTAGGCCATATGG + Intronic
1021548602 7:21844530-21844552 TTTTGGCTTTGTAGGCCATAAGG - Intronic
1021614862 7:22492014-22492036 CTATGGCTTTTGAGGGCAAATGG - Intronic
1022654006 7:32302097-32302119 TTTTGGCTTTGCAGGCCATATGG - Intergenic
1024037012 7:45515482-45515504 TTTTGGATTTGGAGGACAAATGG + Intergenic
1024049875 7:45611881-45611903 TTGTGTCTTCAGAGGCCAAATGG - Intronic
1024943840 7:54789195-54789217 CTGTGGGTTTTGAACCCAAAAGG - Intergenic
1026151897 7:67794969-67794991 CTGAGGCTCAGGAGGCCAAGTGG - Intergenic
1026231760 7:68489987-68490009 CAGTGCCTTGGGAGGCCAATGGG + Intergenic
1027914720 7:84301638-84301660 CTGATGCTTTGAAGGCCATAAGG + Intronic
1028379513 7:90182997-90183019 CTATGGCTTTTGAGGGCAAATGG + Intronic
1033505886 7:141999420-141999442 CCATGGCTGTGGAGTCCAAAGGG + Intronic
1036218918 8:6904074-6904096 CTGTTGCTGTGGAGGTCAAATGG + Intergenic
1036711279 8:11080597-11080619 AGGTGGCTTTGGAGGCCACCTGG - Intronic
1038845813 8:31228769-31228791 CTGTGCTTTGGGAGGCCAAGGGG - Intergenic
1039391921 8:37188162-37188184 CTCTGGCATTGGAGCACAAAAGG + Intergenic
1041005976 8:53497335-53497357 CTGAGGCTCTGCAGGGCAAAGGG - Intergenic
1042528028 8:69785212-69785234 AAGTGGTTTTGGAGGCAAAAAGG + Intronic
1042616871 8:70659276-70659298 CTGTGGGTAGGGAGACCAAAAGG + Intronic
1043451220 8:80368911-80368933 TTTAGGCTTTGCAGGCCAAAAGG - Intergenic
1046212293 8:111092706-111092728 CTGTGGATATGGAAGCAAAAGGG - Intergenic
1046562429 8:115854890-115854912 ATGTGGATGTGGAGGCAAAAGGG - Intergenic
1047982651 8:130198962-130198984 CTGTGGGTTGAGAAGCCAAAAGG - Intronic
1052296391 9:26900277-26900299 CACTGGCTTTGGAGTTCAAAAGG - Intergenic
1052505131 9:29343783-29343805 ATGTGTCAGTGGAGGCCAAATGG - Intergenic
1052537994 9:29772621-29772643 CTGTGTCTTTGCGGGCCACATGG - Intergenic
1053265304 9:36708691-36708713 CGGTGGTTTTGGGGGTCAAATGG + Intergenic
1053636041 9:40005365-40005387 GTGGGCCTTTGGAGGTCAAAAGG + Intergenic
1053769943 9:41459282-41459304 GTGGGCCTTTGGAGGTCAAAAGG - Intergenic
1054316918 9:63602465-63602487 GTGGGCCTTTGGAGGTCAAAAGG + Intergenic
1054548618 9:66370762-66370784 GTGGGCCTTTGGAGGTCAAAAGG - Intergenic
1055307871 9:74949755-74949777 CTGTGTCTTTGGAGGCAGGAAGG + Intronic
1055912582 9:81369243-81369265 TAGTGGCTTTGCAGGCCAGATGG - Intergenic
1056506200 9:87260340-87260362 ATGTGGCCTTGGAGGCCTGATGG - Intergenic
1057418880 9:94892012-94892034 CTGAAACTATGGAGGCCAAAAGG - Intronic
1058040473 9:100296401-100296423 CTGTGTCTTTGGTGACGAAAGGG - Intronic
1058873559 9:109222949-109222971 TTCTGGAGTTGGAGGCCAAATGG - Intronic
1059815787 9:117911990-117912012 CAGAAACTTTGGAGGCCAAAAGG + Intergenic
1061644397 9:131988724-131988746 CAGTTCCTTGGGAGGCCAAAGGG - Intronic
1061825886 9:133257872-133257894 CAGGGGCTTTGGAGAACAAAGGG + Intronic
1062073293 9:134570898-134570920 CTGTGGTTTTGGAGCCCCCAGGG + Intergenic
1062304440 9:135895392-135895414 CTGAAGCTATGGAGGCCAGAGGG + Intronic
1186557035 X:10570689-10570711 TTTTGGCTTTGTGGGCCAAAGGG + Intronic
1186891010 X:13959204-13959226 GTGTGGCTTTAGAGTCAAAATGG - Intergenic
1187643120 X:21316497-21316519 CAGTTGCTTTGGAGGCTATATGG + Intergenic
1190031021 X:46973001-46973023 CTTTGGCTTTGAGGGCCACATGG - Intronic
1190164856 X:48064962-48064984 CTGAGGCTTTGTGGGCCATACGG - Intronic
1190212095 X:48457089-48457111 CTCAGGCTTTGCAGGCCATATGG + Intergenic
1190945472 X:55089194-55089216 CTGTGGCTTCTGAGGGAAAAGGG + Intronic
1192788049 X:74354063-74354085 CTGTGGCCATGGAGGCCAGCTGG - Intergenic
1193671777 X:84396540-84396562 TTGTGGCTGTGGTGGCCAGATGG + Intronic
1195128299 X:101830226-101830248 CTGGGGCTATGGAATCCAAAGGG - Intergenic
1195571392 X:106401890-106401912 CTGTGGCCTTGGACCCCAGAAGG + Intergenic
1195743763 X:108092597-108092619 TTTAGGCTTTGTAGGCCAAAAGG + Intronic
1197318461 X:124997737-124997759 CAGTGGCTCTGGACACCAAAAGG + Intergenic
1198374751 X:136027558-136027580 ATCAGGCTTTGGAGGCCATATGG + Intronic
1201400476 Y:13599229-13599251 CTGAGGCTCTGGAGGGCAACAGG - Intergenic