ID: 906328995

View in Genome Browser
Species Human (GRCh38)
Location 1:44868772-44868794
Sequence GATGAAGGCAAGTGTAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906328991_906328995 -1 Left 906328991 1:44868750-44868772 CCTGGAACCAGGTGATCAAATGG 0: 1
1: 0
2: 1
3: 6
4: 161
Right 906328995 1:44868772-44868794 GATGAAGGCAAGTGTAGTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 145
906328993_906328995 -8 Left 906328993 1:44868757-44868779 CCAGGTGATCAAATGGATGAAGG 0: 1
1: 0
2: 1
3: 8
4: 144
Right 906328995 1:44868772-44868794 GATGAAGGCAAGTGTAGTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906328995 Original CRISPR GATGAAGGCAAGTGTAGTTC TGG Intronic
904906160 1:33898846-33898868 CATGAGGGCAAGTGTCCTTCAGG - Intronic
906328995 1:44868772-44868794 GATGAAGGCAAGTGTAGTTCTGG + Intronic
908622598 1:66001176-66001198 GATGAAAGCAACTGTGGGTCAGG + Intronic
911482380 1:98460219-98460241 GATGAGGGCAAGTGAGGTTGGGG - Intergenic
911713030 1:101096897-101096919 AATGAAGGCATGGGTAGATCTGG + Intergenic
915494073 1:156268693-156268715 GATGAAGGATAGTGTATTTCAGG - Intronic
918060548 1:181057351-181057373 AATGTAGGCAAGTTTATTTCTGG + Exonic
918985046 1:191614288-191614310 GATGAAGGAAGGTGTAGTGGTGG + Intergenic
921152778 1:212414948-212414970 GTTGATGGGAAATGTAGTTCTGG + Intergenic
1063675129 10:8134471-8134493 GATGAAGGCAATTTCAGTTAGGG + Intergenic
1065964454 10:30759720-30759742 GATGGATGCAAATGTAGCTCGGG + Intergenic
1067560830 10:47303289-47303311 GATGGAGGCATTTGTTGTTCAGG - Intronic
1067667772 10:48292997-48293019 GAAGAAGGGAAGTATATTTCTGG + Intergenic
1069566259 10:69465291-69465313 GATGAGGGCAGGAGTTGTTCAGG + Intronic
1070498961 10:77052455-77052477 GATGTGGGCAAGTGTCATTCTGG - Intronic
1072925468 10:99613071-99613093 GATGAGGGGTAGAGTAGTTCAGG - Intronic
1073073425 10:100808939-100808961 GATGATGGCAAGTTTTGTGCGGG - Intronic
1074866006 10:117544722-117544744 GATGCAGGCAAATCCAGTTCGGG - Intronic
1079187012 11:18246911-18246933 GTTGAAGGCATGGGTAGTTCAGG + Intronic
1079189791 11:18267988-18268010 GTTGAAGGCATGGGTATTTCAGG - Intronic
1080607529 11:33875996-33876018 AAAGAAGGCCAGTGTGGTTCAGG - Intronic
1085724801 11:78945040-78945062 GATGAAAGCAAGAGTAATTTTGG + Intronic
1089839849 11:121406569-121406591 GATTCAGGCAAGGGAAGTTCCGG + Intergenic
1090575369 11:128096129-128096151 GCTGAAGGCAAGGGTTGTACAGG + Intergenic
1091168849 11:133502994-133503016 GGAGAAGGGAAGTTTAGTTCAGG - Intronic
1092116366 12:6011503-6011525 GATGAGGGAAAGGGTACTTCTGG + Intronic
1094731479 12:33181165-33181187 GATGAAGGGGAGTGAACTTCAGG + Intergenic
1101261930 12:103041451-103041473 GGTGAAGGCAAGAGCAGTACTGG - Intergenic
1105624266 13:22098096-22098118 AATCAAGGCAAGTGTATCTCAGG - Intergenic
1106959189 13:34977709-34977731 GATGAAGGCTAATGAGGTTCAGG + Intronic
1107272549 13:38637088-38637110 GATGAAGGCATTTGTAATACAGG + Intergenic
1108544263 13:51475761-51475783 GAGGATGGCAAATGGAGTTCTGG - Intergenic
1110731225 13:78880893-78880915 AATGCAGGAAAGTGTAGTTTTGG - Intergenic
1117196887 14:53349289-53349311 GATGTAGGCAAATCTAGTTTAGG + Intergenic
1118987141 14:70766150-70766172 GAAGAAGCCAAGTTTAGTTTTGG + Intronic
1119463676 14:74834773-74834795 GTTGCAGGAAAGTGTAGTTGGGG + Intronic
1121086164 14:91147797-91147819 GAGCAGGGCAAGTGTAATTCTGG + Exonic
1121522402 14:94595050-94595072 GATCAAGGCAAGTGCAGGGCTGG + Intronic
1121984196 14:98485523-98485545 CATGAAGGTAAGTGTAGTTTGGG - Intergenic
1122453605 14:101832643-101832665 GATGAAGACAAGTGTTTTTAAGG + Intronic
1122792684 14:104190980-104191002 GATGGAGGCAACTGGGGTTCAGG - Intergenic
1124157759 15:27242698-27242720 GATGAAGAATAGTGCAGTTCGGG + Intronic
1127007581 15:54587678-54587700 GAGGAAGGCAAGTGAAGGCCAGG + Intronic
1128064507 15:64755951-64755973 GAGGAAGGAAAGGGTAGTTGAGG - Intronic
1129161172 15:73748773-73748795 GAGGAAGGCAGGTGAAGCTCTGG - Intronic
1129868681 15:78927472-78927494 AATGAAGGCATGTGTGGATCTGG + Intronic
1130736717 15:86558091-86558113 GAGTAAGGCAATTCTAGTTCAGG + Intronic
1130770524 15:86919174-86919196 GTTGAAGTCAAGTGAAGTTGAGG - Intronic
1131797611 15:96035435-96035457 GATGAAGGAAAGTCTGGATCAGG - Intergenic
1133654928 16:7851876-7851898 GATGAAGGCAAGGCCATTTCTGG - Intergenic
1138264578 16:55651335-55651357 GATAAAGGCACATGAAGTTCAGG + Intergenic
1145711705 17:26984214-26984236 GCTGAAGGGAAGTGTGGTGCAGG - Intergenic
1147741966 17:42675065-42675087 TCTGGAGGCAGGTGTAGTTCAGG + Intronic
1149043125 17:52214070-52214092 GACCAAGACAAATGTAGTTCTGG - Intergenic
1150415683 17:64986555-64986577 GATGAGAGCAAGTGTGGTGCAGG + Intergenic
1150795982 17:68237482-68237504 GATGAGAGCAAGTGTGGTGCAGG - Intergenic
1152021875 17:77784050-77784072 GATGAAGGCAGGTGTGGTGGGGG - Intergenic
1153517536 18:5918078-5918100 ACTGAATGAAAGTGTAGTTCTGG + Intergenic
1155542343 18:26881734-26881756 GATGAAGGCAGCAGTAGTCCTGG + Intergenic
1156724099 18:40106838-40106860 GATGAAGCAAAGTGTTGTTTTGG + Intergenic
1165761843 19:38326192-38326214 GATGAAGCCATGTGTAGGTGTGG + Intronic
1166383866 19:42369762-42369784 GATGAAGGCAAGTGAGGGCCTGG - Intronic
1166991024 19:46692815-46692837 GATGAAGGAAAGAGTATTCCTGG - Intronic
1168259938 19:55187667-55187689 GAAGAAGGCAAGGGGAGCTCGGG - Intronic
1168580448 19:57551528-57551550 GATGAAGGTAGGTGGAGTCCAGG + Intronic
927412897 2:22846789-22846811 TATGAAGCCAAGTGTATTTGGGG - Intergenic
928308957 2:30194073-30194095 GATGAAGGCAAGTGTTGGCTGGG - Intergenic
928708909 2:33982435-33982457 GTTGCAGGCACCTGTAGTTCCGG + Intergenic
929377273 2:41303195-41303217 AAAGAAGGTAAGTTTAGTTCTGG + Intergenic
931593155 2:63909004-63909026 GATGAGGGCAAATGAAGTTGAGG - Intronic
932200421 2:69821872-69821894 GATGACGGTAAGTGAAGTTATGG + Intronic
933296158 2:80493432-80493454 GTGGAAGGCATGTGTAGTCCTGG + Intronic
935357829 2:102221004-102221026 CCTGAAGGCCAGTGTCGTTCTGG + Intronic
936432283 2:112474923-112474945 GATGGAGGGAGGAGTAGTTCAGG + Intergenic
936432529 2:112476863-112476885 CATGAAGGGAGGAGTAGTTCAGG - Intergenic
937297775 2:120820115-120820137 GATGAAGGCAAGTGAAGGAAAGG + Intronic
937540699 2:122949054-122949076 GATGACGGCAAGTGGAGTGATGG - Intergenic
938620613 2:133049008-133049030 AATGAATGGAAGTGGAGTTCTGG - Intronic
942561166 2:177220578-177220600 GATGAAACCAAGGATAGTTCAGG + Intronic
943450932 2:188040857-188040879 GATCAAGTCAAGTCTATTTCAGG + Intergenic
945038906 2:205728167-205728189 GATGGAGGCAAGGGTCGTGCTGG + Intronic
946741479 2:222806793-222806815 AATGAAGTCAAGGGCAGTTCTGG - Intergenic
948296877 2:236867241-236867263 AATGAAGGCATGTGAAGTTCTGG - Intergenic
1168895120 20:1319031-1319053 GAATAAGGCAAGTGGGGTTCTGG + Intronic
1169042708 20:2508920-2508942 GATGTTGGGAATTGTAGTTCTGG - Exonic
1169332449 20:4726944-4726966 GCAGAAGGCGAGTGTAGCTCTGG - Exonic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1174104705 20:48153915-48153937 GATGAGAGCAAGTGTTGTCCTGG + Intergenic
1174715937 20:52758820-52758842 GGGGAAGGCAAGTGGAGTCCAGG + Intergenic
1176657505 21:9600972-9600994 GATGAAGGTAAGTGAATTTGGGG - Intergenic
1178369089 21:32012117-32012139 GATGCAGGAGAGTGTGGTTCAGG - Intronic
1178591867 21:33917610-33917632 GATTCAGGCCAGGGTAGTTCAGG - Intergenic
1180567784 22:16689989-16690011 GATGAGGGAAAGGGTACTTCTGG + Intergenic
1181638315 22:24184450-24184472 GATGGAGGGAAGTGCAGGTCAGG + Intronic
949103524 3:175534-175556 TATGTATGCAAGTATAGTTCTGG + Intergenic
949714260 3:6910334-6910356 GGTGGAGGCAAATGTAGTTCAGG + Intronic
953369078 3:42372060-42372082 GAAGTAGGAAATTGTAGTTCAGG - Intergenic
953459918 3:43073869-43073891 CATGAAGGCACATCTAGTTCTGG + Intergenic
955786785 3:62549671-62549693 AATGAAGGAAAGTGTATTTTAGG - Intronic
957671090 3:83303646-83303668 GATTAAGGGAAGTCCAGTTCTGG + Intergenic
959469968 3:106738168-106738190 GATGAAGGCACCTGTACATCTGG - Intergenic
960976564 3:123181048-123181070 GATGGATGCAACTGTAGTGCTGG - Intronic
961624746 3:128254198-128254220 GAGGAAGGCAAGTTTGCTTCTGG + Intronic
964404938 3:156339166-156339188 GAGGAATGCATGTGTAGTCCAGG + Intronic
970988786 4:22189569-22189591 TATGAAGGTAAGTGAAGTTAAGG + Intergenic
972263190 4:37432183-37432205 GCTGAAGGCAAATGTAATTAAGG - Intronic
975850696 4:78568875-78568897 GATGAAGGCTAGTCTAGTTTAGG + Intronic
980733949 4:136857980-136858002 GCTGAAGACAAATGGAGTTCAGG - Intergenic
982090408 4:151875583-151875605 TGTGAATGCCAGTGTAGTTCGGG + Intergenic
985051973 4:186000173-186000195 GAGGAAGGCATGTTTATTTCAGG - Intergenic
990022017 5:51139334-51139356 AAGGAAGGCCAGTGTAGTTGAGG + Intergenic
990120243 5:52442424-52442446 GATCAAGGCAACAGTAGATCTGG - Intergenic
990546510 5:56827130-56827152 GAGGACTGCAAGTGTAGTTCAGG + Intronic
991245998 5:64508562-64508584 GATGAAAGAAAGTGTAGGTAGGG - Intronic
993881669 5:93370222-93370244 GATGGATGTGAGTGTAGTTCTGG + Intergenic
1001963185 5:175892927-175892949 GATGTAGGGAAGTGCCGTTCTGG - Intergenic
1004420873 6:15468803-15468825 GATGAAGGCAAAGCTCGTTCTGG + Intronic
1004991477 6:21143356-21143378 CATGAAAGCAAGTGTATCTCAGG + Intronic
1007055970 6:38885121-38885143 GGTGAAGGCATGTTTAGATCAGG + Intronic
1007754004 6:44087137-44087159 GATCCAGGCAGGTGTGGTTCAGG - Intergenic
1008945236 6:57089990-57090012 GATGCTGGGAATTGTAGTTCGGG - Exonic
1011012880 6:82721859-82721881 GAGGAAGGGAAGGGTATTTCGGG - Intergenic
1011262699 6:85485426-85485448 CCTGAAGGTAAGTGAAGTTCAGG + Exonic
1012508648 6:99977577-99977599 TATAAAGGCAAATGTACTTCAGG + Intronic
1013129457 6:107218282-107218304 GCTGGAGGCCATTGTAGTTCTGG - Intronic
1015155230 6:130086770-130086792 GATAAAGTGAAGTGGAGTTCAGG + Intronic
1015549795 6:134400337-134400359 GCTGAAGGGAAGTTTAGTTGAGG - Intergenic
1015816248 6:137214041-137214063 GATGAAGTAAACTGTTGTTCTGG + Intronic
1017242848 6:152189844-152189866 GATGAAGGCTAGGGTGGCTCTGG + Intronic
1018697818 6:166404404-166404426 GCTGAAGTCAAGTGCAGATCTGG + Intergenic
1020403666 7:7805765-7805787 GAGGAAGCCAAGTGAAGCTCTGG - Intronic
1020858008 7:13452847-13452869 GATGGAGCCATTTGTAGTTCAGG + Intergenic
1022500480 7:30879516-30879538 GAGGAAGGCAGGTGCAGGTCTGG - Intronic
1027340297 7:77200602-77200624 GCTGTAGGCAAGAGAAGTTCAGG - Intronic
1031052338 7:116956447-116956469 GATGAAGGCAAGTGTGTTCCTGG + Exonic
1033463025 7:141564557-141564579 GATTATGGGAACTGTAGTTCAGG + Intronic
1038298243 8:26316679-26316701 GATCAAGGCAACTGCAGATCTGG + Intronic
1039417747 8:37410001-37410023 GATGAAGCCAAGGAGAGTTCTGG - Intergenic
1040563895 8:48548898-48548920 GATGAAGGCCAGTGAAATGCTGG + Intergenic
1043057975 8:75464411-75464433 GATAAAGGCAAATTTAGTGCAGG - Intronic
1043239913 8:77919402-77919424 TATGTAGGCAGGTGTAGCTCAGG - Intergenic
1046796970 8:118384038-118384060 GATGAGGGCTATTGTAGTTGGGG + Intronic
1049126635 8:140795106-140795128 GATGTAGGCAAGTGATGTTTGGG - Intronic
1049351428 8:142166858-142166880 GATGAAGGCAAATGCATGTCGGG - Intergenic
1051438885 9:17061641-17061663 CATGAAGGCAGTTTTAGTTCTGG + Intergenic
1052990430 9:34516200-34516222 CAGGAAGGCAAGTGTGGTTGGGG + Intronic
1053191572 9:36075099-36075121 GAAACATGCAAGTGTAGTTCGGG + Intronic
1061452961 9:130678499-130678521 GAAGAAGGCAAGAGGAGGTCAGG - Intronic
1203635230 Un_KI270750v1:104546-104568 GATGAAGGTAAGTGAATTTGGGG - Intergenic
1190322223 X:49186076-49186098 GATGGAGGAAGGTGTAGATCTGG - Intronic
1190958550 X:55221584-55221606 CATGAAGGCAACTTTGGTTCAGG + Intronic
1192783135 X:74314190-74314212 GATGAAGCCAAGTGTATGGCTGG - Intergenic
1194530378 X:95040580-95040602 TATTAAGGCAAGTGTAACTCAGG - Intergenic
1196409978 X:115408171-115408193 GATGAGGGAAAGGGTATTTCAGG - Intergenic