ID: 906329315

View in Genome Browser
Species Human (GRCh38)
Location 1:44871487-44871509
Sequence CTATACATGCAGATGGACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906329315_906329320 18 Left 906329315 1:44871487-44871509 CCCTTGTCCATCTGCATGTATAG 0: 1
1: 1
2: 1
3: 7
4: 145
Right 906329320 1:44871528-44871550 TCCCTCTCTGATTTATATTCTGG 0: 1
1: 0
2: 2
3: 16
4: 212
906329315_906329323 24 Left 906329315 1:44871487-44871509 CCCTTGTCCATCTGCATGTATAG 0: 1
1: 1
2: 1
3: 7
4: 145
Right 906329323 1:44871534-44871556 TCTGATTTATATTCTGGTCATGG 0: 1
1: 0
2: 2
3: 16
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906329315 Original CRISPR CTATACATGCAGATGGACAA GGG (reversed) Intronic
901312261 1:8278466-8278488 CTATAGATGCAAATGGAAACAGG - Intergenic
901942304 1:12672372-12672394 CTATCCATGAGGATGGGCAAAGG + Intergenic
906329315 1:44871487-44871509 CTATACATGCAGATGGACAAGGG - Intronic
907644333 1:56226777-56226799 CTTAATATGCAGATGGACATTGG - Intergenic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
909115809 1:71534680-71534702 CTATCCTTGCAAATGGAAAATGG - Intronic
909142389 1:71884815-71884837 CTTTAAATTCACATGGACAAAGG + Intronic
909156455 1:72083802-72083824 CTATCCATGTAGAGGGAAAATGG - Intronic
913028604 1:114873438-114873460 CTAGCCATCCAGATGGAAAATGG - Intronic
913314622 1:117539511-117539533 GTGTACATGCAAATGGAGAAGGG + Intergenic
915720501 1:157981688-157981710 CTATACATGCAGGTGATCATGGG + Intergenic
921697413 1:218227990-218228012 CTATAATTGCTGATGGACTATGG + Intergenic
1064598619 10:16971298-16971320 CTTTACAGCCAGATGGACACTGG - Intronic
1066603043 10:37128133-37128155 CTATACATACACATAGACTATGG + Intronic
1071808595 10:89152658-89152680 CCACAGATGCAGAGGGACAAAGG - Intergenic
1072216263 10:93289840-93289862 TTATAATTGAAGATGGACAAAGG + Intergenic
1074790357 10:116880451-116880473 CTAACCATGCAGATTTACAAAGG - Intronic
1075167016 10:120077747-120077769 ATACACATGCAAATGGAGAACGG - Intergenic
1075217326 10:120547647-120547669 CGATAAATACAGATGGAAAAAGG - Intronic
1075258420 10:120943488-120943510 CTCTACATGGAGCTGGAAAAGGG + Intergenic
1076425067 10:130361794-130361816 CTCTGCATGCAGATGGACAATGG - Intergenic
1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG + Intergenic
1079908670 11:26281796-26281818 CCATAGTTGCAGAAGGACAATGG - Intergenic
1085293382 11:75416159-75416181 CTCTACATGCAGATGACCAAAGG - Intronic
1088014510 11:105042579-105042601 CTATACAATCAGATAAACAAAGG + Intronic
1090302632 11:125658468-125658490 CAATACATGTAAATTGACAAAGG - Intronic
1091971935 12:4794585-4794607 ATATTCATGCAGATGTACATGGG - Intronic
1092959662 12:13584063-13584085 CTATACATTCAGAAGAACGAAGG + Intronic
1098402675 12:70090502-70090524 CTATACATACAGGGGGAAAAAGG + Intergenic
1099122994 12:78715890-78715912 CTATATATGCAGATGTCCATTGG - Intergenic
1099581704 12:84456008-84456030 TTATACATGCACAAGGTCAAAGG + Intergenic
1104236078 12:126937749-126937771 GTCTCCATGCAGATGGAGAAGGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1111654802 13:91139218-91139240 CTATCCATTCAGATGGAGCAGGG + Intergenic
1112330753 13:98475432-98475454 CTATCCATGTTAATGGACAAGGG + Intronic
1112337368 13:98526215-98526237 TTATACATACAGCTTGACAAAGG - Intronic
1112558336 13:100489789-100489811 TTATAAATGCAGGTGAACAAGGG + Intronic
1112765195 13:102734344-102734366 CTACGCATGCAGATGAAGAAAGG - Exonic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118598070 14:67451443-67451465 CTATACATGCAAAGCCACAAGGG + Intronic
1118851218 14:69585184-69585206 CTCTACATGCAGATGACCAGAGG - Intergenic
1122332525 14:100932661-100932683 CTATACATGCAGAAGGACAAAGG - Intergenic
1123972110 15:25516949-25516971 CGATACCTGCTAATGGACAAAGG + Intergenic
1124825644 15:33092444-33092466 GTTTACATTCAGATGGCCAAAGG - Intronic
1125470532 15:39998286-39998308 TTAAACATGCAGATGAAAAAAGG - Intronic
1126338378 15:47612199-47612221 CCAAACATGCAAAGGGACAATGG - Intronic
1126599870 15:50417872-50417894 CTATACAAGATGATGGCCAATGG + Intergenic
1130304088 15:82701155-82701177 GTATAAATGCAGATGGAGACTGG - Intronic
1131129678 15:89889193-89889215 CCATCCATGGGGATGGACAAGGG + Intronic
1132244365 15:100282859-100282881 CTATACATGCAGATTTATATCGG - Intronic
1138426684 16:56938787-56938809 CTATAGATTCAGATGGAGGATGG + Intronic
1143239189 17:5429585-5429607 CCATACAAGCTGATGGAAAATGG - Intronic
1143823862 17:9588320-9588342 CCATCTTTGCAGATGGACAAGGG + Intronic
1149322748 17:55498123-55498145 ATATACATGCATATGAAGAATGG - Intergenic
1155962444 18:32005986-32006008 GTATACATCCAGATGGCCTAAGG + Intergenic
1158435326 18:57431245-57431267 TTACACGTGCAGATGGACAGTGG - Intergenic
1159499027 18:69244952-69244974 ATACAGATGCAGATGGACACAGG + Intergenic
1166653323 19:44591818-44591840 GTATACATCCAGATGGCCTAAGG - Intergenic
1167556100 19:50196650-50196672 ATAAACATACAGATGGACAGAGG - Intronic
1168476094 19:56676406-56676428 CTGTACTTGGAGATGGAGAAAGG - Intergenic
925512226 2:4640887-4640909 CATGGCATGCAGATGGACAATGG - Intergenic
927356629 2:22181103-22181125 CCATACATGTACATGGAAAAGGG + Intergenic
929383198 2:41377861-41377883 ATATACATCCAGATGGCCAGAGG + Intergenic
930347147 2:50198061-50198083 ATAAAGATGCAGATGGATAATGG - Intronic
933463305 2:82617277-82617299 CTAGACATTCATATGGAAAAGGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938690398 2:133783145-133783167 CTATACATGAACAAGGGCAAGGG + Intergenic
941714320 2:168748141-168748163 CTGTACACTCAGATGGCCAATGG + Intronic
943137856 2:183937845-183937867 TCATACATGCAGGTGGATAATGG - Intergenic
944314685 2:198271679-198271701 CTATAAATTCATATGGGCAATGG + Intronic
946276794 2:218637688-218637710 CTATAGATACAGGTAGACAAAGG + Intergenic
946680980 2:222215705-222215727 CTACACATGCAGGAGGAAAAAGG - Intronic
946946467 2:224827507-224827529 CTATACAAGCAGATGCATACTGG + Intronic
947481551 2:230505105-230505127 CCAAACTTGCATATGGACAATGG + Intronic
948084004 2:235231281-235231303 CTAAAGATTCAGATGGCCAAGGG - Intergenic
1172974761 20:38897877-38897899 GAAGACATACAGATGGACAACGG - Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177571103 21:22888288-22888310 ATTAACATGCATATGGACAAGGG + Intergenic
1178193423 21:30314267-30314289 ATATAAAGACAGATGGACAATGG - Intergenic
1178238906 21:30876506-30876528 CTATCCATGTAGATAGATAAAGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179106508 21:38405381-38405403 GTATGCATGGAGATGGACAGGGG - Intronic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
953254079 3:41272480-41272502 CATTACATGCAGAGGAACAAAGG - Intronic
954786892 3:53100075-53100097 CTATTCATGCTGATGAAAAAAGG - Intronic
955663733 3:61328379-61328401 GGAGACAAGCAGATGGACAATGG - Intergenic
956396416 3:68831325-68831347 CTAAACATGGAAAGGGACAACGG - Intronic
956578306 3:70780776-70780798 ATATTGAGGCAGATGGACAAGGG + Intergenic
959029772 3:101285149-101285171 CTATAAATGCAGATGTGTAAGGG + Intronic
960663410 3:120086261-120086283 TAATAAATGTAGATGGACAATGG + Intronic
960827408 3:121804730-121804752 ATAAACATGCAGATGCAAAAAGG - Intronic
962156560 3:132954532-132954554 CTATACATGAAGATAGACTTTGG + Intergenic
964175125 3:153818711-153818733 CTTTACATGCAGATTCACCAGGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964501925 3:157357469-157357491 CTTACAATGCAGATGGACAAAGG - Intronic
965380275 3:167979950-167979972 GTAAACATGGAGATGAACAAAGG - Intergenic
967587470 3:191232961-191232983 CTATACGTGTAGATGGGAAAGGG - Intronic
969694916 4:8729108-8729130 CTAGACAGACAGATGGACACTGG + Intergenic
969894923 4:10294687-10294709 CTATACATGCTGACTGACAGGGG - Intergenic
972426563 4:38938491-38938513 GTATACAAGCAGAATGACAAGGG + Intronic
974295353 4:59992083-59992105 ATATACATGCAGATAAAAAATGG + Intergenic
977528443 4:98172332-98172354 TTATAGATGCAGATAAACAAAGG - Intergenic
979009471 4:115349235-115349257 ATAAACATGCAGATGAAAAAGGG + Intergenic
980744052 4:136992389-136992411 TTATACATAGAGATAGACAATGG - Intergenic
983722805 4:170878027-170878049 CTATACAACAAAATGGACAAGGG - Intergenic
985185245 4:187307407-187307429 CTCTCCATGCAGATGCACACAGG + Intergenic
985586913 5:745193-745215 CCATACGTGCAAATGGACAAAGG - Exonic
985601488 5:837375-837397 CCATACGTGCAAATGGACAAAGG - Exonic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
989456484 5:41650045-41650067 CTATCTTTGCAGATGGACAGAGG + Intergenic
997689425 5:135815673-135815695 CTACAGATGCACATGGACACAGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999216722 5:149941567-149941589 CTTTACATGCGGAGGCACAATGG - Intronic
999793306 5:154963921-154963943 CCATACATGCAGAGGCACATAGG + Intronic
1000936816 5:167312086-167312108 CAATATATGCATATGGTCAAGGG - Intronic
1006564863 6:34946746-34946768 CTGTACCTGCATATGCACAAAGG + Intronic
1007323966 6:41046377-41046399 CTATAAATACTGATGGACAGAGG + Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1014136652 6:117897175-117897197 CAATACATGTAGATGTACATTGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1019106384 6:169671020-169671042 CTATACATGAGGGTGGACATGGG - Intronic
1021948911 7:25754975-25754997 CTATCCATGCAGATGGCAAAGGG - Intergenic
1022637373 7:32149783-32149805 TGATACATGCACATGGAAAAGGG - Intronic
1027850374 7:83444376-83444398 CTACACATTCAGGTTGACAAAGG - Intronic
1028084641 7:86621126-86621148 CTATACCTGAAGGTGTACAATGG + Intergenic
1033799424 7:144882459-144882481 CTTTAAATGTACATGGACAATGG - Intergenic
1035122611 7:156580827-156580849 CAATACATGTAGCTGGACAGAGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1042817486 8:72893553-72893575 CTATACATGGAGATTGAATATGG - Intronic
1043880757 8:85539770-85539792 CTTTACATGAAGAAAGACAAAGG + Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1049486919 8:142870193-142870215 CAATACATGCAGATGCATCAGGG - Intronic
1051751314 9:20344748-20344770 ATATAAATGCAGATTGATAATGG - Exonic
1053078023 9:35151546-35151568 CTGTACATCCAGATGGACTGAGG - Intergenic
1054725224 9:68643195-68643217 CTATATATGCATATTAACAATGG - Intergenic
1057203845 9:93158948-93158970 CTATCCACACGGATGGACAAGGG + Intergenic
1057338911 9:94181636-94181658 CCATTCATGAAGATGGAAAAAGG + Intergenic
1059103932 9:111495196-111495218 CTATATATGCTGATGGTCACTGG + Intergenic
1062195991 9:135274443-135274465 ATATACATGCCTATGAACAAAGG + Intergenic
1185531098 X:819845-819867 GTGTAGACGCAGATGGACAAGGG - Intergenic
1186585068 X:10864661-10864683 GTATAGATGTAGATGAACAATGG - Intergenic
1190089169 X:47422468-47422490 CTATAAATAAAAATGGACAAAGG + Intergenic
1190651000 X:52568704-52568726 CCATACATGCAGATTAATAAAGG + Intergenic
1194182617 X:90732794-90732816 ATAGACATGCAGAGGGAGAATGG - Intergenic
1197260434 X:124311769-124311791 CCATACAGGCAGAGTGACAAGGG + Intronic
1197880236 X:131158786-131158808 CTCTCCATGCAGGTGGATAAAGG - Intergenic
1198442694 X:136679346-136679368 ACATATTTGCAGATGGACAATGG + Intronic
1199472687 X:148212224-148212246 CTATACATCCAGTTGTCCAATGG + Intergenic
1199859660 X:151789882-151789904 CTATAGACAGAGATGGACAAAGG + Intergenic
1200529242 Y:4314747-4314769 ATAGACATGCAGAGGGAGAATGG - Intergenic