ID: 906339886

View in Genome Browser
Species Human (GRCh38)
Location 1:44970153-44970175
Sequence AGTTATGTTTTTTCACTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 496}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906339886_906339890 28 Left 906339886 1:44970153-44970175 CCTTTAAGTGAAAAAACATAACT 0: 1
1: 1
2: 3
3: 44
4: 496
Right 906339890 1:44970204-44970226 CCTATAAGCACATGTGATGGAGG 0: 1
1: 0
2: 0
3: 9
4: 114
906339886_906339888 25 Left 906339886 1:44970153-44970175 CCTTTAAGTGAAAAAACATAACT 0: 1
1: 1
2: 3
3: 44
4: 496
Right 906339888 1:44970201-44970223 TATCCTATAAGCACATGTGATGG 0: 1
1: 0
2: 0
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906339886 Original CRISPR AGTTATGTTTTTTCACTTAA AGG (reversed) Intronic
901103798 1:6739731-6739753 AGGTATATTTTTGCACTAAATGG - Intergenic
901172071 1:7266466-7266488 ACTTATGTTTCTTCAATAAATGG - Intronic
903611032 1:24612874-24612896 AGCTATTTTTTTTCTTTTAAAGG - Intergenic
903795319 1:25924346-25924368 AGTTAGGTTTTTCTTCTTAAAGG - Intergenic
903795321 1:25924379-25924401 TTTTTTTTTTTTTCACTTAAAGG - Intergenic
904220396 1:28962975-28962997 ATTTATATTTTTTCTTTTAATGG + Intronic
904435090 1:30489779-30489801 AGTTATTTCTGTTCATTTAAAGG + Intergenic
904894861 1:33807989-33808011 AGTAATGTTTTTAACCTTAAAGG - Intronic
906339886 1:44970153-44970175 AGTTATGTTTTTTCACTTAAAGG - Intronic
906860274 1:49351957-49351979 ATTTGTGTTTTTTCATTAAAAGG + Intronic
906879148 1:49571325-49571347 AGGTATTTTTTTTCAGTTATAGG + Intronic
907895793 1:58689789-58689811 AATAATGTTTTTTCAATTATAGG + Intronic
908213046 1:61921150-61921172 AGTTATGTCTTTTTTCCTAATGG - Intronic
908277609 1:62491806-62491828 TGCTACGTTTTTTAACTTAAAGG + Intronic
908564830 1:65343708-65343730 ACTTTTGCCTTTTCACTTAAAGG - Intronic
908614365 1:65901811-65901833 AGTTATGTTTTTTCTTCTGATGG + Intronic
909251888 1:73368396-73368418 ATTTATTTTTTTTCATTTTAAGG + Intergenic
909740102 1:79018388-79018410 ACTTTTTTTGTTTCACTTAAGGG + Intergenic
909781450 1:79552413-79552435 AATTATTTATTTTCACTTATCGG + Intergenic
910695511 1:90010284-90010306 AATTATGTTTTCTTACTTACTGG - Exonic
911507792 1:98775104-98775126 ACTTCTACTTTTTCACTTAAAGG + Intergenic
911729222 1:101275323-101275345 ATTTGTGTTGTTTCAGTTAATGG - Intergenic
911768197 1:101704677-101704699 TGTTATGTTTTTTCATAAAAAGG - Intergenic
911821192 1:102425416-102425438 AATTATGTTATTTGGCTTAACGG - Intergenic
911930683 1:103899704-103899726 ACTTATATTTTTTCATATAAAGG + Intergenic
914890227 1:151615063-151615085 AGTAATGTTTTTTCTCTAGAAGG - Intronic
916288506 1:163137514-163137536 AGTTATTTTTTATTACTTTATGG - Intronic
916386193 1:164273243-164273265 AGTTTTACATTTTCACTTAAAGG - Intergenic
916926682 1:169528607-169528629 AGTCATGTTTATTCTCTTATTGG + Intronic
916971193 1:170018523-170018545 ATTTATGATTTTTCAATCAAAGG + Intronic
917302753 1:173594154-173594176 AGTCATCTTTTTTCATTTAGTGG - Intronic
917843636 1:179002668-179002690 AGTCATGTTGTTTCACTGAGAGG - Intergenic
917912533 1:179665200-179665222 TGTTTTTCTTTTTCACTTAATGG + Intronic
919202728 1:194378291-194378313 TGTTATGATTTTACACTTACTGG - Intergenic
919728075 1:200896536-200896558 AATTATTTTTTTTAACTTTATGG - Intronic
920081700 1:203379536-203379558 AGTTAGGTCATTTCACTTGAGGG - Intergenic
921461994 1:215439155-215439177 TTTTATGTTTTTTGACTTACAGG + Intergenic
921603386 1:217131732-217131754 AATTCTATTTCTTCACTTAAGGG + Intronic
922323522 1:224508431-224508453 AGATGTGATTTTTAACTTAATGG + Intronic
923089333 1:230727523-230727545 ACTTAAGTTTTCACACTTAATGG - Intergenic
924119153 1:240778866-240778888 GCTTATGTTTATTCACTTTATGG + Intronic
1063066953 10:2619941-2619963 ACTTCTGCATTTTCACTTAAAGG + Intergenic
1063734385 10:8735771-8735793 AGTTATGTTTTTTCCAGTAACGG - Intergenic
1063999863 10:11654531-11654553 AGATAGGTTTTTTCACATATGGG - Intergenic
1064538432 10:16381920-16381942 AGTTTTATTCTTTCTCTTAAAGG - Intergenic
1065023623 10:21520796-21520818 AGTTATTTTTTTTTAACTAAGGG + Intronic
1065708573 10:28493958-28493980 AATTAAGTTTCTTCTCTTAAGGG - Intergenic
1066114586 10:32228234-32228256 ATTTTTTTTTTTTCCCTTAACGG - Intergenic
1066160880 10:32726676-32726698 AGATTTGTTTTTTCATTTAGCGG + Intronic
1068048860 10:51923078-51923100 CGTTAGGTTTATGCACTTAAAGG + Intronic
1068054984 10:52001361-52001383 AGTTATGTTTTTTTTTTTTATGG - Intronic
1068760646 10:60705001-60705023 AGCTATGTTTTGTCCCTGAATGG - Intronic
1068917617 10:62449372-62449394 AGTTCTGTTTCTTGACCTAATGG + Intronic
1069277781 10:66613759-66613781 ATTTATTTCTTTTCACTTCAGGG - Intronic
1070042667 10:72797029-72797051 AGTTTTGTTTTTTAATTTCAGGG + Intronic
1071143713 10:82542418-82542440 ATTTATCTTGTTTCACTTACTGG - Intronic
1071323150 10:84484883-84484905 AATTATGTTTTTTCGGTTATTGG - Intronic
1072085170 10:92072162-92072184 GGGTATGTTTTTTCATTTAAAGG - Intronic
1072320941 10:94249416-94249438 AGTTTTTTTTTTTAACTTTAGGG - Intronic
1072467266 10:95677193-95677215 AGATATATTTTTTAATTTAAAGG + Intronic
1073746545 10:106475139-106475161 ACAGATGTTTTTTCACTAAATGG + Intergenic
1073778270 10:106809809-106809831 TGTTTTGTTATTTCACTTTAAGG + Intronic
1075035363 10:119062195-119062217 AATTTTTTTTTTTCTCTTAAAGG - Intronic
1075876150 10:125807393-125807415 AGTGATGTTTTTCTACTTACTGG + Exonic
1077764811 11:5146611-5146633 TCTTATGTTTTTACACTTTATGG + Intergenic
1078033556 11:7779774-7779796 AGCTTTGTTATTTGACTTAAAGG + Intergenic
1078346080 11:10549784-10549806 TGTTATGTTCTTTAACTTGACGG + Intergenic
1079931235 11:26564502-26564524 AGTTATTTTTTTTCATTTTATGG + Intronic
1080229359 11:30001264-30001286 TGTTATGTTTATTTGCTTAAGGG - Intergenic
1080530454 11:33170172-33170194 AGTAATGATTTTTCTCTTAAAGG + Intergenic
1081498576 11:43642441-43642463 AGTCATTTTTTTTCTTTTAACGG - Intronic
1086107965 11:83168021-83168043 TGTTATGTTTTTTCCCTTTAAGG + Intronic
1086492692 11:87371240-87371262 ACTAATGTTTGTTCACTAAAAGG + Intergenic
1087104969 11:94399761-94399783 TGTTATATTTTTTCATTTTATGG - Intronic
1087462235 11:98459696-98459718 ATTCATGTTGGTTCACTTAACGG + Intergenic
1087984876 11:104665403-104665425 ACTTTTGATGTTTCACTTAAAGG + Intergenic
1088080493 11:105906284-105906306 AAATATGTTTTCTCACTTACAGG - Intronic
1088106295 11:106210249-106210271 AGATATCTTTTATCAGTTAAAGG + Intergenic
1089916512 11:122162181-122162203 AGATGTGTTCTTTCACTTCAAGG - Intergenic
1091012457 11:132016100-132016122 AGTTTTTTTTTTTCACGCAAGGG + Intronic
1091371780 11:135066415-135066437 AGTTAAGTTTCTTCATTTGAAGG + Intergenic
1091425330 12:382991-383013 AGTTTTTTTTTTTCACATTAGGG + Intronic
1092189724 12:6510321-6510343 AGTTATGTGTGTTCACTGTAAGG + Intronic
1093237902 12:16634676-16634698 AAGTATTTTTTTTCCCTTAAGGG + Intergenic
1094386636 12:29901614-29901636 GATTATGTTTTGTAACTTAAAGG - Intergenic
1094768031 12:33619927-33619949 AATTATATTTTTTCACTGAGGGG - Intergenic
1095044634 12:37488243-37488265 CATTATTTTTTTTCATTTAAAGG - Intergenic
1095195819 12:39315373-39315395 TGTTATTTTTTTTCATTTTATGG - Intronic
1095648713 12:44581127-44581149 AGTTTTATTTATTCACTGAAAGG - Intronic
1095859099 12:46895079-46895101 AGTTATTTTTTGGCACTTAGTGG - Intergenic
1097502660 12:60425372-60425394 GGTTGTGTTTTTTCACTCAAAGG + Intergenic
1097540324 12:60935214-60935236 ACTTTTGTTTTTTCCCTTGAGGG + Intergenic
1097627312 12:62016409-62016431 AGTTAAGCTTTTTAACTTGAGGG - Intronic
1097991629 12:65841150-65841172 ATATATGTTTTTTTTCTTAACGG + Intronic
1098152659 12:67563667-67563689 AGTTATGTTTTCTCCCAGAAAGG + Intergenic
1098503656 12:71224035-71224057 AGCTATGTTTTATCAGTTTATGG - Intronic
1098784074 12:74727460-74727482 CTTTATGTTTTTACACTTAAAGG + Intergenic
1098962367 12:76752309-76752331 TGTTACATTTTTTAACTTAAAGG - Intergenic
1099151149 12:79115569-79115591 ATTTTTGATATTTCACTTAAGGG - Intronic
1099271389 12:80514823-80514845 AGTGATGCTTTTTCAGATAATGG + Intronic
1099691810 12:85964501-85964523 AATTATGATTTTAAACTTAAGGG + Exonic
1100555861 12:95693278-95693300 AGATATGTTTTTTTTTTTAAAGG + Intronic
1100683761 12:96961740-96961762 GCATATGTTTTTTCACTTTATGG - Intergenic
1100731669 12:97477676-97477698 AAGTATGTTTGTTCCCTTAAAGG - Intergenic
1101090009 12:101275595-101275617 AGTTCTGCCTTTTCCCTTAACGG - Intergenic
1101369015 12:104107739-104107761 AGGTTTGTTTTTTTTCTTAAAGG + Intergenic
1101537710 12:105634518-105634540 AGATAGCTTTTTTCATTTAAAGG + Intergenic
1101630539 12:106489312-106489334 AATATAGTTTTTTCACTTAATGG + Intronic
1101749213 12:107569483-107569505 AATTGTTTTTGTTCACTTAAAGG - Intronic
1102783209 12:115583496-115583518 ATCTATATTTGTTCACTTAATGG - Intergenic
1104297004 12:127525249-127525271 AGTTTTCTTTTTTTAATTAAGGG - Intergenic
1106282013 13:28282896-28282918 ATTTATTTATTTTGACTTAATGG + Intronic
1107150189 13:37102066-37102088 AATTATGTTTTTCCACTAAAAGG - Intergenic
1107180832 13:37456805-37456827 AATCATGTTTTTTCACATATGGG - Intergenic
1107576364 13:41727034-41727056 AGATATTTTTCTTCACTAAAAGG + Intronic
1108762416 13:53584875-53584897 AGTTTTTTTTTTTTACTTAAAGG - Intergenic
1109234785 13:59802565-59802587 AGTTTTTTTTTTTTACTTCATGG + Intronic
1109399016 13:61800128-61800150 AGGTATGATTTTTAACTTGAGGG + Intergenic
1109582290 13:64357052-64357074 ATTTATGTTTTTTCACCTCATGG + Intergenic
1110012909 13:70361874-70361896 ATTTATTTTTTATTACTTAATGG - Intergenic
1110043814 13:70802344-70802366 AGCTATGTCTTTTCTCATAACGG - Intergenic
1110301742 13:73936781-73936803 AGAGATGTTTTTTCACATATTGG - Intronic
1110821271 13:79919815-79919837 AATAATTTTTTTTCATTTAAAGG + Intergenic
1111342502 13:86905619-86905641 AGATAAGTATTTTCACATAAAGG - Intergenic
1111613645 13:90637804-90637826 AGTTAAGTCTTTTCAGTTGATGG + Intergenic
1112304857 13:98264606-98264628 ACTTCTGCTTTTTCACTTAAAGG - Intronic
1112453031 13:99529853-99529875 AGTTATTTTTATTCACATACAGG + Intronic
1112525508 13:100142974-100142996 ATTTATGTTTTTTCACATTTTGG + Intronic
1112883269 13:104135530-104135552 ATTTATGTTTCTCCACTAAATGG + Intergenic
1116095875 14:40366763-40366785 AGTTTCTTTTTTTCCCTTAAAGG + Intergenic
1116098104 14:40398288-40398310 AATTTTGTTTTTCCACTTTAGGG - Intergenic
1116365173 14:44051696-44051718 TTTTATCTTTTTTCCCTTAAGGG - Intergenic
1116539893 14:46088781-46088803 AGTTATTTTTTTTCAATGAATGG + Intergenic
1117282300 14:54253174-54253196 AAATATGTTTTTCCAGTTAATGG - Intergenic
1117756167 14:58976420-58976442 TGCTTTTTTTTTTCACTTAATGG - Intergenic
1118665479 14:68064583-68064605 ATTAATATTTGTTCACTTAATGG + Intronic
1119928849 14:78524641-78524663 AGTGATGTGTTTTAACTTGAAGG - Intronic
1120051521 14:79872470-79872492 AGTCATGCTTTTTAAATTAATGG - Intergenic
1120801985 14:88700569-88700591 AGTCATGCTTTTCCACTGAAGGG - Intronic
1122001993 14:98666327-98666349 TGTTATTTTTTTTCACCTCAAGG + Intergenic
1122714975 14:103690871-103690893 AGTCATGGTTCTCCACTTAAAGG - Intergenic
1122759166 14:104008470-104008492 AGTTAAGTTTTTTGACCAAATGG + Intronic
1123675489 15:22707241-22707263 ATTTGTGTATGTTCACTTAAGGG + Intergenic
1124387301 15:29220805-29220827 AGTTTTTTTTTTTCCCTAAAAGG - Intronic
1125188249 15:36957994-36958016 AGTAATGTTTTTTAATTTAATGG + Intronic
1125196248 15:37050253-37050275 AGATATGGTTTTTGACTTGAAGG - Intronic
1125876545 15:43152102-43152124 TGATATGCTTTTTAACTTAATGG - Intronic
1126010016 15:44293849-44293871 AGTTATGTTTTTCCTCCTTAAGG + Intronic
1126332072 15:47543677-47543699 AATTATTTTTTTTCACTGAAGGG + Intronic
1126403780 15:48301889-48301911 ATGTATGTTTGTTTACTTAAAGG + Intronic
1126998283 15:54471582-54471604 AGTTAGGTCTTTTCACCTTATGG - Intronic
1127207643 15:56736985-56737007 AGTTCTTTTTTTTCTCTGAATGG + Intronic
1127750422 15:62035121-62035143 TTTTATGCTTTTTCGCTTAATGG - Intronic
1127824144 15:62689242-62689264 AGTAAGGTTTCTACACTTAAGGG - Intronic
1127938242 15:63665146-63665168 AGCAATCTTTTTACACTTAAAGG + Intronic
1127960876 15:63889866-63889888 ACTTTGCTTTTTTCACTTAAGGG - Intergenic
1128005896 15:64240303-64240325 ATGCATGTTTGTTCACTTAATGG - Intronic
1128487565 15:68109946-68109968 ATTTAAGTTTTTTAACTTAATGG - Intronic
1129559143 15:76547600-76547622 AGTTCTGCTTTTTCACATATAGG + Intronic
1130197094 15:81790047-81790069 ACCAATCTTTTTTCACTTAATGG + Intergenic
1131502807 15:92986414-92986436 AGGTGTTTCTTTTCACTTAAAGG + Intronic
1131941037 15:97565621-97565643 AGTTATTTCTTTTCTTTTAAAGG + Intergenic
1132248094 15:100312870-100312892 ATTTATGTATTATTACTTAATGG - Intronic
1132610268 16:812478-812500 AATTATGTTTTTTCATGTGAAGG - Intronic
1135832886 16:25793545-25793567 AATTATGTTTCTTGCCTTAAAGG + Intronic
1137022030 16:35437724-35437746 AGTTATGTTTTTGCCCATCAAGG - Intergenic
1137991201 16:53157650-53157672 AAATATGTATGTTCACTTAATGG - Intronic
1139333967 16:66217858-66217880 ATTTATGTATATTAACTTAATGG - Intergenic
1140134348 16:72192303-72192325 AGGTATTTTGTTTCACCTAATGG + Intergenic
1143755305 17:9062870-9062892 TATTATTTTTTTTTACTTAAGGG - Intronic
1144027923 17:11294855-11294877 ACTTTTGTGTTTTCACTTTAAGG + Intronic
1146209906 17:30933987-30934009 TGTGATGTCTTTTCACTTCAGGG - Intronic
1146966026 17:37030678-37030700 AGTTGTGTTTCTCCATTTAAAGG + Intronic
1147510174 17:41061567-41061589 ACTTATTTTATTTCACTAAAGGG - Intergenic
1148919181 17:51014795-51014817 ATTTATGTTTTTAACCTTAAAGG - Intronic
1149758985 17:59211990-59212012 TCTTATTTTTTTTCATTTAAAGG + Intronic
1149801355 17:59571038-59571060 ATTTATGTTTTTTAACTGTAAGG + Intronic
1150325944 17:64257783-64257805 AGTTTGACTTTTTCACTTAAAGG - Intronic
1151264584 17:72944840-72944862 TCATATGTTTTTGCACTTAACGG - Intronic
1153916552 18:9750756-9750778 AAGTATGTTTCTTCACTTAGTGG - Intronic
1154066917 18:11115906-11115928 ATTTATATTTTATCATTTAAAGG - Intronic
1155212773 18:23617337-23617359 GCTTATTTTATTTCACTTAAGGG + Intronic
1155846070 18:30708456-30708478 AGCTATGTTGTTTCACATATAGG - Intergenic
1156411795 18:36836292-36836314 AAAAATGTTTTTTCACATAATGG + Intronic
1156637795 18:39051853-39051875 AGTTTTATTTTTTCAATTATAGG - Intergenic
1157000668 18:43519611-43519633 AGGTTTGTTTTTTCAATTAAAGG + Intergenic
1157064087 18:44326740-44326762 ATTTGTCTTTTTTTACTTAAGGG - Intergenic
1157321496 18:46638212-46638234 AGTGTTGTTTTTTCAAGTAATGG + Intronic
1157988577 18:52468068-52468090 AGTTATGTTCATTCATTCAAAGG + Intronic
1158199437 18:54923630-54923652 AGATATATTTTTACATTTAAAGG - Intronic
1158281850 18:55836896-55836918 ACTTAAGTGATTTCACTTAAAGG - Intergenic
1158508013 18:58063890-58063912 ACTGATGTTTTTTCTCTAAAGGG - Intronic
1159254281 18:65925847-65925869 CTTTATTTTTTTTCACTTACTGG + Intergenic
1159563551 18:70022447-70022469 AGGCATGTTTATTAACTTAAGGG - Intronic
1159930174 18:74303982-74304004 CTTTTTTTTTTTTCACTTAAAGG + Intergenic
1160103839 18:75949796-75949818 ATGTATATTTATTCACTTAATGG - Intergenic
1165168552 19:33873834-33873856 ATTTATATTCTTTCATTTAATGG - Intergenic
1165818994 19:38662589-38662611 AGTTTTGTTTTTGTATTTAAGGG - Intronic
1168058207 19:53875307-53875329 ATATATGTTTTTTAATTTAAAGG - Exonic
925252945 2:2456778-2456800 AGGTATGTTTTATAATTTAAAGG - Intergenic
926282601 2:11462526-11462548 ACTTAGATCTTTTCACTTAAAGG + Intronic
926660556 2:15461110-15461132 AATTATTTTTTTTAACTTTAAGG + Intronic
927648025 2:24891567-24891589 AATTTTTTCTTTTCACTTAAAGG - Intronic
928094678 2:28396628-28396650 TGTTTTGTTTTTTCATTAAAAGG - Intronic
928502491 2:31911802-31911824 AGTTATTTTTTTTTACTTTTTGG + Intronic
928612892 2:33008387-33008409 AGAAATGTTAATTCACTTAAGGG - Intronic
928638406 2:33271970-33271992 AGTTATGTTAATTCACTTTCAGG - Intronic
929250909 2:39754023-39754045 TTTTATGTATTTTCACTTTAGGG - Intronic
929261575 2:39872100-39872122 ATTTATGTTTGTTCAAATAACGG - Intergenic
930328340 2:49949267-49949289 TGTTATTTTTTCTCACTTATAGG + Intronic
930446064 2:51473944-51473966 ACTTTTGCCTTTTCACTTAAAGG + Intergenic
930709062 2:54532985-54533007 ACTTTTACTTTTTCACTTAAAGG + Intronic
932258542 2:70307654-70307676 ATTTATATTTTTTCCCTTTATGG + Intergenic
933276870 2:80293539-80293561 ACTTGTGTTGTTTCATTTAAGGG + Intronic
933360472 2:81276534-81276556 AATCATGTACTTTCACTTAATGG - Intergenic
935299399 2:101680709-101680731 AGTTTTGTTTTTTCAGTTTTTGG - Intergenic
935830310 2:106995308-106995330 ATTTATTTTTATTAACTTAAGGG + Intergenic
936405732 2:112200860-112200882 ATTTATTCTCTTTCACTTAAAGG + Intergenic
937544352 2:122998792-122998814 ATTTATGTTTTGTTCCTTAAGGG + Intergenic
937938013 2:127261529-127261551 AGGATTGTTTTTTCACTTGATGG - Intronic
939142612 2:138373354-138373376 CGTTATTTTTTTTCAGTTAGTGG - Intergenic
939431801 2:142119187-142119209 TGGTATGTTTTTACACTTAAGGG - Intronic
939664204 2:144930131-144930153 AGTTATTTTTATTCACTTTGTGG + Intergenic
939793703 2:146614854-146614876 TGTTTTGTTTTTCCATTTAATGG - Intergenic
940168965 2:150806066-150806088 AATTATGTTTTTTTTTTTAAAGG - Intergenic
940482941 2:154258484-154258506 AGGTATTTTTTTTAACATAAGGG - Intronic
941148034 2:161877364-161877386 AGTTAAGTTTTCTCTCTCAATGG - Intronic
941311124 2:163933565-163933587 AGTTATGGTTTATAACTCAAAGG + Intergenic
941453329 2:165686540-165686562 ACTTAGGTTTTTCCACTTTAGGG - Exonic
941938742 2:171010264-171010286 TTTTGTGTTTTTTCACTTGAGGG + Intronic
942080929 2:172398996-172399018 GTTTATGTTTTCTCATTTAAAGG - Intergenic
943711718 2:191104095-191104117 AGATATATTTTTTCACAAAACGG - Intronic
944016208 2:195042131-195042153 AGATATCATTTTTCACTTAAAGG - Intergenic
944741858 2:202620266-202620288 TGGTTTGTTTTTTCCCTTAAAGG - Intergenic
945310213 2:208303124-208303146 ATATATGTTTTTTTACTTTAGGG + Intronic
945338378 2:208619461-208619483 AGCTATTTTTTTTCACTAATTGG + Intronic
946298589 2:218807319-218807341 AGTTTTGTTTTTTTCCTTAAAGG - Intronic
947013700 2:225593828-225593850 ATTTTTGTTTTTTCACTTAATGG - Intronic
948038300 2:234877799-234877821 ACTTGTTTTTTTTCACTTACTGG + Intergenic
1169005125 20:2200441-2200463 ATTTAGGTTATTTCACTTGAAGG + Intergenic
1169361543 20:4953934-4953956 TGTTACTTTTTTTCACTTTAAGG - Intronic
1169767910 20:9168671-9168693 GGTCATTGTTTTTCACTTAATGG + Intronic
1169776577 20:9261827-9261849 GTTTCTGTTTTTTCACTTATTGG - Intronic
1170233120 20:14072200-14072222 AGTTATGTTTTTTTCCTCTAGGG + Intronic
1170269539 20:14508979-14509001 ATTTATGTATTTGCACTCAATGG + Intronic
1171539174 20:25931856-25931878 CATTATTTTTTTTCATTTAAAGG - Intergenic
1171723153 20:28586401-28586423 TGTTATTTTGTTTCACTTAGGGG - Intergenic
1171779081 20:29402435-29402457 AGTTATGTGTTCACACTTATAGG + Intergenic
1171860194 20:30393531-30393553 TGTTATTTTGTTTCACTTAGGGG + Exonic
1171949835 20:31411520-31411542 ACTTTTCTTTTTTCACTGAAAGG - Intronic
1173560451 20:44001615-44001637 AGTTTTGTTTTTTGACTGAAAGG + Intronic
1174747090 20:53073749-53073771 AGTTTTTTTTTTTAACTTGACGG - Intronic
1176695212 21:9968958-9968980 AATTGTGTTTTTTAAGTTAATGG - Intergenic
1176939102 21:14902414-14902436 AGTTATTTTTTTCCATGTAATGG + Intergenic
1176951859 21:15057261-15057283 AGTTATGTTTGTCCACTTCAAGG - Intronic
1177092566 21:16787426-16787448 AGTTATGATGTTTCACTTTAGGG + Intergenic
1177439493 21:21102325-21102347 ACTTATATTTTTTAATTTAAAGG + Intronic
1177642607 21:23863000-23863022 AATTATGGTTTTTCAATTACAGG + Intergenic
1179068833 21:38052994-38053016 AGGTATGATTGTGCACTTAAGGG - Intronic
1180296712 22:10945051-10945073 TGTTATTTTGTTTCACTTAGGGG - Intergenic
1180411949 22:12620817-12620839 TGTTATTTTGTTTCACTTAAGGG + Intergenic
1183770242 22:39918526-39918548 AGAAATATTTTTTCAATTAAGGG - Intronic
949616792 3:5762405-5762427 ATTTTTTTTTTTTCATTTAATGG + Intergenic
950820619 3:15754462-15754484 ACTTACATCTTTTCACTTAAAGG - Intronic
952132085 3:30375981-30376003 AATTATGGTTTTTTACTTACAGG + Intergenic
953259514 3:41323987-41324009 ATTTCTGTTATTTCACTTTAAGG + Intronic
954991622 3:54845721-54845743 ATTTATGTTTTCTGACTAAATGG - Intronic
955020881 3:55119954-55119976 TAAAATGTTTTTTCACTTAATGG + Intergenic
955813423 3:62816511-62816533 AGTAATGTGTTTTCTCTAAATGG - Intronic
955827493 3:62963919-62963941 ATATATCTTTTTTCACTGAATGG - Intergenic
956420707 3:69084062-69084084 GGTCATCTTTTTTCAGTTAAGGG - Intergenic
957086064 3:75678233-75678255 AGCTATGTGTTCTCACTTATAGG - Intergenic
957172389 3:76754934-76754956 CATTGTGTTTTTTCACTTAAAGG - Intronic
957357644 3:79112991-79113013 AGTCATGTTTTATCACCAAATGG + Intronic
957379652 3:79410216-79410238 TGGTATGTATTTTCACGTAATGG + Intronic
957679854 3:83419904-83419926 AATAATGTTTTTTTAATTAAAGG + Intergenic
958010946 3:87879379-87879401 ATTAATGTTTTTTTACTTACAGG + Intergenic
958419046 3:93910583-93910605 TGTTTTGTTTTTTCAATTGATGG + Intronic
958612789 3:96448948-96448970 AATTATATTTTTTAAGTTAAAGG + Intergenic
959165991 3:102778956-102778978 AGTTAAGTTCTATCACTTAAAGG - Intergenic
959545706 3:107593746-107593768 TGTTTTGTTTTTCCACTTACAGG - Intronic
959977577 3:112479211-112479233 AGTTATTGTTTTTGACTTTAGGG - Intronic
960112052 3:113854747-113854769 AGTTATGTTTTTCCCCAAAAAGG - Intronic
960191567 3:114712673-114712695 AGTTCAGTTTGTTCACTAAAGGG + Intronic
960400061 3:117185869-117185891 CATTGTGTTTTTGCACTTAAGGG + Intergenic
960530644 3:118760189-118760211 AGATATGTTTTATCACATATGGG + Intergenic
960562364 3:119098689-119098711 AAATATGTTTTTTAAATTAATGG + Intronic
960711710 3:120536974-120536996 GGTTATTTTTATTCACTCAATGG + Intergenic
961340609 3:126214504-126214526 AGTCATCTTTTTACTCTTAATGG - Intergenic
962028662 3:131575270-131575292 AGTTAAGTTTGTTCTGTTAAAGG + Intronic
962631899 3:137285256-137285278 TGTTATTTATTTTCACTTAAAGG - Intergenic
964227323 3:154420633-154420655 AGTTTTATTTTTTCATGTAAAGG - Intronic
964256886 3:154785351-154785373 ATTTATGCTTTGACACTTAAAGG - Intergenic
964412175 3:156408856-156408878 ATTTTTTCTTTTTCACTTAATGG - Intronic
964583549 3:158268947-158268969 AATTATGTATTTTCAATGAAAGG - Intronic
964584626 3:158283535-158283557 AGTTATGTATTTTCACGAAATGG - Intronic
964617606 3:158685376-158685398 ACTAATGTATTTTCACATAAAGG - Intronic
964787444 3:160413736-160413758 AGTTTTTTTTTTTCACTAAGGGG - Intronic
965393980 3:168139651-168139673 AGCTATGTTTTTTTCCTTTATGG + Intergenic
966170699 3:177076710-177076732 AGTTTTGTTTTTTGTTTTAAGGG - Intronic
966428423 3:179805975-179805997 ATATATTTTTTTTCAATTAAAGG - Intronic
966436341 3:179888576-179888598 AGTTATGTTTCTACGGTTAAGGG + Intronic
967123795 3:186407043-186407065 TGTTTTCTTTTTCCACTTAAAGG - Intergenic
967357161 3:188584626-188584648 AATTATGTTTTTTTACTTATTGG + Intronic
967456653 3:189694706-189694728 TGTTAGGTTTTTTCACTTTGAGG + Intronic
968767483 4:2480662-2480684 AGTTATGTTTCTTGATTTAAGGG + Exonic
970060745 4:12031035-12031057 AGTTATGCCTTTTCATTTAAAGG + Intergenic
971685855 4:29766209-29766231 AGTTATTTTTCTTCTGTTAATGG + Intergenic
971913301 4:32824654-32824676 AGTCAAGTTTTATTACTTAAAGG + Intergenic
972859351 4:43148347-43148369 TGTTATTTTTTTTTCCTTAAAGG - Intergenic
973767618 4:54177953-54177975 ATGAATGTTTTTTAACTTAAAGG + Intronic
974257650 4:59481706-59481728 ATTTATGTTTCTACACTTATAGG - Intergenic
974742705 4:66027550-66027572 ACTTTTTTTTTTTCAATTAATGG + Intergenic
976306993 4:83569964-83569986 AGTTATCTTTCTTCCCTCAAAGG + Intronic
976432562 4:84980058-84980080 AGTTGTGGTTTTATACTTAAAGG - Intergenic
976682886 4:87776791-87776813 AGTTTTATTTTTGCATTTAATGG - Intergenic
977453419 4:97226958-97226980 AGTTATTTTTCTCCACTAAAAGG + Intronic
978062903 4:104360114-104360136 AGATATATTTATTCACTTAGTGG - Intergenic
978177346 4:105748326-105748348 TGTTTTGTTTTTTCACTTTCTGG + Intronic
978202818 4:106042927-106042949 AGTTATGTCTTGTCATTTCATGG + Exonic
978894926 4:113875127-113875149 CGTTATGTTTTTTCTCTTCTTGG + Intergenic
979107700 4:116708322-116708344 AGTTTAGTTTTTTAAATTAAAGG + Intergenic
979427033 4:120580573-120580595 AGTTTTTTTTTTTTTCTTAAAGG + Intergenic
979755188 4:124331540-124331562 TGTAATGTTTTTTCACTTGTTGG - Intergenic
979935863 4:126694592-126694614 AGTTATGTGTTTTCCCTTAGAGG + Intergenic
979963549 4:127050165-127050187 AGTTATGTTCTTTGCCTTCAAGG - Intergenic
980586215 4:134818929-134818951 ATTTTTTTTTTTTTACTTAATGG + Intergenic
980961011 4:139475679-139475701 AATTATTTATTTTCAATTAAAGG - Exonic
981317989 4:143360376-143360398 AGTTTTGTTTTTTGAACTAAAGG + Intronic
981358264 4:143817713-143817735 AATTATTTTTTTTGACTTCAAGG + Intergenic
981369515 4:143943832-143943854 AATTATTTTTTTTGACTTGAAGG + Intergenic
981516433 4:145614755-145614777 AGCAATGTTTTGTCACTTTAGGG + Intergenic
981582083 4:146260082-146260104 AGTTAAGTGTTTTCAGTTTATGG - Intronic
981594981 4:146409809-146409831 AGTTATGTGTTTACTTTTAATGG + Intronic
981709281 4:147692907-147692929 AGTTGTGTTTTTTCATTGATGGG + Intergenic
982212451 4:153049784-153049806 ATTTATCTTTTTTCATTTGAAGG + Intergenic
982285530 4:153729852-153729874 ATTTTTGTTTTTTAACTTCAAGG + Intronic
982343319 4:154328583-154328605 AGTTTTGTTTTCTGAATTAAAGG - Intronic
982546359 4:156738004-156738026 AGTTATGGTTTGTAACTTGAAGG + Intergenic
982903084 4:161031623-161031645 AATTAAGTTTTTTAGCTTAAAGG + Intergenic
982936914 4:161490884-161490906 TGCTATGTTTTATCAATTAAAGG + Intronic
983289091 4:165778660-165778682 AGCTATCTTTTTTAATTTAAAGG + Intergenic
983779046 4:171644970-171644992 AGTTTTGTTTTTTCACCTAAGGG - Intergenic
983982832 4:174019980-174020002 AGTCATGCATTTTCACTGAAGGG - Intergenic
984107695 4:175570745-175570767 AGTATTGATTTTTCACCTAAGGG + Intergenic
985561521 5:588982-589004 AGTTATGCTTTTTCTCTTTCGGG - Intergenic
985837769 5:2283114-2283136 TGTTTTGTTTTTGCACTTACAGG + Intergenic
986017621 5:3771458-3771480 TTTTATTTTTGTTCACTTAAAGG - Intergenic
986184958 5:5426507-5426529 CATTATGTTCTGTCACTTAAAGG + Intronic
986340229 5:6782785-6782807 TTTTATGTTTTTTCCCTTATTGG + Intergenic
987167674 5:15218369-15218391 AGATTTTTTTTTTTACTTAAAGG + Intergenic
987378462 5:17260114-17260136 TGTTATTTATTTGCACTTAACGG - Intronic
987839785 5:23208707-23208729 AATTATGTTTGTTTACTTATAGG + Intergenic
988179066 5:27766362-27766384 AGTGAAGAATTTTCACTTAAAGG + Intergenic
989187828 5:38642192-38642214 AGTTATTTTTATTCATTTAAGGG + Intergenic
989728328 5:44616308-44616330 ATTTATGTTTTTCCACATAGAGG - Intergenic
990153134 5:52843179-52843201 AATTATGTTTTTACAGTGAATGG - Intronic
990178306 5:53131782-53131804 AGTTGTTTTTTTACATTTAATGG - Intergenic
990701400 5:58478746-58478768 AGTTATTATCTTTCTCTTAAGGG + Intergenic
991122270 5:63030298-63030320 AGGTCTGTTTTTTCACTTAGTGG - Intergenic
991150104 5:63357796-63357818 AGTTAAGTAATTTCTCTTAAGGG + Intergenic
991457511 5:66820245-66820267 AGGTATATCTTTTCACTTTAGGG + Intronic
991711562 5:69413887-69413909 AGTTTTGTTTTTATAGTTAAAGG + Intronic
992237781 5:74729755-74729777 TGTCATGTTTTTTGGCTTAAGGG + Intronic
992283452 5:75206560-75206582 AATTTTTCTTTTTCACTTAAAGG + Intronic
992483903 5:77177564-77177586 ACTTTTATCTTTTCACTTAAAGG + Intergenic
992917294 5:81470340-81470362 AGTTTTGTTTTTTTATTGAAAGG + Intronic
993049147 5:82905951-82905973 AGTTATGTTTTTTCTCTTAATGG - Intergenic
993224369 5:85147944-85147966 ATTTTTGTTTATTCACTTTAAGG + Intergenic
993388020 5:87282827-87282849 AATTATTTTTTTCAACTTAATGG - Intronic
993468915 5:88282693-88282715 ACTTTTATGTTTTCACTTAAAGG + Intergenic
993809575 5:92458789-92458811 AGTTACATTTCTTTACTTAAGGG - Intergenic
993864623 5:93177542-93177564 AGCTATGTTTTATCATTTGAAGG - Intergenic
994174218 5:96693262-96693284 CGAAATGTTTTTTAACTTAACGG - Intronic
994289486 5:98011511-98011533 ACTTATATTTTCTCACTTACTGG - Intergenic
995294102 5:110498633-110498655 ATTTATGTGACTTCACTTAAGGG + Intronic
995869026 5:116724967-116724989 AGTAATATTTTTTCTTTTAAAGG + Intergenic
995903586 5:117096873-117096895 AATTTTTTTTTTTCACTGAAGGG - Intergenic
996237613 5:121151512-121151534 GGTTATATTTTATCACATAAGGG + Intergenic
996446970 5:123566178-123566200 AATTTTGTTTTGTCACTTAAAGG + Intronic
997016432 5:129940777-129940799 ATATATGTTTTTTCACTTTCAGG + Intronic
997784478 5:136696581-136696603 GTGTATGATTTTTCACTTAATGG - Intergenic
997970615 5:138398439-138398461 TTTTATTTTCTTTCACTTAACGG + Intronic
998722273 5:144966502-144966524 AATGATTTTTTTTCACTGAAAGG - Intergenic
998806467 5:145921891-145921913 TGCTATTTATTTTCACTTAAAGG + Intergenic
998994526 5:147856039-147856061 ACTTTTATATTTTCACTTAAAGG - Intergenic
999136975 5:149327799-149327821 ACATATGTTTGTGCACTTAATGG - Intronic
1000126948 5:158254676-158254698 TTATATGTTTTTTCATTTAATGG + Intergenic
1000457365 5:161467700-161467722 ACTTATTTTTTTCCACTTCATGG + Intronic
1000789791 5:165591368-165591390 AATAATGTTTTTTAACTAAATGG + Intergenic
1002628872 5:180554879-180554901 AGGTATGTTTTTCCAATTCAAGG + Intronic
1003343945 6:5247791-5247813 AGTAATTTTTTTTTATTTAATGG - Intronic
1003798700 6:9636241-9636263 AATGATGGTTTATCACTTAATGG - Intronic
1003836671 6:10078716-10078738 AGGTATGTTATTTCACTGAAGGG + Intronic
1004459053 6:15818462-15818484 GTATATATTTTTTCACTTAATGG - Intergenic
1004840846 6:19583183-19583205 AGTTATGTTTTTTTCCTTCTTGG - Intergenic
1005115769 6:22334734-22334756 AGTAATGTTTCTTGACTCAAGGG - Intergenic
1006212394 6:32407786-32407808 AGTTGTCTTTTTTCACTGGAGGG - Intergenic
1006927906 6:37668570-37668592 AGTTCACCTTTTTCACTTAACGG - Intronic
1007879867 6:45152840-45152862 ATATATATTTTTTTACTTAAAGG - Intronic
1008748007 6:54696847-54696869 TGCTAAGTTTTTTCACATAAGGG + Intergenic
1008759882 6:54841270-54841292 TGTTCTGTTTTTACACCTAATGG + Intergenic
1009038355 6:58145772-58145794 ATTGATGTTTTTTCACTTGTTGG - Intergenic
1009214152 6:60899429-60899451 ATTGATGTTTTTTCACTTGTTGG - Intergenic
1009543587 6:64997408-64997430 ACTTTTTTTTTTTAACTTAAAGG - Intronic
1009652270 6:66491058-66491080 TGGTATGTTTTTGCACTGAATGG - Intergenic
1010553384 6:77250832-77250854 TCTTATGTTTTCTCACTAAAAGG - Intergenic
1010603389 6:77858855-77858877 AATTATTTTTTTTCCATTAAAGG - Intronic
1011092657 6:83623382-83623404 AATTAATTTTTTTCATTTAATGG + Intronic
1012304927 6:97643022-97643044 AATTATGTTTTTTTACTTCCTGG + Intergenic
1012541062 6:100362384-100362406 GGTTTTTTTTTTTCCCTTAATGG + Intergenic
1012596047 6:101041747-101041769 AGTTATGTTGTTTCCTTAAAAGG - Intergenic
1012726466 6:102818045-102818067 AGGTTTACTTTTTCACTTAAAGG - Intergenic
1013801715 6:113953436-113953458 AGTTTTGGTTTTTCCTTTAAAGG + Intronic
1014304084 6:119718553-119718575 AGTTATGTTTTTAGGATTAAGGG + Intergenic
1014822199 6:126002933-126002955 ACTTTGCTTTTTTCACTTAATGG + Intronic
1014831448 6:126107209-126107231 ATTTATGTTTTTTCACAAGATGG + Intergenic
1015468656 6:133577054-133577076 AGTTATTTTTTTTCCCATAGGGG - Intergenic
1016826236 6:148390810-148390832 ATTTTTATTTTTTTACTTAAGGG + Intronic
1018089046 6:160329725-160329747 TGTTTTGTTTTTTCCCTCAAGGG - Intergenic
1018676923 6:166230298-166230320 TGTTTTGTTTTTTCCCTCAAGGG + Intergenic
1020352044 7:7231412-7231434 AGTTATGTCTCTTCCCTCAAAGG + Intronic
1020384417 7:7582270-7582292 AATTATGTTTTTTAACAAAAAGG - Intronic
1020664987 7:11029850-11029872 TGTTATGTTTTTTCTTTTATTGG + Intronic
1021008051 7:15424768-15424790 AGTTTTGTTTCTTTACTTCATGG + Intronic
1021172001 7:17408979-17409001 AATTATGCTTTTTTACTTGAAGG - Intergenic
1021364737 7:19763197-19763219 AGATAAATTTATTCACTTAAGGG - Intronic
1021468496 7:20973243-20973265 AGGAATTTTTTTTCCCTTAATGG + Intergenic
1022818460 7:33935675-33935697 TGTTTTGTTTTTTCATTTACTGG - Intronic
1022912554 7:34913760-34913782 AGCTATGTTTCTTGACTTCAAGG - Intergenic
1023179414 7:37466841-37466863 ATTTCTCTTTTTTCATTTAATGG - Intergenic
1023603117 7:41900189-41900211 ACTGATTTTTTTTAACTTAATGG + Intergenic
1024668935 7:51573547-51573569 AGTTTTTTTTTTTCAGTAAAAGG + Intergenic
1025141088 7:56465918-56465940 AGTTGAGAGTTTTCACTTAAAGG + Intergenic
1025153110 7:56575972-56575994 AGTTAAGCTTTTTCCCTGAAGGG + Intergenic
1025163492 7:56687670-56687692 AGTTGAGTGTTTACACTTAAAGG - Intergenic
1025626919 7:63231092-63231114 AGTTATGTTGATTTACCTAAAGG - Intergenic
1025762698 7:64409468-64409490 AGGTTTATTTTTTCTCTTAAAGG - Intergenic
1026433497 7:70371938-70371960 AAGTATGTTTTTTCTCTTTAGGG + Intronic
1027549739 7:79575332-79575354 AGGTATGTTTTTTCTTCTAATGG - Intergenic
1027941138 7:84680880-84680902 AAGTATGTTTTTTCACTAATGGG - Intergenic
1028242220 7:88435350-88435372 CTTTATGTCTTTTCATTTAAGGG - Intergenic
1028302500 7:89218133-89218155 ATTTATGTATTTTTTCTTAAAGG + Exonic
1028458710 7:91067209-91067231 AATTATGTTTTTTCATCTAATGG + Intronic
1028788360 7:94823106-94823128 AGGTATGTATTTTCATTTCAAGG - Intergenic
1028789804 7:94841253-94841275 ATTTATATTGTTTCACTTGATGG + Intergenic
1030020157 7:105266072-105266094 AATTATGTTTTTACCTTTAAAGG - Intronic
1030375506 7:108748773-108748795 AGTTATGTCTTTTTGCTAAATGG + Intergenic
1030470862 7:109960891-109960913 AGTTTTTTTTTTTAACTTTAGGG + Intergenic
1030547285 7:110912586-110912608 AGTTTTTTTTTTTTACTTCATGG + Intronic
1030622023 7:111800670-111800692 ATTTATCTTTTTTCGCCTAAAGG + Intronic
1031142462 7:117958805-117958827 AGTTATGTATTTTAATTTCATGG - Intergenic
1031204213 7:118733707-118733729 AATTATATTTGTTCATTTAATGG - Intergenic
1031228310 7:119070734-119070756 TGTTATATTTATTCACTTACAGG - Intergenic
1031572050 7:123371228-123371250 AATTATGTATTATCATTTAAGGG + Intergenic
1031785311 7:126023664-126023686 AGTAATGATTTTTCTCTTCACGG + Intergenic
1032528242 7:132596553-132596575 ATTTATGTCTTTTTAATTAATGG + Intronic
1032948658 7:136881981-136882003 ATTTATGGTGTTTCATTTAAAGG - Intronic
1033336527 7:140457787-140457809 ATATATGTTTTTTCTTTTAAAGG - Intronic
1033372669 7:140725282-140725304 ATTTATAATTTTTCAATTAATGG - Intronic
1033965815 7:146974095-146974117 AGTTATGTTGTTGCCCTGAAAGG + Intronic
1033968019 7:147002033-147002055 CCTTATGTTGTTTTACTTAATGG - Intronic
1034201673 7:149286638-149286660 GGTTCTGTTTTCTCACTTATGGG - Intronic
1034399296 7:150851455-150851477 AGTTATGTATTCTCAGTTATGGG - Intronic
1034593775 7:152167979-152168001 AGTTATATTTTTTAAAATAAGGG + Intronic
1035751450 8:1999874-1999896 AGTCATGCTTTCTCACTAAAAGG + Intronic
1035836337 8:2756871-2756893 AGTTATTTGTTTTCACTTCCTGG + Intergenic
1036539150 8:9686702-9686724 AATTATGTTTTTGCATTTCAAGG - Intronic
1037039559 8:14213919-14213941 AGTTAAGTTTTTCCACCTTAAGG - Intronic
1038188937 8:25301122-25301144 AGTTTTACCTTTTCACTTAAAGG - Intronic
1038710837 8:29943670-29943692 AGTTAATTTCTTTTACTTAAAGG + Intergenic
1038950170 8:32405182-32405204 AGTTATGTGTTCTCTCTTCAAGG + Intronic
1039404815 8:37303468-37303490 ATTTATTTTTTCTCACATAACGG + Intergenic
1039717111 8:40121601-40121623 AAATGTGTTTTTCCACTTAATGG - Intergenic
1041425038 8:57711241-57711263 AGTTCCGTTTTTTCACTTTAAGG - Intergenic
1043166403 8:76908329-76908351 AGCTATGTTTTTATAATTAAAGG + Intergenic
1043196168 8:77294843-77294865 AGTCATGTTTTATTACTTTAGGG + Intergenic
1043314321 8:78901422-78901444 AGTTATGTTTTCTTTCTTTATGG - Intergenic
1043495459 8:80796007-80796029 AGCTATGTTTCTCCATTTAAAGG - Intronic
1043659281 8:82715570-82715592 ATTTTTTTTTTTTTACTTAAAGG - Intergenic
1043719475 8:83528967-83528989 ACTTTTGCCTTTTCACTTAAAGG - Intergenic
1045048153 8:98298560-98298582 ACTTATCTTTTTACACTTTATGG - Intergenic
1045210703 8:100096114-100096136 AATTTTGTTTTTTTAATTAAAGG - Intronic
1045513454 8:102833947-102833969 AGTTGTGTTTCTGTACTTAATGG - Intronic
1046186373 8:110726359-110726381 AGTTTTGTCTTTTTACTTTATGG - Intergenic
1046427071 8:114067958-114067980 AATTATGTTTTTACACTTCATGG - Intergenic
1047983505 8:130208545-130208567 ACTTTTTTTTTTTCACTTTAAGG + Intronic
1049008167 8:139870628-139870650 ATTTTTATTTTTTCACTTAATGG - Intronic
1049996241 9:1036772-1036794 AGTAGTGTTTTTACACTTGATGG + Intergenic
1050741464 9:8825274-8825296 AGTTAAGTTTGATAACTTAAAGG + Intronic
1051518016 9:17952343-17952365 AGTTTTATTTTTTAACTTACAGG + Intergenic
1051595042 9:18816578-18816600 AATTAAATTTTTTCACTTTAAGG - Intronic
1051653147 9:19350680-19350702 AATTTTTTTTTTTCAATTAAAGG + Exonic
1052009291 9:23386862-23386884 AGTTAGGTTATTTCAATAAAAGG - Intergenic
1052708792 9:32026531-32026553 AGTTACTTTTTTTCTCTCAATGG + Intergenic
1053132321 9:35623264-35623286 AGTTATTATTTTACACTTGAAGG + Intronic
1053632190 9:39954906-39954928 AATTGTGTTTTTTAAGTTAATGG - Intergenic
1053642604 9:40099984-40100006 TGTTACGTTCTTTTACTTAAAGG - Intergenic
1053773575 9:41508629-41508651 AATTGTGTTTTTTAAGTTAATGG + Intergenic
1054165876 9:61727591-61727613 CATTATTTTTTTTCATTTAAAGG + Intergenic
1054211698 9:62295792-62295814 AATTGTGTTTTTTAAGTTAATGG + Intergenic
1054339002 9:63837830-63837852 TGTTATTTTGTTTCACTTAGGGG - Intergenic
1054479905 9:65652677-65652699 TGTTATTTTGTTTCACTTAGGGG - Intergenic
1054542157 9:66276645-66276667 TGTTACGTTCTTTTACTTAAAGG + Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055050867 9:71979148-71979170 ATTTATGTTGTTTCATTTTAAGG - Intronic
1055131916 9:72785476-72785498 ACTTTTGCCTTTTCACTTAAAGG + Intronic
1055656748 9:78457990-78458012 AGTTATATTTTTTTATTTTATGG - Intergenic
1055943557 9:81672855-81672877 TGTTGAGTTTTTTCATTTAAAGG - Intronic
1056167773 9:83955639-83955661 AATTTTATTTTTTCACTAAAGGG - Exonic
1057018580 9:91677974-91677996 AGTTCTCTTTTTTCCCTTATTGG + Intronic
1057134077 9:92674429-92674451 AGTTATGTGTATTCACTTTGGGG + Intergenic
1059057009 9:110994021-110994043 AGTTATTATTTTGCACTTTATGG - Intronic
1059811817 9:117863425-117863447 AGTTATATTGTATCACATAAAGG + Intergenic
1202783513 9_KI270718v1_random:23462-23484 TGTTATTTTGTTTCACTTAGGGG + Intergenic
1202803575 9_KI270720v1_random:26218-26240 TGTTATTTTGTTTCACTTAGGGG - Intergenic
1203448364 Un_GL000219v1:83315-83337 TGTTATTTTCTTTCACTTAGGGG - Intergenic
1186353393 X:8763627-8763649 AGTCAATTTTTATCACTTAATGG + Intergenic
1186445501 X:9624324-9624346 CGTTAGCTTCTTTCACTTAAAGG + Intronic
1188024769 X:25196564-25196586 TTTTATCTCTTTTCACTTAAGGG + Intergenic
1188369152 X:29347710-29347732 ATTTTTACTTTTTCACTTAAAGG + Intronic
1188376474 X:29435968-29435990 AGTTATGTTTTTTCCCCTAATGG - Intronic
1188478067 X:30607949-30607971 TGTTTTGTTTTATTACTTAAGGG + Intergenic
1189760070 X:44313268-44313290 AGTTAAGGTTTTTCAATTAAAGG - Intronic
1191746071 X:64488632-64488654 AGTTTTTTTTTTTCACATGAAGG + Intergenic
1192613512 X:72592323-72592345 AGTTATGTTTTTTCCCCTTTGGG - Intronic
1193651911 X:84146543-84146565 AGTTATTTTTTTATACTTAATGG - Intronic
1193692528 X:84664627-84664649 AATAATGTTTTTTCAGTAAATGG - Intergenic
1194050094 X:89057550-89057572 AGGTATGTGTTTTAATTTAAAGG + Intergenic
1194149074 X:90300992-90301014 TGTAATGTTTTTTAAGTTAATGG - Intergenic
1194265560 X:91749418-91749440 AGTTTTGTTTTTTCTGTTATTGG - Intergenic
1194419811 X:93660162-93660184 AGTTATCTTTTTTCACATTATGG - Intergenic
1194640091 X:96393377-96393399 AGTGATGTTTTTTCCCATTACGG + Intergenic
1194742029 X:97585182-97585204 AGTTTTGTGTTTTCACTTTATGG - Intronic
1194827199 X:98577990-98578012 AGTTTTTTTTTTTCACTTTAGGG + Intergenic
1194839934 X:98727518-98727540 TATTATGTATTTTCACTTTAAGG + Intergenic
1194988298 X:100515873-100515895 AGTTATCTTTTTTTTTTTAATGG + Intergenic
1196335727 X:114531100-114531122 AGTTATTTTTGTTCACTGGAAGG - Intergenic
1196487595 X:116231581-116231603 AGTAATGGTTCTTCCCTTAAAGG + Intergenic
1196642976 X:118085141-118085163 ACTTATGTTTATTCATTTATCGG - Intronic
1198789463 X:140327854-140327876 ATTTATATTTTTTCTTTTAATGG + Intergenic
1199994477 X:153011964-153011986 AGTCAAGTTTTTTTCCTTAAAGG + Intergenic
1200495446 Y:3877724-3877746 TGTAATGTTTTTTAAGTTAATGG - Intergenic
1200582711 Y:4969866-4969888 AGTTTTGTTTTTTCTGTTATTGG - Intergenic
1201447874 Y:14078256-14078278 ATTTATTTTTTTGCACTAAATGG + Intergenic