ID: 906345355

View in Genome Browser
Species Human (GRCh38)
Location 1:45011182-45011204
Sequence CCGCGTGCGCTTCTTGGCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906345355_906345362 -4 Left 906345355 1:45011182-45011204 CCTCTGCCAAGAAGCGCACGCGG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 906345362 1:45011201-45011223 GCGGCCCAGCAGCTGCCGGGGGG 0: 1
1: 1
2: 0
3: 31
4: 296
906345355_906345368 21 Left 906345355 1:45011182-45011204 CCTCTGCCAAGAAGCGCACGCGG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 906345368 1:45011226-45011248 TCCAGCACCGCGCCCGGGCCAGG 0: 1
1: 0
2: 3
3: 23
4: 233
906345355_906345361 -5 Left 906345355 1:45011182-45011204 CCTCTGCCAAGAAGCGCACGCGG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 906345361 1:45011200-45011222 CGCGGCCCAGCAGCTGCCGGGGG 0: 1
1: 0
2: 0
3: 31
4: 447
906345355_906345367 16 Left 906345355 1:45011182-45011204 CCTCTGCCAAGAAGCGCACGCGG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 906345367 1:45011221-45011243 GGGACTCCAGCACCGCGCCCGGG 0: 1
1: 0
2: 0
3: 18
4: 176
906345355_906345366 15 Left 906345355 1:45011182-45011204 CCTCTGCCAAGAAGCGCACGCGG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 906345366 1:45011220-45011242 GGGGACTCCAGCACCGCGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 141
906345355_906345360 -6 Left 906345355 1:45011182-45011204 CCTCTGCCAAGAAGCGCACGCGG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 906345360 1:45011199-45011221 ACGCGGCCCAGCAGCTGCCGGGG 0: 1
1: 0
2: 2
3: 219
4: 804
906345355_906345358 -8 Left 906345355 1:45011182-45011204 CCTCTGCCAAGAAGCGCACGCGG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 906345358 1:45011197-45011219 GCACGCGGCCCAGCAGCTGCCGG 0: 1
1: 0
2: 1
3: 44
4: 294
906345355_906345359 -7 Left 906345355 1:45011182-45011204 CCTCTGCCAAGAAGCGCACGCGG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 906345359 1:45011198-45011220 CACGCGGCCCAGCAGCTGCCGGG 0: 1
1: 0
2: 4
3: 22
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906345355 Original CRISPR CCGCGTGCGCTTCTTGGCAG AGG (reversed) Exonic
900077345 1:827957-827979 CCGCGTTCGCGTCGAGGCAGAGG + Intergenic
906345355 1:45011182-45011204 CCGCGTGCGCTTCTTGGCAGAGG - Exonic
907430080 1:54406470-54406492 CCGCGTGCGCCGATTGGCCGAGG - Intronic
910659835 1:89660066-89660088 CAGCGTGCTCTTCTTGAGAGAGG + Intronic
922591672 1:226782050-226782072 CCGCCTGCGTTTCTTGGCTTGGG + Intergenic
1063815500 10:9767161-9767183 CTTGGTTCGCTTCTTGGCAGGGG + Intergenic
1068478003 10:57552214-57552236 CCGCTTGCACTTCCTGGCTGAGG + Intergenic
1072283288 10:93889852-93889874 CCACGTACAGTTCTTGGCAGTGG - Intergenic
1076432912 10:130419614-130419636 CCAGGTGCTCTTCTTGGCAGTGG + Intergenic
1076899035 10:133328095-133328117 CAGCGTCAGCTTCGTGGCAGTGG + Intronic
1083511952 11:63217620-63217642 CTCCCTGCGCTTCTTGGCTGGGG - Exonic
1087188886 11:95231468-95231490 CCTCGTCCTCTTATTGGCAGAGG - Intronic
1091810136 12:3390045-3390067 CCGCCTGTGCTTCTGGGCATGGG + Intronic
1102204513 12:111081401-111081423 CCACATGTGCTGCTTGGCAGTGG - Intronic
1107078257 13:36346516-36346538 CCACGCGCGCGTCTTGCCAGCGG + Intronic
1108516553 13:51208713-51208735 CCGCGTGCACTTCTGCCCAGTGG + Intergenic
1108893417 13:55293011-55293033 CCAAGTGCTCTTCTTGACAGAGG + Intergenic
1110729277 13:78860839-78860861 CCGCTTGCGCTTCCTGGGTGAGG + Intergenic
1111200301 13:84927668-84927690 CCGTTTGAGCTTCTTGGCAGAGG + Intergenic
1112412089 13:99173261-99173283 CCGCTTGCGCTTCCTGGGTGAGG + Intergenic
1115721171 14:36162493-36162515 CCCCGTGCGCTTCCTGGGTGAGG + Intergenic
1121451010 14:94008303-94008325 CAGGGTGGGCTTCTTGGAAGAGG + Intergenic
1122301637 14:100734472-100734494 CAGCGCGCGCTTCTTGACACAGG - Exonic
1123878110 15:24645359-24645381 CCGAGTGAGCTTCTTGCAAGTGG + Intergenic
1123920755 15:25068198-25068220 CCTCATGCTCTCCTTGGCAGGGG - Intergenic
1124239877 15:28020137-28020159 CAGCCTGCCTTTCTTGGCAGGGG - Intronic
1132646813 16:1003067-1003089 CTGCGTCCACTGCTTGGCAGAGG - Intergenic
1132903118 16:2268890-2268912 CCGCGCGAGCTTCGCGGCAGCGG + Intergenic
1132947248 16:2538292-2538314 CCGAGGGCGCTGCTTGGCTGCGG + Intronic
1132968467 16:2673164-2673186 CCGAGGGCGCTGCTTGGCTGCGG - Intergenic
1133088870 16:3387952-3387974 CCTTGTGCGGTTCTGGGCAGAGG - Intronic
1133327161 16:4948840-4948862 CCTGGTCCTCTTCTTGGCAGGGG + Intronic
1138692924 16:58785792-58785814 CCCCTTGCGCTTCCTGGCTGAGG + Intergenic
1142967858 17:3592207-3592229 CCGGGTGCGGCTCTTGGCCGTGG + Exonic
1145235925 17:21208410-21208432 CCTCCCGCTCTTCTTGGCAGTGG - Intronic
1152877549 17:82795759-82795781 CCACGTGGTCTTCTCGGCAGAGG - Intronic
1160179384 18:76620562-76620584 CCGCGGCAGCTTCTCGGCAGCGG + Intergenic
1160947940 19:1652206-1652228 CCGCGCGCGCTTGTTGGGGGGGG - Intronic
1164495485 19:28757038-28757060 CCGCTTGTGCTTCCTGGGAGAGG - Intergenic
1165943609 19:39428250-39428272 CCGGGTGCTGTTCTTGCCAGTGG + Exonic
1166219153 19:41353966-41353988 CCCCGTGCGCTTCCTGGGTGGGG - Intronic
1167158016 19:47750928-47750950 CCGCCTGAGCTTCTTGGCGTTGG - Exonic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932597759 2:73104763-73104785 CAGGGTGGGCTTCTTGGGAGAGG - Intronic
938406569 2:131036165-131036187 CTGGGTGCGTTTCTGGGCAGAGG - Intronic
946722720 2:222627403-222627425 TCACGTCTGCTTCTTGGCAGTGG - Intronic
1168860694 20:1044184-1044206 CAGGGTGGGCTTCTAGGCAGTGG + Intergenic
1184814259 22:46858691-46858713 CTTCGAGCGCTTCTTGGGAGAGG + Intronic
1185315674 22:50178223-50178245 GCGCGCGTGCTTCTTGTCAGGGG - Exonic
952990878 3:38829679-38829701 CCCCATGCGCTGCTTTGCAGAGG - Intergenic
971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG + Exonic
997463439 5:134071239-134071261 CTGCGTCCGCACCTTGGCAGTGG - Intergenic
998972867 5:147611450-147611472 CCCCTTGCGCTTCTTGGGTGAGG + Intronic
1001364324 5:171121834-171121856 GAGTGTGCCCTTCTTGGCAGGGG - Intronic
1003040786 6:2685574-2685596 CCGCTTCCTCTTTTTGGCAGAGG - Exonic
1008095549 6:47336110-47336132 ACCAGTGGGCTTCTTGGCAGAGG + Intergenic
1011234578 6:85202174-85202196 CCCCTTGCGCTTCTTGGGTGAGG - Intergenic
1019235915 6:170612392-170612414 CCGCGTTCGCGTCGAGGCAGAGG - Intergenic
1033030703 7:137823448-137823470 CCGCAGGAGCTTCTTTGCAGAGG - Intronic
1035287362 7:157814871-157814893 ACTCGTGCGCTTCTGTGCAGAGG - Intronic
1035515828 8:231925-231947 CCGCGTTCGCGTCGAGGCAGAGG - Intergenic
1039082067 8:33743384-33743406 CTGCGTGGGCTTCTCTGCAGTGG + Intergenic
1040005917 8:42620862-42620884 CCGTGTGCGCTCCTTGGACGTGG + Intergenic
1041121078 8:54586929-54586951 CCGCTTGCGCTTCCTGGGTGAGG + Intergenic
1049040442 8:140108704-140108726 CCACGTGTGCTTCTAGGCACTGG - Intronic
1057080860 9:92173406-92173428 CAGCGGGAGGTTCTTGGCAGTGG - Intergenic
1060700994 9:125748198-125748220 CCGCGTCCGCTCCTGTGCAGAGG - Intronic
1061370381 9:130194355-130194377 CCGCGGGTGCTTCCTGGCTGTGG + Intronic
1203787347 EBV:135333-135355 CCGGGTGGGCTTCCCGGCAGAGG - Intergenic