ID: 906346137

View in Genome Browser
Species Human (GRCh38)
Location 1:45015757-45015779
Sequence TACCCTACCCCATGTAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906346137_906346143 26 Left 906346137 1:45015757-45015779 CCAGAACTACATGGGGTAGGGTA 0: 1
1: 0
2: 1
3: 4
4: 68
Right 906346143 1:45015806-45015828 ACATTTGCAGAAAAACGGGTGGG 0: 1
1: 0
2: 1
3: 7
4: 155
906346137_906346141 22 Left 906346137 1:45015757-45015779 CCAGAACTACATGGGGTAGGGTA 0: 1
1: 0
2: 1
3: 4
4: 68
Right 906346141 1:45015802-45015824 TGTGACATTTGCAGAAAAACGGG 0: 1
1: 0
2: 2
3: 29
4: 335
906346137_906346140 21 Left 906346137 1:45015757-45015779 CCAGAACTACATGGGGTAGGGTA 0: 1
1: 0
2: 1
3: 4
4: 68
Right 906346140 1:45015801-45015823 TTGTGACATTTGCAGAAAAACGG 0: 1
1: 0
2: 0
3: 60
4: 859
906346137_906346144 27 Left 906346137 1:45015757-45015779 CCAGAACTACATGGGGTAGGGTA 0: 1
1: 0
2: 1
3: 4
4: 68
Right 906346144 1:45015807-45015829 CATTTGCAGAAAAACGGGTGGGG 0: 1
1: 0
2: 1
3: 9
4: 164
906346137_906346138 -2 Left 906346137 1:45015757-45015779 CCAGAACTACATGGGGTAGGGTA 0: 1
1: 0
2: 1
3: 4
4: 68
Right 906346138 1:45015778-45015800 TAGAGCTTTCCTAGCAGTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 109
906346137_906346142 25 Left 906346137 1:45015757-45015779 CCAGAACTACATGGGGTAGGGTA 0: 1
1: 0
2: 1
3: 4
4: 68
Right 906346142 1:45015805-45015827 GACATTTGCAGAAAAACGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906346137 Original CRISPR TACCCTACCCCATGTAGTTC TGG (reversed) Intergenic
904836730 1:33342520-33342542 CCCCCCACCCCATGCAGTTCAGG + Intronic
906346137 1:45015757-45015779 TACCCTACCCCATGTAGTTCTGG - Intergenic
914830034 1:151164498-151164520 TACTCTACACCAAGTATTTCAGG - Intronic
917124032 1:171670387-171670409 TACCCCAGCCCATGTGGTTTTGG + Intergenic
922028335 1:221774183-221774205 TTTCCTAGCCCATGTACTTCAGG - Intergenic
1065061108 10:21901653-21901675 CACCCTACTCAAAGTAGTTCTGG + Intronic
1066031925 10:31436488-31436510 TACCCTAGGCCATGTGGCTCCGG - Intronic
1069286306 10:66720070-66720092 TACCCTATCCCATGCACTCCAGG + Intronic
1075604761 10:123796722-123796744 TACCCTGCCCCAGGCAGTGCTGG + Intronic
1076161522 10:128247565-128247587 TTCCCTTGCCCATGTAGTTGTGG - Intergenic
1089217343 11:116842549-116842571 TACCCTGCCCTTTGGAGTTCAGG + Intergenic
1103081996 12:118031589-118031611 TAGCCTACCCCATTTTGGTCTGG + Exonic
1106590031 13:31091050-31091072 TAAACTTCTCCATGTAGTTCTGG - Intergenic
1112991603 13:105520654-105520676 TACCCTTCCCTTTGGAGTTCAGG - Intergenic
1113409528 13:110072629-110072651 TACCCTAACCCACGCAGTCCTGG - Intergenic
1117813040 14:59568724-59568746 TGCCCTACCTCTTGTACTTCTGG - Intronic
1122239578 14:100353679-100353701 CTCCTTACCCCATGTAGTCCAGG + Exonic
1132504638 16:301412-301434 TTCCCCACCCCATGGAGTCCTGG - Intronic
1136725449 16:32353614-32353636 TTCCCTACCCCATTAAGTTATGG - Intergenic
1136843780 16:33559670-33559692 TTCCCTACCCCATTAAGTTATGG - Intergenic
1203000982 16_KI270728v1_random:164142-164164 TTCCCTACCCCATTAAGTTATGG + Intergenic
1203132584 16_KI270728v1_random:1700545-1700567 TTCCCTACCCCATTAAGTTATGG + Intergenic
1203153945 16_KI270728v1_random:1859968-1859990 TTCCCTACCCCATTAAGTTATGG - Intergenic
1143152165 17:4814517-4814539 TATCCTGCCCCATGTTGTTGGGG - Intronic
1148616759 17:49006570-49006592 TACCCTGCCCCATATAGCTGTGG + Intronic
1159567409 18:70067964-70067986 TAACTTACCCCATGTGGTTGGGG + Intronic
1159749529 18:72283234-72283256 TACCCTACCCTAAGAAGTCCAGG - Intergenic
1167454894 19:49592859-49592881 TGCACCACCCCATGAAGTTCAGG + Intronic
1167894294 19:52568854-52568876 AACCCTAACCCATGTATTTTTGG - Intronic
926977626 2:18531080-18531102 TACCCACTGCCATGTAGTTCAGG - Intergenic
930051668 2:47220801-47220823 GACCCTACCTCATGGAGTTTGGG + Intergenic
930158658 2:48130882-48130904 TACCCTACCCCATCTTCTACTGG - Intergenic
933799402 2:85948788-85948810 TCTCTGACCCCATGTAGTTCTGG - Intergenic
942499655 2:176575808-176575830 GGCCCCACCCCATGTGGTTCAGG + Intergenic
943848397 2:192681980-192682002 TACTCTACCCTATGTTTTTCTGG + Intergenic
1169694966 20:8377100-8377122 TCCCCTACCCCATGAGGTGCTGG - Intronic
1171460386 20:25294635-25294657 TACCCCACCCCAGGGAGTTTTGG - Intronic
1173277895 20:41600404-41600426 TACCCTACTCCGCTTAGTTCTGG - Intronic
1176298417 21:5086620-5086642 TCCCCTGCCCCATCTGGTTCTGG - Intergenic
1179858609 21:44175329-44175351 TCCCCTGCCCCATCTGGTTCTGG + Intergenic
1181495995 22:23287863-23287885 CACCCTGACCCATGTAGTTCGGG + Intronic
952976747 3:38703047-38703069 TCCCCTACCCCATGTACCTCAGG + Intronic
959936675 3:112036664-112036686 TACTTTACCCCATGAAATTCAGG + Intronic
964154838 3:153572501-153572523 TACCCTACCCAATATAATTTAGG - Intergenic
971716042 4:30178693-30178715 TACCCAATCTCATGTATTTCTGG - Intergenic
971809886 4:31411059-31411081 TGTCCTACCCAATGTAGTTTTGG - Intergenic
976952655 4:90851445-90851467 CACCCCTCCCCATGTACTTCAGG - Intronic
982344023 4:154336058-154336080 TACCCTACACGGTCTAGTTCAGG - Intronic
983769827 4:171535570-171535592 TACCCAACCTCAGGTAGTTTGGG + Intergenic
987253916 5:16128496-16128518 AACCCTTCCCCATCTATTTCTGG - Intronic
996035708 5:118756549-118756571 AACAGAACCCCATGTAGTTCAGG + Intergenic
998748863 5:145294717-145294739 TACCCTGATCCATGTAGTTTAGG + Intergenic
999803932 5:155064530-155064552 TCTCCTACTCTATGTAGTTCTGG + Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1010650584 6:78450222-78450244 TACCCTAATCCATATGGTTCAGG + Intergenic
1014073125 6:117205817-117205839 TGCCCTCCCTCATTTAGTTCAGG + Intergenic
1016071075 6:139739979-139740001 TACCTTGCCCCATGTCCTTCAGG + Intergenic
1017238068 6:152138115-152138137 TACACTACCCCATGAATTTCAGG - Intronic
1022298723 7:29082590-29082612 GAACGTATCCCATGTAGTTCGGG + Intronic
1029791214 7:102845061-102845083 TACTCTAAACCCTGTAGTTCAGG + Intronic
1036621461 8:10426945-10426967 GACCCTGCCCCTTGTCGTTCCGG + Intronic
1038594695 8:28877213-28877235 TATTTTACCCTATGTAGTTCTGG - Intronic
1041834780 8:62199134-62199156 TACCCAACTCCAGGTATTTCAGG + Intergenic
1042429718 8:68691123-68691145 TACCCTTCTCAATGTAGTTCAGG + Intronic
1050946498 9:11527095-11527117 TACACTGGCCCATGTAGATCTGG + Intergenic
1055505076 9:76939783-76939805 TACCCCACCCCATGTGGGTGGGG + Intergenic
1059966184 9:119616574-119616596 TACCCTTTGCCATGTAGATCTGG - Intergenic
1188050795 X:25483220-25483242 TACCCCACCCCATGTCGTAGAGG - Intergenic
1189773941 X:44453256-44453278 TTTCCTATCCCATTTAGTTCAGG - Intergenic
1190874095 X:54447388-54447410 CACCCTTCTCCATGTAGTGCAGG + Exonic
1196208280 X:112966134-112966156 TTCCCTACCCCAACTATTTCAGG + Intergenic
1197943725 X:131816231-131816253 CACGCTAACCCATCTAGTTCAGG + Intergenic
1198231424 X:134693150-134693172 TGCCCACCCCCATGTATTTCAGG + Intronic
1198384148 X:136112280-136112302 TTCCCTATCCCATTTATTTCAGG + Intergenic