ID: 906349583

View in Genome Browser
Species Human (GRCh38)
Location 1:45046541-45046563
Sequence CTGTTAACAGGCATCTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906349583_906349586 -1 Left 906349583 1:45046541-45046563 CCTACTGAGATGCCTGTTAACAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 906349586 1:45046563-45046585 GATAAATGGAGATATCAAAAAGG 0: 1
1: 0
2: 7
3: 36
4: 584
906349583_906349587 30 Left 906349583 1:45046541-45046563 CCTACTGAGATGCCTGTTAACAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 906349587 1:45046594-45046616 TATACATATCTAGAGTTGAGAGG 0: 1
1: 0
2: 2
3: 18
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906349583 Original CRISPR CTGTTAACAGGCATCTCAGT AGG (reversed) Intronic