ID: 906349583 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:45046541-45046563 |
| Sequence | CTGTTAACAGGCATCTCAGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 146 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 133} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 906349583_906349586 | -1 | Left | 906349583 | 1:45046541-45046563 | CCTACTGAGATGCCTGTTAACAG | 0: 1 1: 0 2: 0 3: 12 4: 133 |
||
| Right | 906349586 | 1:45046563-45046585 | GATAAATGGAGATATCAAAAAGG | 0: 1 1: 0 2: 7 3: 36 4: 584 |
||||
| 906349583_906349587 | 30 | Left | 906349583 | 1:45046541-45046563 | CCTACTGAGATGCCTGTTAACAG | 0: 1 1: 0 2: 0 3: 12 4: 133 |
||
| Right | 906349587 | 1:45046594-45046616 | TATACATATCTAGAGTTGAGAGG | 0: 1 1: 0 2: 2 3: 18 4: 184 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 906349583 | Original CRISPR | CTGTTAACAGGCATCTCAGT AGG (reversed) | Intronic | ||