ID: 906356902

View in Genome Browser
Species Human (GRCh38)
Location 1:45115172-45115194
Sequence CGGGGTGGCCGCCGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5269
Summary {0: 5, 1: 305, 2: 1494, 3: 1847, 4: 1618}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906356888_906356902 13 Left 906356888 1:45115136-45115158 CCGGTTCCCAGTGAGCTGTTGGG 0: 3
1: 48
2: 1425
3: 546
4: 267
Right 906356902 1:45115172-45115194 CGGGGTGGCCGCCGGGCAGAGGG 0: 5
1: 305
2: 1494
3: 1847
4: 1618
906356886_906356902 28 Left 906356886 1:45115121-45115143 CCATCGTCATCATGGCCGGTTCC 0: 1
1: 8
2: 489
3: 1065
4: 835
Right 906356902 1:45115172-45115194 CGGGGTGGCCGCCGGGCAGAGGG 0: 5
1: 305
2: 1494
3: 1847
4: 1618
906356891_906356902 6 Left 906356891 1:45115143-45115165 CCAGTGAGCTGTTGGGTACACCT 0: 3
1: 4
2: 14
3: 16
4: 180
Right 906356902 1:45115172-45115194 CGGGGTGGCCGCCGGGCAGAGGG 0: 5
1: 305
2: 1494
3: 1847
4: 1618
906356890_906356902 7 Left 906356890 1:45115142-45115164 CCCAGTGAGCTGTTGGGTACACC 0: 3
1: 4
2: 11
3: 15
4: 190
Right 906356902 1:45115172-45115194 CGGGGTGGCCGCCGGGCAGAGGG 0: 5
1: 305
2: 1494
3: 1847
4: 1618

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906356902 Original CRISPR CGGGGTGGCCGCCGGGCAGA GGG Intronic
Too many off-targets to display for this crispr