ID: 906357950

View in Genome Browser
Species Human (GRCh38)
Location 1:45124033-45124055
Sequence CAAAAACCCTTCAGAAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1024
Summary {0: 1, 1: 1, 2: 10, 3: 112, 4: 900}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906357947_906357950 7 Left 906357947 1:45124003-45124025 CCCAAATTCTATCTCCAGCAAAA 0: 1
1: 6
2: 51
3: 180
4: 1064
Right 906357950 1:45124033-45124055 CAAAAACCCTTCAGAAATGAAGG 0: 1
1: 1
2: 10
3: 112
4: 900
906357946_906357950 8 Left 906357946 1:45124002-45124024 CCCCAAATTCTATCTCCAGCAAA 0: 1
1: 3
2: 32
3: 163
4: 901
Right 906357950 1:45124033-45124055 CAAAAACCCTTCAGAAATGAAGG 0: 1
1: 1
2: 10
3: 112
4: 900
906357948_906357950 6 Left 906357948 1:45124004-45124026 CCAAATTCTATCTCCAGCAAAAA 0: 1
1: 2
2: 6
3: 53
4: 436
Right 906357950 1:45124033-45124055 CAAAAACCCTTCAGAAATGAAGG 0: 1
1: 1
2: 10
3: 112
4: 900
906357949_906357950 -7 Left 906357949 1:45124017-45124039 CCAGCAAAAACAAAAACAAAAAC 0: 3
1: 59
2: 320
3: 1879
4: 11582
Right 906357950 1:45124033-45124055 CAAAAACCCTTCAGAAATGAAGG 0: 1
1: 1
2: 10
3: 112
4: 900

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906357950 Original CRISPR CAAAAACCCTTCAGAAATGA AGG Intronic
900356005 1:2264187-2264209 CAAATACCTTTCAGAAACAAAGG - Intronic
900785255 1:4645408-4645430 CTAAAACCCTGAAGAAATGAAGG + Intergenic
901393158 1:8961101-8961123 AAACCACCCTTCAAAAATGAAGG + Intronic
901437648 1:9257797-9257819 CAGAAGCCTTTGAGAAATGATGG + Intronic
902132181 1:14271674-14271696 CAAAAACTATTTAGAGATGAAGG - Intergenic
903859959 1:26358911-26358933 CAACAAAGCTTCAGAAATGTGGG + Intergenic
904294755 1:29512416-29512438 AAAATACCCTTCATAAATGAAGG + Intergenic
904635026 1:31873356-31873378 AAAATATCCTTCAGGAATGAAGG - Intergenic
905329623 1:37184401-37184423 CAGAAATCATTCAAAAATGAAGG + Intergenic
905354344 1:37370694-37370716 CCCAGACCCTTCAGGAATGAAGG + Intergenic
905832141 1:41078688-41078710 AAAATATCCTTCAGAAATAAAGG + Intronic
905979929 1:42215851-42215873 AAAATACTCTTCAAAAATGAAGG + Intronic
906050747 1:42869320-42869342 CCCAGACCCTTCAGGAATGAAGG + Intergenic
906352554 1:45076355-45076377 AAAATACCCTTCAAACATGAAGG - Intronic
906357950 1:45124033-45124055 CAAAAACCCTTCAGAAATGAAGG + Intronic
906743871 1:48208061-48208083 CACTAAGCCTTAAGAAATGAGGG + Intergenic
906879922 1:49578366-49578388 CCCAGACCCTTCAGGAATGAAGG + Intronic
907023977 1:51096755-51096777 AAAATATCCTTCAGACATGAAGG + Intergenic
907137472 1:52153454-52153476 CTCAGACCCCTCAGAAATGAGGG - Intronic
907178612 1:52550131-52550153 AAAATACTCTGCAGAAATGATGG + Intronic
907597607 1:55734022-55734044 CCCAGACCCCTCAGAAATGAAGG + Intergenic
907689936 1:56653308-56653330 CAAAATCCATTCAGATATTAAGG - Intronic
908023587 1:59924205-59924227 TAAATATACTTCAGAAATGAAGG + Intronic
908028092 1:59971892-59971914 CCAAAGCCCTTCAGAAAAGCAGG - Intergenic
908287741 1:62626841-62626863 CAAAAACCCTTCCAAAAAAATGG + Intronic
908738376 1:67301006-67301028 AAAAAATTCTTCAAAAATGAAGG + Intergenic
909092424 1:71243114-71243136 CAAATACACTTGAGAAATGCTGG - Intergenic
909124842 1:71654566-71654588 CAAAAACCCATAATAGATGAAGG - Intronic
909530460 1:76676111-76676133 CAAAAATCCTTCAGTGATGAAGG + Intergenic
909577186 1:77187744-77187766 CCCAGACCCTTCAGGAATGAAGG + Intronic
909598864 1:77440218-77440240 AAACTACCCTTCAGAAATGAGGG - Intronic
909625198 1:77707652-77707674 TTCAAACCCTTCAGAAATGAAGG + Intronic
909811195 1:79933248-79933270 CCCAGACCCTTCAGGAATGAAGG + Intergenic
910634660 1:89394155-89394177 CAAAGAGCCTCCAGAAATGATGG - Intergenic
910663374 1:89697771-89697793 AAAAAATTTTTCAGAAATGAAGG - Intronic
910773677 1:90853731-90853753 CATAACCCCATCATAAATGAAGG + Intergenic
910784213 1:90976774-90976796 CCAATCCCCTTCAGATATGAAGG - Intronic
910791545 1:91056237-91056259 CCCAGACCCTTCAGGAATGAAGG - Intergenic
910886769 1:91971828-91971850 CAAGATCCGTTCACAAATGAAGG - Intronic
910926477 1:92403071-92403093 AAAATATCCTTCAAAAATGAAGG - Intergenic
911485437 1:98499246-98499268 AAAATATCCTTCAGGAATGAAGG - Intergenic
911487355 1:98518168-98518190 AAAATACCCTTCAAACATGAAGG + Intergenic
911504997 1:98737803-98737825 TAAAAACCATTAAAAAATGAGGG + Intronic
911507740 1:98774406-98774428 CCCAGACCCTTCAGGAATGAAGG + Intergenic
911735903 1:101336361-101336383 AAAAAACCCATCAGAATTTAAGG - Intergenic
912050442 1:105523030-105523052 CCCAGACCCTTCAGGAATGAAGG - Intergenic
912251769 1:108019569-108019591 CCCAGACCCTTCAGGAATGAAGG - Intergenic
912278111 1:108282290-108282312 AAAATAACCTTCAAAAATGAAGG - Intergenic
912290115 1:108412067-108412089 AAAATAACCTTCAAAAATGAAGG + Intronic
912478761 1:109961600-109961622 CAAAAATCCTACAGAAAAGCTGG - Intergenic
912598754 1:110905535-110905557 AAAATATCCTTCAAAAATGAAGG + Intergenic
912987469 1:114449036-114449058 AAAAAACCTTTGAGAGATGAAGG + Intronic
912990233 1:114479517-114479539 AAAATATCCTTCAAAAATGAAGG + Intronic
912991119 1:114487424-114487446 CAAATACCCTTCAGGAATGAAGG + Intronic
913039183 1:115006482-115006504 GACAGACCCTTCAGGAATGAAGG - Intergenic
913401275 1:118436778-118436800 AAAATATCCTTCAAAAATGAAGG - Intergenic
913698588 1:121352609-121352631 GGAATACCCTTCAAAAATGAAGG + Intronic
914082248 1:144419736-144419758 AAAATACTCTTCAAAAATGATGG - Intergenic
914138958 1:144927426-144927448 GGAATACCCTTCAAAAATGAAGG - Intronic
914177153 1:145288235-145288257 AAAATACTCTTCAAAAATGATGG - Intergenic
914882486 1:151558208-151558230 AAAATATCCTTCAGAAATGAGGG - Intronic
914989826 1:152489281-152489303 GACAAACCCTTCATAAATAAAGG - Intergenic
915709915 1:157885550-157885572 CCCAGACCCTTCAGGAATGAAGG + Intronic
916090869 1:161306747-161306769 CAAAAACCCTCCAGACATAGTGG - Exonic
916531535 1:165661037-165661059 CAGGACCCCTTCTGAAATGAAGG + Intronic
916632288 1:166629463-166629485 CCAAAAGCCTCCAGACATGAAGG - Intergenic
916639419 1:166711079-166711101 CCAAGACCCTTTAGGAATGAAGG - Intergenic
916702408 1:167311378-167311400 AAAATATCCTTCAGGAATGAAGG + Intronic
917313928 1:173705159-173705181 CAGACATCCTTCAGGAATGAGGG - Intergenic
917549091 1:176005314-176005336 AAAAAACCCTACAAAAATTAAGG - Intronic
917693803 1:177497029-177497051 AAATTACCCTTCAGTAATGAAGG + Intergenic
918025714 1:180743589-180743611 CAAAACCTCATCAGGAATGAAGG - Intronic
918025721 1:180743730-180743752 AAAACATCCTTCAGGAATGAAGG - Intronic
918129038 1:181608822-181608844 GAAGAAACCTTCAGAAATAAGGG - Intronic
918552200 1:185756078-185756100 CAAAAAGCACTCACAAATGAAGG + Intronic
918733483 1:188028612-188028634 TTAAAACCATTAAGAAATGAAGG - Intergenic
918768722 1:188523764-188523786 CCTAGACCCTTCAGAAATGAAGG + Intergenic
918802498 1:188989604-188989626 CTAAAACTCTGCAGAAATGAAGG - Intergenic
918815304 1:189173105-189173127 CCCAGACCCTTCAGGAATGAAGG + Intergenic
918958498 1:191239846-191239868 CCCAGACCCTTCAGGAATGAAGG + Intergenic
919000478 1:191825966-191825988 CCCACACCCTTCAGGAATGAAGG - Intergenic
919143786 1:193607463-193607485 CATAAACCCTTCTTAAATGTGGG + Intergenic
919242064 1:194926421-194926443 CCGAGACCCTTCAGAAATGAAGG + Intergenic
919318228 1:196001257-196001279 CCCAGACCCTTCAGGAATGAAGG + Intergenic
920485994 1:206371250-206371272 GGAATACCCTTCAAAAATGAAGG + Intronic
920735206 1:208527211-208527233 CACATACGCTTCAGAAATCAAGG + Intergenic
921194832 1:212745620-212745642 AAAATATCCTTCAAAAATGAAGG + Intronic
921613102 1:217235352-217235374 CTAAAAATCTTCACAAATGAAGG - Intergenic
921700945 1:218268317-218268339 AAAACATCCTTTAGAAATGAAGG + Intergenic
921830229 1:219719878-219719900 AAAATATCCTTCAGGAATGAAGG + Intronic
922492849 1:226032385-226032407 CAAAAACCCATAAGAAATTGAGG + Intergenic
922780791 1:228250698-228250720 CCTAGACCCTTCAGGAATGAAGG - Intronic
922944488 1:229500512-229500534 CAAAAGCAATTCAGAAAGGATGG - Intronic
923239994 1:232074392-232074414 AAAACATCCTTCAAAAATGAAGG - Intergenic
923345636 1:233049447-233049469 TAAAGACCCTCAAGAAATGAAGG + Intronic
923486667 1:234439023-234439045 AAAATATCCTTCAGAAATGAAGG + Intronic
924799628 1:247318638-247318660 AAAACATCCTTCAGGAATGATGG + Intronic
1063145804 10:3294139-3294161 CAAAAAAAATTCAGAAAAGAGGG + Intergenic
1063227297 10:4027690-4027712 AATAAACCCCTCAGAAATGCAGG - Intergenic
1064267830 10:13839310-13839332 CAAAATGCCTTTAGAAATGGTGG - Intronic
1064517324 10:16165872-16165894 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1064647214 10:17471944-17471966 CAAAAACCTTTGAAAAATGTAGG + Intergenic
1065036073 10:21639769-21639791 CAGAACCCCTTCTGAAATGGGGG + Intronic
1065232192 10:23609815-23609837 CAAATACACTTGAAAAATGATGG - Intergenic
1065451061 10:25857406-25857428 CATAAATGCTTCAGAACTGAGGG + Intergenic
1065595521 10:27307018-27307040 TAAAAACTCTTCGTAAATGAAGG - Intergenic
1066169804 10:32829224-32829246 CACAGACCCTTCAGGAATGAAGG + Intronic
1066256017 10:33679519-33679541 CAAAAAACCATGAGAAATTAGGG + Intergenic
1067125235 10:43510328-43510350 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1067540550 10:47148289-47148311 AAAATATCCTTCAGAAATGAAGG + Intergenic
1067720553 10:48724637-48724659 CAGAAACCCTTGAGCAATGCAGG - Intronic
1068007398 10:51407680-51407702 CCCAGACCCTTCAGGAATGAAGG - Intronic
1068207282 10:53872015-53872037 CAAAATTGCTTCAAAAATGAGGG - Intronic
1069131523 10:64709716-64709738 CAAAAATCAATCAAAAATGATGG - Intergenic
1069192045 10:65504465-65504487 GACAGACCCTTCAGGAATGAAGG - Intergenic
1069275038 10:66579720-66579742 TAAATACTCTTCAGAAATAAAGG - Intronic
1069434878 10:68371937-68371959 AAAATATCTTTCAGAAATGAAGG + Intronic
1069586377 10:69606093-69606115 AAACTATCCTTCAGAAATGAAGG + Intergenic
1069790560 10:71017671-71017693 CCCAGACTCTTCAGAAATGAAGG - Intergenic
1070176456 10:73974436-73974458 CAAAAAAACTTCATAAATCAAGG + Intergenic
1071018310 10:81023486-81023508 CAAAAACTCTTCAAACATGAAGG + Intergenic
1071191835 10:83109685-83109707 CTAAAATCTTCCAGAAATGAAGG + Intergenic
1071266815 10:83972092-83972114 CCCAGACCCTTCAGAAATGAAGG - Intergenic
1071512538 10:86272175-86272197 AAAAAATCTTTCAAAAATGATGG + Intronic
1071593983 10:86904499-86904521 AAAATATCCTTCAAAAATGAAGG + Intronic
1071744133 10:88395988-88396010 AAACTATCCTTCAGAAATGAAGG + Intronic
1071849716 10:89556632-89556654 CAGGAACCCTTCTGAAATGGAGG - Intronic
1071937942 10:90551162-90551184 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1071942518 10:90605871-90605893 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1072146242 10:92641411-92641433 AAAATACCTTTCAGGAATGAAGG - Intronic
1072877926 10:99192789-99192811 AAAATATCCTTCAGACATGAAGG + Intronic
1072938840 10:99740383-99740405 AAAATACCTTTCAAAAATGAAGG - Intronic
1073039182 10:100588387-100588409 AAAATATCTTTCAGAAATGAAGG + Intergenic
1073599409 10:104832123-104832145 CTAAGATTCTTCAGAAATGACGG - Intronic
1073956674 10:108880322-108880344 CAAAGACCCTTCAGAAAACAAGG - Intergenic
1074301616 10:112238989-112239011 AAAGAATCCTTCAGACATGAAGG - Intergenic
1074397363 10:113108749-113108771 CAACCTCCCTGCAGAAATGACGG - Intronic
1076073944 10:127517303-127517325 CTAAAACCATTCAGAAACGTTGG + Intergenic
1076436431 10:130447566-130447588 GAAAAATCCTTTAGAAATGAAGG - Intergenic
1076870824 10:133193215-133193237 AAAATATCCTTCAGAAATTAAGG + Intronic
1077062262 11:622870-622892 AAAAAACCCTTCAGAGACCACGG - Intronic
1077965666 11:7130023-7130045 AAAATATTCTTCAGAAATGAAGG - Intergenic
1078014968 11:7605137-7605159 AAAGAACCCTGCAGAAAAGATGG + Intronic
1078204062 11:9212688-9212710 AAAATATCCTTCAAAAATGAGGG + Intronic
1078517427 11:12034949-12034971 CAAAAAAGCTTCATAAGTGAAGG + Intergenic
1078723138 11:13902490-13902512 GAAAAACCCCTGAGCAATGAGGG + Intergenic
1079512149 11:21223904-21223926 AAACTAACCTTCAGAAATGATGG - Intronic
1080443963 11:32320339-32320361 AAAAACCCCTCTAGAAATGAAGG - Intergenic
1080699165 11:34629844-34629866 AAAAAAACCTTGGGAAATGAAGG - Intronic
1081378548 11:42387792-42387814 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1081894676 11:46575168-46575190 CAAAAACCACTCAGGCATGATGG + Intronic
1081975500 11:47232037-47232059 AATAAAGCCTTAAGAAATGAAGG + Intronic
1082836078 11:57650969-57650991 CCCAGACCCTTCAGGAATGAAGG + Intronic
1082999909 11:59281750-59281772 CCCAGACCCTTCAGAAATAAAGG + Intergenic
1083391322 11:62352669-62352691 CAAATATCCTTCAGGAATGAAGG - Intronic
1083461854 11:62818912-62818934 AAAACATCCTTCAAAAATGAAGG + Intronic
1083969433 11:66064906-66064928 CAAAGATCTTTCAAAAATGAAGG - Intronic
1084060050 11:66666025-66666047 AAACAAGCTTTCAGAAATGATGG + Intronic
1085225605 11:74918096-74918118 CTCAGACCCTTCAGAAGTGAAGG + Intronic
1085914120 11:80864083-80864105 CCAAAACTCTTCAAAAAGGAAGG + Intergenic
1085937873 11:81171803-81171825 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1086013444 11:82134271-82134293 AAAACACACTTCAGAAATAATGG + Intergenic
1086278868 11:85162326-85162348 CTCAGACCCTTCAGGAATGAAGG + Intronic
1086535929 11:87845927-87845949 CAAATATCCTTCAGTATTGAAGG + Intergenic
1086891715 11:92265992-92266014 CAAAAAACATCAAGAAATGATGG - Intergenic
1086996389 11:93361179-93361201 AAAATACCCCTCAGGAATGAAGG + Intronic
1087172345 11:95062269-95062291 AGAGAAGCCTTCAGAAATGAAGG - Intergenic
1087378552 11:97375241-97375263 TAAAAGCCCTTCAGAAACGGTGG + Intergenic
1087696715 11:101386879-101386901 AAAATATCCTTCAAAAATGAGGG - Intergenic
1087700150 11:101428093-101428115 AAATTATCCTTCAGAAATGAAGG - Intergenic
1087859122 11:103131672-103131694 AAAATATCCTTCAGGAATGAGGG - Intronic
1087861727 11:103166569-103166591 GAAAAATTCTTCAGAAATAAAGG - Intronic
1088062962 11:105679871-105679893 CCCAAACCCTTCAGGAATAAAGG - Intronic
1088097461 11:106117045-106117067 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1088338489 11:108736038-108736060 CATTAACCCTTCAGCAAAGACGG - Intronic
1088382747 11:109214833-109214855 AAAATACTATTCAGAAATGAAGG - Intergenic
1088449600 11:109967194-109967216 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1088944285 11:114493940-114493962 AAAAAATCCTTCAAATATGAAGG - Intergenic
1089186698 11:116621347-116621369 AAAATATGCTTCAGAAATGAAGG + Intergenic
1089830490 11:121323290-121323312 CAAAAACACTACAAAAAAGATGG - Intergenic
1090209222 11:124906170-124906192 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1090842561 11:130505131-130505153 AAAATATCCTTCTGAAATGAAGG - Intergenic
1091052006 11:132380625-132380647 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1091088125 11:132743416-132743438 CAGAAACCCTCCAGGAAGGAAGG + Intronic
1091664045 12:2406000-2406022 CAAATATTCTTCACAAATGAAGG - Intronic
1091827892 12:3527880-3527902 AAAATATCTTTCAGAAATGACGG - Intronic
1091940784 12:4479023-4479045 CAAAAATTCTTCAGGAATGAAGG - Intergenic
1091966986 12:4752912-4752934 AAAATATCCTTCAGACATGAAGG - Intronic
1092017732 12:5173238-5173260 CAAAAACCAGACAGAAATGGAGG - Intergenic
1092151694 12:6253318-6253340 CTAAAACCTTCAAGAAATGATGG + Intergenic
1092178396 12:6426917-6426939 CAAAAATCCTGCAGAAGAGAAGG + Intergenic
1092300430 12:7243573-7243595 CAAAATTCTTTCAGAAAAGAGGG + Intergenic
1092381884 12:8003288-8003310 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1092492989 12:8963176-8963198 AAAATACCTTTCAGAAATGAAGG + Intronic
1092741709 12:11636834-11636856 TACAGACCCTTCAGGAATGAAGG - Intergenic
1092785983 12:12027300-12027322 GAAATATCCTTCAAAAATGAAGG + Intergenic
1092851970 12:12637602-12637624 AAAAATCCCTTCTGAAATAAAGG + Exonic
1092867325 12:12774836-12774858 CAAATTCCCACCAGAAATGAAGG - Intronic
1092974110 12:13727653-13727675 CACAAACTCTGCAGAAATAATGG - Intronic
1093031547 12:14293730-14293752 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1093036606 12:14337565-14337587 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1093152498 12:15639394-15639416 CAAAAACCCATGGGAAATGGAGG + Intronic
1093263567 12:16971896-16971918 AAACTACACTTCAGAAATGAAGG - Intergenic
1093490831 12:19701688-19701710 CTAAAATCTTCCAGAAATGAAGG + Intronic
1093872721 12:24311325-24311347 TAATGAACCTTCAGAAATGATGG - Intergenic
1094102791 12:26781147-26781169 CCCAGACCCTTCAGGAATGAAGG + Intronic
1095190480 12:39252029-39252051 CCCAGACCCTTCAGTAATGAAGG + Intergenic
1095619543 12:44234008-44234030 CAAAAACTCTTAAGAAATATTGG - Intronic
1095844136 12:46728097-46728119 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1095855993 12:46861799-46861821 CTCAGACCCTTCAGGAATGAAGG - Intergenic
1096340024 12:50790021-50790043 CAGAAACCTTTGAGGAATGATGG + Intronic
1096545359 12:52335351-52335373 CAAAAAACGTGTAGAAATGATGG + Intergenic
1097075914 12:56394157-56394179 AAAATATCCTTCAGGAATGAAGG + Intergenic
1097425852 12:59444080-59444102 AAAATACCCTTCAAAAATGAAGG - Intergenic
1097498629 12:60374782-60374804 ACAAAACCCTTGAGAAATGTGGG + Intergenic
1097564396 12:61250546-61250568 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1097821087 12:64130030-64130052 CCCAGACCCTTCAGGAATGAAGG - Intronic
1098356438 12:69616969-69616991 CAAAACCCTTTCTGGAATGAGGG - Intergenic
1098483619 12:70995491-70995513 GAAAAATCCTACAGAAAAGAAGG + Intergenic
1098505994 12:71251308-71251330 CAGAAACCCTCCAGAAAAGTTGG - Intronic
1098571097 12:71988277-71988299 AAGAAACACTTCAGAAATGGTGG + Intronic
1098716358 12:73831691-73831713 CCCAGACCCTTCAGTAATGAAGG + Intergenic
1099400988 12:82203876-82203898 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1099508958 12:83509859-83509881 CACAGACCCTTCAGGAATGAAGG + Intergenic
1099594744 12:84646804-84646826 AGAACACCCTTCAGAAATTAAGG + Intergenic
1099736083 12:86567609-86567631 CCCAGACACTTCAGAAATGAAGG + Intronic
1099794124 12:87375718-87375740 AAAAAATTCTTCAGAAATGAAGG - Intergenic
1100413352 12:94345678-94345700 CAGGACCCCTTCAGAAATGCGGG - Intronic
1100639595 12:96469541-96469563 AAAATATCCTTCAGAAACGAAGG - Intergenic
1100931080 12:99610156-99610178 ACAATAGCCTTCAGAAATGAAGG + Intronic
1100931106 12:99610370-99610392 CAAGACCCCTTCTGAAATGAGGG + Intronic
1101114400 12:101518066-101518088 CAGAAACCCTTCTGAAATGGGGG + Intergenic
1101264399 12:103068009-103068031 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1101476663 12:105056307-105056329 AAAATATCCTTCAGAAATGAAGG + Intronic
1101534348 12:105603868-105603890 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1102163513 12:110787964-110787986 CAGGACCCCTTCTGAAATGAGGG + Intergenic
1102608304 12:114087919-114087941 GAAAAACCCTTCATAATTTAAGG - Intergenic
1104148058 12:126054529-126054551 CCTAGACCCTTCAGGAATGAAGG + Intergenic
1104554558 12:129787915-129787937 CAAAAAACCTTCAGATGAGAGGG + Intronic
1104576985 12:129975392-129975414 AAAATATCTTTCAGAAATGAAGG + Intergenic
1106119172 13:26844397-26844419 AAAATACCCCTCAGGAATGAAGG + Intergenic
1106500769 13:30326642-30326664 AAAATATCCTTCAGGAATGAAGG + Intergenic
1106690940 13:32115656-32115678 GAAAAAGCCTTTAGTAATGAAGG - Intronic
1106723816 13:32463819-32463841 AAACTATCCTTCAGAAATGAAGG + Intronic
1108328776 13:49362995-49363017 AAAATACCCTTCAGGCATGAAGG + Intronic
1108544167 13:51474170-51474192 AAAAAACCCACCAGGAATGATGG - Intergenic
1109249269 13:59999240-59999262 CAAAAACCTTTCTTAAGTGAGGG - Intronic
1109315744 13:60747283-60747305 TACCAACCCTTCAGAAATGAAGG - Intergenic
1110134739 13:72052164-72052186 AAGAAAGCCTTCAAAAATGAAGG - Intergenic
1110330193 13:74263280-74263302 CTCAAACCCATCAGAAATTAAGG + Intergenic
1110833882 13:80062735-80062757 CCCAGACCCTTCAAAAATGAAGG - Intergenic
1111254990 13:85655295-85655317 CAAAAACATTTCATAATTGAAGG - Intergenic
1111426468 13:88091237-88091259 TAAATATCCTTCAGACATGAAGG - Intergenic
1111441126 13:88283605-88283627 CCAAAACCCTTCAGGAATGAAGG + Intergenic
1111455161 13:88473152-88473174 CACAAACCCATCATAAATCAAGG + Intergenic
1112249679 13:97768450-97768472 CCCAAACCCTTCAGGAACGAAGG - Intergenic
1112844956 13:103630722-103630744 AAAATACCCTTCAAGAATGACGG - Intergenic
1112875836 13:104037310-104037332 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1113443028 13:110344321-110344343 CAAATAGCCTTCATAAAAGATGG + Intronic
1113855405 13:113442128-113442150 AAAATATCTTTCAGAAATGAAGG - Intronic
1113980986 13:114275537-114275559 AAAAAACCCTAAAGAAATAATGG - Intergenic
1114093874 14:19313460-19313482 TAAAAACCCTTCAAAAAACAGGG + Intergenic
1114138678 14:19885746-19885768 AAAAAATCCTTCAAAAATAAAGG - Intergenic
1114219486 14:20683946-20683968 CAAAAAACCTTCAGAACAGCAGG + Intergenic
1114820452 14:26011570-26011592 AAAATACCCTTCAAACATGAAGG + Intergenic
1115073344 14:29354665-29354687 GAAAAACTCTTCACACATGACGG + Intergenic
1115106286 14:29765240-29765262 CATAAACACTTCACAAAAGAGGG + Intronic
1115496278 14:34007780-34007802 CAAATACCGGTAAGAAATGATGG + Intronic
1115619901 14:35131348-35131370 AAAATATCCTTCAGACATGAAGG - Intronic
1116083011 14:40200457-40200479 CAAAAATCTTTCAGAAAGAAGGG + Intergenic
1116218767 14:42054411-42054433 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1116226556 14:42160941-42160963 AACAGACCCTTCAGAAATGAAGG - Intergenic
1116355018 14:43916608-43916630 AAAATATCCTTCAGACATGAAGG + Intergenic
1116475739 14:45336741-45336763 AAACTATCCTTCAGAAATGAAGG - Intergenic
1116531211 14:45976355-45976377 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1117225124 14:53650418-53650440 CCAAAACTCTTCAGGAGTGATGG - Intergenic
1117634389 14:57726263-57726285 CCCAGACCCTTCAGGAATGAAGG + Intronic
1117779875 14:59221515-59221537 TCCAGACCCTTCAGAAATGAAGG - Intronic
1118385070 14:65249409-65249431 CTCAGACCCTTCAGGAATGAAGG - Intergenic
1118518404 14:66552660-66552682 TAAATATCCTTCAGAAATGAGGG - Intronic
1118682057 14:68252051-68252073 AAAAGACCCTTTAGAAATAAGGG - Intronic
1119664408 14:76474143-76474165 CAAAATCCCTGAAGAAATTAAGG - Intronic
1119671492 14:76522792-76522814 CAAAAACCCTTCAGGAATGAAGG - Intergenic
1120129605 14:80789564-80789586 CTAAAATCCTTGAGAAATGTAGG + Intronic
1120163271 14:81168244-81168266 CAAGATCACTTCTGAAATGAGGG - Intergenic
1120555768 14:85928761-85928783 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1120594431 14:86416552-86416574 CCAAGACCCTTCAGGAAGGAAGG - Intergenic
1120804667 14:88734123-88734145 CAACAACCCTACAGAAAAAATGG + Intronic
1121480254 14:94262855-94262877 AAAATATCCTTCAGGAATGAAGG - Intronic
1122183751 14:99973446-99973468 CAAAAACCCAAGAGAAATGTGGG - Intronic
1122595562 14:102887924-102887946 CAGAAACCCAACAGAAATGCAGG - Intronic
1123128382 14:105966091-105966113 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1123408906 15:20042248-20042270 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1123518237 15:21048958-21048980 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1124171673 15:27379655-27379677 AAACTACCCTTCAAAAATGAAGG - Intronic
1124417842 15:29488833-29488855 AAAATACCCTTGAAAAATGAAGG + Intronic
1124842442 15:33255647-33255669 CAAAAACCCTTCTGACTTGTGGG - Intergenic
1125307894 15:38342589-38342611 AAAACATCCTTCAAAAATGAAGG - Intronic
1125317840 15:38451399-38451421 GAAATATCCTTAAGAAATGAAGG - Intergenic
1125846953 15:42864647-42864669 AAATTATCCTTCAGAAATGAAGG + Intronic
1126273270 15:46846806-46846828 AAACTATCCTTCAGAAATGAAGG - Intergenic
1126283858 15:46988127-46988149 CCTAGACCCTTCAGGAATGAAGG + Intergenic
1126326024 15:47478631-47478653 AAAACAGCCTTCAGAAATAATGG + Intronic
1127018635 15:54718990-54719012 CAAAAATATTTAAGAAATGAAGG - Intergenic
1127357043 15:58210119-58210141 CTCAGACCCTTCAGGAATGAAGG + Intronic
1127403382 15:58614586-58614608 AAACTATCCTTCAGAAATGAGGG - Intronic
1127403388 15:58614641-58614663 AAACTAACCTTCAGAAATGAGGG + Intronic
1128900830 15:71421406-71421428 AAAACACCCTTCAAATATGATGG - Intronic
1129573682 15:76717190-76717212 AAACTATCCTTCAGAAATGAAGG + Intronic
1130142377 15:81238864-81238886 AAACTACCCTTCAGGAATGATGG - Intronic
1130331549 15:82925894-82925916 CTAAAATCATTGAGAAATGAGGG - Intronic
1130344800 15:83033053-83033075 AAAATATCCTTCAAAAATGAAGG + Intronic
1130800667 15:87259729-87259751 AGAAAACCCTTCAAAAATCAAGG - Intergenic
1131640669 15:94289372-94289394 AAAATATCCTTCAGAAATGAAGG + Intronic
1131658956 15:94493175-94493197 CCCAGACCCTTCAGGAATGATGG + Intergenic
1131663677 15:94546320-94546342 CAAAAACCAGGCATAAATGAAGG + Intergenic
1131673348 15:94645768-94645790 CACACACCCTTCAGAATTAAGGG - Intergenic
1131895655 15:97026675-97026697 CCCAAACTCTTCAGGAATGAAGG - Intergenic
1131967026 15:97855131-97855153 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1132037545 15:98499187-98499209 CAAGAATACTTCAGAAATAAGGG - Intronic
1132169031 15:99628947-99628969 AAAAAATCCTTCTGAAATGAAGG - Intronic
1132789872 16:1679705-1679727 AAAAAACCCTTTAGATTTGAGGG + Intronic
1133571716 16:7047279-7047301 AAAATATCCTTTAGAAATGAAGG - Intronic
1134292754 16:12915584-12915606 CAGAAACCCATCAGAATGGATGG - Intronic
1135083079 16:19452784-19452806 CAGGACCCCTTCTGAAATGAGGG + Intronic
1135493307 16:22929425-22929447 AAAAAGCCCCTCAGAAAAGATGG - Intergenic
1135664960 16:24327953-24327975 TAAAAACAATTCAGACATGAAGG + Intronic
1136284213 16:29231737-29231759 AAATAACCCTTTACAAATGAAGG + Intergenic
1137341819 16:47614967-47614989 TAACTACCCTTCAGTAATGAAGG - Intronic
1137416340 16:48285086-48285108 CAAAATTACTTCAAAAATGAAGG - Intronic
1137649049 16:50103243-50103265 CAAAGACCTTTCAGAAGTCAGGG - Intronic
1137941375 16:52690531-52690553 AAAAAATTCTTCAAAAATGAAGG - Intergenic
1137945254 16:52727922-52727944 CAAACACCCCTCAGAAAAAATGG + Intergenic
1139393969 16:66625027-66625049 CAAAGACTATTCAGAAACGAGGG + Intronic
1140318690 16:73926433-73926455 AAAATATCCTTCAGGAATGAAGG - Intergenic
1140326900 16:74013228-74013250 CTCAAACCCCTCAGGAATGAAGG - Intergenic
1141024652 16:80534196-80534218 AAAATACCCTTCAGTAATAAAGG - Intergenic
1141264516 16:82484276-82484298 CAAATATCCTTCAGGACTGAAGG + Intergenic
1142089247 16:88201246-88201268 AAATAACCCTTTACAAATGAAGG + Intergenic
1142116938 16:88362488-88362510 AAAACACCCTTCAAGAATGAAGG - Intergenic
1142467665 17:145500-145522 CAAAAACCCTTCCTAAAGGCAGG + Intergenic
1143695549 17:8613241-8613263 CAAAAAAACTTCAAAAATAAAGG + Intronic
1144195648 17:12892185-12892207 AAAATATTCTTCAGAAATGAAGG - Intronic
1144722245 17:17479535-17479557 CATAAAACCTTCAGACATGGTGG + Intronic
1145401569 17:22540486-22540508 TGAAAACATTTCAGAAATGAAGG + Intergenic
1146238289 17:31188109-31188131 CCCAGACCCTTCAGGAATGAAGG + Intronic
1146364697 17:32213142-32213164 CAAATACACATCAGAAAGGAGGG - Intronic
1146743892 17:35311144-35311166 GAAAAATCCTTCAAACATGAAGG - Intergenic
1146792352 17:35759302-35759324 CAAAAACCCTTGAAAAGTCAGGG - Intronic
1146828344 17:36044276-36044298 AAAATAGCCTTCAAAAATGAAGG - Intergenic
1146836557 17:36115377-36115399 CTCAGACCCTTCAGGAATGAAGG + Intergenic
1148635427 17:49145625-49145647 CCCAGACCCTTCAGGAATGAAGG - Intronic
1149344401 17:55719780-55719802 CAAAAATCCTCCAGTAAAGAAGG + Intronic
1149943525 17:60897150-60897172 AAATTACCCTTCATAAATGAAGG - Intronic
1150089276 17:62307419-62307441 CATAAACCCTTCACAAGTGAAGG - Intergenic
1150873134 17:68937611-68937633 CAAAATACCTACAGAAAAGAGGG - Intronic
1150916295 17:69440680-69440702 AAAATACCCTTCAGAAATGAAGG - Intronic
1151023835 17:70653825-70653847 AAAATATCCTTCACAAATGATGG + Intergenic
1151093147 17:71465484-71465506 CCAAAACCTTATAGAAATGAAGG + Intergenic
1151098296 17:71524818-71524840 AAACAACTCATCAGAAATGACGG + Intergenic
1151503631 17:74511294-74511316 AAAATACCCTTCAAACATGAAGG - Intergenic
1151642029 17:75403195-75403217 CAAAAGCCATTCAGTAATGGTGG + Intronic
1153076720 18:1170659-1170681 CAATAACCCTTCTTACATGAAGG - Intergenic
1153089983 18:1332042-1332064 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1153417685 18:4867162-4867184 GAAAAGGCCTTCAGAAATGAAGG + Intergenic
1153684971 18:7536677-7536699 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1154068718 18:11132937-11132959 CCCAAACCCTTCAGGAATGAAGG + Intronic
1154252303 18:12754874-12754896 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1155109364 18:22698789-22698811 AGATAACCCTTAAGAAATGAAGG - Intergenic
1155213902 18:23625553-23625575 AGAAAACCCATCAGAAATCAAGG - Intronic
1155486077 18:26344461-26344483 AAAATATCCTGCAGAAATGAAGG + Intronic
1155486373 18:26347244-26347266 AAACTATCCTTCAGAAATGAAGG + Intronic
1155597541 18:27504686-27504708 AAAAAACCCTTCAAACATGAAGG + Intergenic
1155920646 18:31599771-31599793 CCAACACCCTACAGAAATCAGGG + Intergenic
1156784005 18:40887582-40887604 AAAAGATCTTTCAGAAATGAAGG - Intergenic
1156799194 18:41088310-41088332 AAAAAACCCTTAAAAAATCAAGG + Intergenic
1156860218 18:41827553-41827575 CAAGAACACTTTAGAAAAGAAGG - Intergenic
1156990052 18:43398902-43398924 CCTAAACTCTTCAGGAATGAAGG - Intergenic
1157341468 18:46781865-46781887 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1157524395 18:48368823-48368845 AAAAGACCCTTCTGGAATGAAGG + Intronic
1157870684 18:51227728-51227750 CCCAGACCCTTCAGAAATGAAGG - Intergenic
1157939265 18:51909088-51909110 CCCAGACCCTTCAGAAATGAAGG + Intergenic
1158231340 18:55259036-55259058 CACAAAACTTTCAGAAATGATGG - Intronic
1158454577 18:57594817-57594839 CAAAAACCACACTGAAATGATGG + Intergenic
1158670955 18:59473461-59473483 CAAAAAGTCTTCAGAATTGAAGG - Intronic
1159262060 18:66026904-66026926 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1159288035 18:66377353-66377375 CACAAGCCCTTCAGGAATGAAGG + Intergenic
1159525080 18:69578552-69578574 CAAAAATGCTCCAGAAATGATGG - Intronic
1159739353 18:72146539-72146561 CAGAAAACCTTCAGAGGTGATGG + Intergenic
1159850011 18:73516086-73516108 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1159956128 18:74519640-74519662 CAAAGACCCTGCAGGAAGGAGGG + Intronic
1160092702 18:75841899-75841921 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1160158748 18:76454880-76454902 AAACAACCTTGCAGAAATGAGGG + Intronic
1160296279 18:77640275-77640297 AAAAACCCCTTCAAAAATCAGGG + Intergenic
1161577778 19:5064404-5064426 CAAGAGCCCTTCAGAGATGTCGG - Intronic
1161741813 19:6025676-6025698 AAAATACCCTTCAGCAATGAAGG - Intronic
1162243350 19:9377006-9377028 AAAATGGCCTTCAGAAATGAAGG - Intronic
1162584009 19:11547956-11547978 CCAAAAGCCTTCAGACATCAGGG - Intronic
1162692616 19:12446442-12446464 AAAATATCCTTCAGACATGAAGG - Intronic
1163957273 19:20655612-20655634 CTAAATCCCTTAAGAAAAGAGGG + Intronic
1164973084 19:32549148-32549170 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1165245189 19:34494571-34494593 CAAAAACCCTAGAGAAATAAAGG - Exonic
1165350094 19:35270456-35270478 CAAAATCCCTTCAGCAATGGTGG + Exonic
1165537406 19:36460958-36460980 AAAATATCCTTCAGTAATGAAGG + Intronic
1165561181 19:36681387-36681409 CAAAAACCTGACAGAAAAGATGG - Intergenic
1165592741 19:36984713-36984735 AAAACACCTTTCACAAATGAGGG - Intronic
1167940827 19:52944565-52944587 AAAAAAACCCTCAGAAGTGAAGG + Intronic
1168539071 19:57195528-57195550 CCCAGACCCTTCAGGAATGAAGG - Intronic
1202634577 1_KI270706v1_random:33472-33494 AAAACACCCTTCAAAAGTGAAGG - Intergenic
1202651301 1_KI270707v1_random:6570-6592 AAAACACCCTTCAAAAGTGAAGG + Intergenic
925326942 2:3030427-3030449 AAAATATCCTTCAGGAATGAAGG + Intergenic
925354958 2:3234159-3234181 CAAAAAACTTGCAGGAATGAGGG + Intronic
925460999 2:4062330-4062352 CTCAGACCCTTCAGGAATGAAGG + Intergenic
925570502 2:5306370-5306392 GAAGTATCCTTCAGAAATGAAGG - Intergenic
925772489 2:7297134-7297156 CCCAGACCCTTCAGAAATAAAGG - Intergenic
926176073 2:10593585-10593607 CATAAACCCTTAAGAAAAAAAGG + Intronic
926377347 2:12245893-12245915 CTAAAACCTAACAGAAATGAGGG - Intergenic
926575598 2:14576779-14576801 AAAATACCCTTCAGGAATGAAGG - Intergenic
926617582 2:15012801-15012823 AAACTACCCTTCAGAAATGAAGG + Intergenic
926810135 2:16748826-16748848 CCCAGACCCTTCAGGAATGAAGG - Intergenic
926996112 2:18737426-18737448 CAAATAAACTTCAAAAATGAAGG + Intergenic
927648338 2:24894849-24894871 CAAATATCCTTCAAAAATGAAGG - Intronic
927853246 2:26513008-26513030 CAAAAAGCCGGCAGAAATCAGGG + Intronic
928104795 2:28462077-28462099 GAAATATCCTTCAAAAATGAAGG - Intronic
928297118 2:30093435-30093457 AAAATACCCTTTAGGAATGAAGG + Intergenic
928484323 2:31713852-31713874 AAAATATCCTTCAGACATGAAGG + Intergenic
928565598 2:32544756-32544778 CAAAAATCCCTCATAAATGTTGG + Intronic
928621743 2:33096277-33096299 GAAAAATCCTCCAAAAATGAAGG + Intronic
928695059 2:33840948-33840970 CAAAAATCATTGAGAAATAAGGG - Intergenic
929630857 2:43460712-43460734 CAAAAACCAACCACAAATGAAGG + Intronic
929696465 2:44120869-44120891 CATAAACCCCTCAGTAATGGTGG - Intergenic
929785993 2:44991752-44991774 AAACCATCCTTCAGAAATGAAGG - Intergenic
930005685 2:46894628-46894650 CAAATATCCTTTAGGAATGAAGG - Intergenic
930109869 2:47669291-47669313 CAAAACTCTTTCAGAAGTGAGGG - Intergenic
930294946 2:49543507-49543529 CCCAGACCCTTCAGGAATGAAGG - Intergenic
930480914 2:51947382-51947404 CCCAGACCCTTCAGGAATGAAGG - Intergenic
930848667 2:55934289-55934311 CAAAAAGCCCTCAAGAATGAAGG - Intergenic
931059256 2:58508668-58508690 CAAGAACCTTTCAGAAAAGATGG + Intergenic
932636751 2:73396152-73396174 TAAAAACACTTAAGAAATTAGGG - Intronic
932820858 2:74898766-74898788 CAAAAAGATTTCTGAAATGATGG - Intergenic
933003303 2:76954979-76955001 ACAATATCCTTCAGAAATGAAGG + Intronic
933265447 2:80176583-80176605 CATAGACCCTACAGGAATGAAGG - Intronic
933504529 2:83160905-83160927 CCCAGACCCTTCAGGAATGAAGG - Intergenic
933857559 2:86430657-86430679 CAAACATCCTTCAGAAATGAAGG + Intergenic
933988838 2:87617963-87617985 CAGATATCCTTGAGAAATGAAGG + Intergenic
935018692 2:99209806-99209828 AAAATACCCTTCAAATATGAAGG - Intronic
935208302 2:100915697-100915719 AAAATATCCTTCAGGAATGAAGG + Intronic
935424857 2:102909555-102909577 CCCAGACCCTTCAGGAATGAAGG - Intergenic
935505919 2:103902733-103902755 AAAATACGCTTCAGAAGTGAAGG - Intergenic
935605130 2:104964628-104964650 AAAATATCCTTCAAAAATGAAGG - Intergenic
935989739 2:108708350-108708372 AAAAAATCCTTCAAACATGAAGG + Intergenic
936026678 2:109036040-109036062 AAAACGCCCTTCAGGAATGAAGG + Intergenic
936101799 2:109588146-109588168 AAAACATCCTTCAAAAATGAAGG + Intronic
936305006 2:111332860-111332882 CAGATATCCTTGAGAAATGAAGG - Intergenic
936380123 2:111977285-111977307 AAAATACCTTTCAAAAATGAAGG - Intronic
936411226 2:112260035-112260057 CCCAAACCCTTCAGGCATGAAGG + Intergenic
936641467 2:114316577-114316599 CTCAGACCCTTCAGGAATGAAGG + Intergenic
937449033 2:121985203-121985225 AAAAAATCCTTTAAAAATGAAGG - Intergenic
937539764 2:122934979-122935001 CAATCACCCCTCAGAAAAGATGG + Intergenic
937581823 2:123497255-123497277 CACAGACTCTTCAGGAATGAGGG - Intergenic
937765885 2:125659876-125659898 TCCAGACCCTTCAGAAATGAAGG + Intergenic
938208998 2:129449196-129449218 AAAATACCTTTTAGAAATGAAGG + Intergenic
938234386 2:129691708-129691730 AAAAAATCCTTCGGAAATGAAGG + Intergenic
939052382 2:137323157-137323179 GAAAAACTGATCAGAAATGACGG + Intronic
939423899 2:142009310-142009332 CAAAAACCAATCAGAAAAAAGGG - Intronic
939617517 2:144377738-144377760 CCAAAACCCTTCCCAAATCATGG + Intergenic
939806495 2:146780342-146780364 CCCAGACCCTTCAGGAATGAAGG + Intergenic
939976387 2:148721269-148721291 AAAATACCCTTCAAAAGTGAAGG - Intronic
940494246 2:154405233-154405255 CTAAATCATTTCAGAAATGAAGG + Intronic
940549827 2:155139912-155139934 CAGAACCCCTTCTGAAATGGTGG - Intergenic
940741280 2:157511393-157511415 AAAATATCCTTCAAAAATGAAGG + Intergenic
940912805 2:159224028-159224050 CAAAATCTCTTCAGCAGTGAAGG + Intronic
940923778 2:159340661-159340683 AAGAAAGCCTTCAGAAATGAAGG + Intronic
940950757 2:159670865-159670887 GAAGTATCCTTCAGAAATGATGG - Intergenic
941115398 2:161466441-161466463 AAAACACCCTTCAGGAGTGAAGG - Intronic
941314352 2:163973903-163973925 CTAAAACCCTTGAGACTTGAGGG + Intergenic
941330407 2:164172682-164172704 CCAAGACCCTTCAGGAATGAAGG - Intergenic
941403046 2:165055509-165055531 AAAAAACCCTTAAGTAATTAGGG - Intergenic
941668288 2:168262976-168262998 CCCAGACCCTTCAGGAATGAAGG + Intergenic
942119347 2:172761508-172761530 AAAATATCCTTCAGGAATGAAGG + Intronic
942388730 2:175469567-175469589 TAAAAATCCTTCAGAATTCAAGG + Intergenic
942406212 2:175659051-175659073 GAAATACCCTTCAGGAATAAAGG - Intergenic
942838427 2:180329506-180329528 AAAATACCCTTCAAACATGAAGG + Intergenic
943017491 2:182530676-182530698 AAAATATTCTTCAGAAATGAAGG + Intergenic
943180777 2:184537966-184537988 ATAAAACTCTTCAAAAATGAAGG + Intergenic
943182536 2:184561526-184561548 CCCAGACCCTTCAGGAATGAAGG + Intergenic
943309899 2:186312530-186312552 AAAATACCCTTCAAACATGAAGG + Intergenic
943317674 2:186410443-186410465 CCCAGACCCTTCAGGAATGAAGG - Intergenic
943385641 2:187201365-187201387 CCCAGACCCTTCAGGAATGAAGG - Intergenic
943495658 2:188617805-188617827 CACCAAAGCTTCAGAAATGAAGG - Intergenic
943509290 2:188803906-188803928 CCCAGACCCTTCAGGAATGAAGG + Intergenic
943795568 2:191988879-191988901 CAATAACTCTGCAGAAATGCAGG + Intronic
944884656 2:204049942-204049964 CAAAAACATTTCATAAAGGAAGG - Intergenic
945354659 2:208825518-208825540 AAGTTACCCTTCAGAAATGACGG + Intronic
945496915 2:210519566-210519588 TAAATGGCCTTCAGAAATGATGG + Intronic
945545098 2:211139998-211140020 CCCAGACCCTTCAGGAATGAAGG + Intergenic
945717581 2:213378787-213378809 CCCAGACCCTTCAGGAATGAAGG - Intronic
945725592 2:213469616-213469638 CCCAGACCCTTCAGGAATGAAGG - Intronic
946454248 2:219811042-219811064 AAACTATCCTTCAGAAATGAAGG - Intergenic
946547579 2:220761557-220761579 AAAATATTCTTCAGAAATGAAGG - Intergenic
946703502 2:222435924-222435946 CCCAGACCCTTCAGGAATGAAGG - Intronic
946791154 2:223301621-223301643 CACAGAACCTTCAGTAATGAAGG + Intergenic
947060240 2:226156367-226156389 CACAAACCCTGAAGGAATGAGGG - Intergenic
947281762 2:228463126-228463148 CCCAGACCCTTCAGAAATAAAGG - Intergenic
947441112 2:230122138-230122160 CCCAAACCCCTCAGGAATGAAGG + Intergenic
947678110 2:232003681-232003703 AAAATATCCTTCAGTAATGAAGG - Intronic
947939495 2:234037267-234037289 AAATAATCCTTCACAAATGAGGG + Intergenic
948511480 2:238468380-238468402 AAGATATCCTTCAGAAATGAAGG - Intergenic
948774882 2:240279636-240279658 AAAATATCCTTCAGACATGAAGG + Intergenic
1168885732 20:1252910-1252932 CAGAAACCCTTCTGAAATGAAGG - Intronic
1169820927 20:9709088-9709110 CAAAGTTCCTTAAGAAATGATGG - Intronic
1170130080 20:13009945-13009967 CCAAAACACTTCAGAAAGCAGGG + Intronic
1170161292 20:13313968-13313990 CAAAAACATAACAGAAATGAAGG + Intergenic
1171069426 20:22053098-22053120 AAAAATTCCTTCAGGAATGAAGG + Intergenic
1173300200 20:41795749-41795771 CCTGGACCCTTCAGAAATGAAGG - Intergenic
1174169920 20:48609915-48609937 AAAATACCCTTCAAACATGAGGG + Intergenic
1175056723 20:56205468-56205490 GTAGAACCCTTCTGAAATGAGGG - Intergenic
1175288438 20:57854981-57855003 AAAATACCCTTCAAAACTGAAGG - Intergenic
1175797577 20:61781999-61782021 AAAATATCCTTCAAAAATGAAGG + Intronic
1176600836 21:8793066-8793088 AAAACACCCTTCAAAAGTGAAGG - Intergenic
1176627171 21:9101858-9101880 AAAACACCCTTCAAAAGTGAAGG + Intergenic
1177072710 21:16530738-16530760 AAAATATCCTTTAGAAATGAAGG - Intergenic
1177105380 21:16948083-16948105 AAAAAATCCTTCAAACATGAAGG + Intergenic
1177267970 21:18808822-18808844 CCCAGACCCTTCAGAAATGAAGG + Intergenic
1177454172 21:21314241-21314263 AAAATCCCCTTCAGACATGAAGG - Intronic
1177491370 21:21830275-21830297 CAAATATCTTTGAGAAATGATGG - Intergenic
1177745554 21:25208686-25208708 CAAAAACCCTTCTGGAACAATGG - Intergenic
1177843766 21:26264478-26264500 AAAATATCCTTCAGAAATGAAGG + Intergenic
1178243322 21:30927344-30927366 AAACTATCCTTCAGAAATGAAGG + Intergenic
1178596579 21:33959214-33959236 AAAATATCCTTCAGGAATGATGG + Intergenic
1178990269 21:37348643-37348665 AAAATATCCTTCAAAAATGAAGG - Intergenic
1179414876 21:41190651-41190673 CCCAGACCCTTCAGGAATGAAGG - Intronic
1180366130 22:11939757-11939779 AAAACACCCTTCAAAAGTGAAGG + Intergenic
1180417519 22:12781470-12781492 AAAACACCCTTCAAAAGTGAAGG + Intergenic
1180486862 22:15809115-15809137 TAAAAACCCTTCAAAAAACAGGG - Intergenic
1180674192 22:17576042-17576064 CTAAATTCCTTCAGAAAAGAAGG + Intronic
1181485475 22:23228599-23228621 AAAATATCCTTCAGGAATGAAGG - Intronic
1182965370 22:34516529-34516551 CAAAAACTGCTCAGAAATGCTGG + Intergenic
1182965941 22:34520961-34520983 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1182987435 22:34733658-34733680 CTAAGACCCTAAAGAAATGAGGG - Intergenic
1183033543 22:35123415-35123437 AAAATATCCTTCAGGAATGAAGG - Intergenic
1183070176 22:35390694-35390716 CAAGAACCCCTCAGAAATCATGG + Intronic
1183398436 22:37586829-37586851 CAGGACCCCTTCTGAAATGAGGG - Intergenic
1184061337 22:42083948-42083970 CAGAATCCCTTCTGAAATGGGGG - Exonic
1184195950 22:42928157-42928179 CATAAACCCTTGAGAAAGGACGG + Intronic
1184603291 22:45556479-45556501 CCCAGACCCTTCAGGAATGAAGG - Intronic
1184632541 22:45794724-45794746 AAAATATCCTTCAAAAATGAAGG + Intronic
1184755616 22:46514305-46514327 TAATCACCCTTCAGAAATGCCGG - Intronic
1185090579 22:48768262-48768284 AAAATATCCTTCAGTAATGAAGG - Intronic
1185140532 22:49098464-49098486 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1185191543 22:49439816-49439838 CAAAAATCCTTCACACATGTGGG - Intronic
949169769 3:984724-984746 CACACACCCTTCAGGAATAAAGG - Intergenic
949427093 3:3929348-3929370 CCTAGACCCTTCAGGAATGATGG - Intronic
949445874 3:4132944-4132966 CCCACACCCTTCAGGAATGAAGG + Intronic
949470510 3:4391000-4391022 GAACAATCCTTCAAAAATGAAGG - Intronic
949475036 3:4435772-4435794 AAAATTCCCTTCAGGAATGAAGG + Intronic
950909960 3:16578042-16578064 AAAACAATCTTCAGAAATGAGGG + Intergenic
951986550 3:28627714-28627736 CCCAAACCCTTCAGTAATGAAGG + Intergenic
952350965 3:32537763-32537785 CCAAAACCCTTCTGAATTGCAGG + Intronic
952594610 3:35000952-35000974 AAAATATCCTTCAGAAATGAAGG + Intergenic
952776002 3:37047283-37047305 CAAAAAGCCTGCTGAAAGGATGG - Intronic
953400696 3:42612959-42612981 CAAAATACTTTCATAAATGAAGG - Intronic
953729432 3:45433836-45433858 AAAATATCCTTCAGAAACGAAGG - Intronic
953745000 3:45567370-45567392 CAAACAGCCCTCAGACATGATGG + Intronic
955300483 3:57773529-57773551 CAAAAACCTTTAGGAAATCAAGG + Intronic
956198748 3:66682920-66682942 GAAAAACTCCACAGAAATGAAGG - Intergenic
956272438 3:67462293-67462315 CAGGACCCCTTCGGAAATGAGGG - Intronic
956360349 3:68440647-68440669 CCCAGACCCTTCAGGAATGAAGG - Intronic
956509931 3:69982235-69982257 CCCAGACCCTTCAGGAATGAAGG + Intergenic
956984467 3:74681662-74681684 CAAATATCCTTCAGTGATGAAGG + Intergenic
957334074 3:78804366-78804388 CTAAAACGCTTGAGAAATGAGGG - Intronic
957373919 3:79332793-79332815 CAAGAACACCTTAGAAATGATGG - Intronic
957907444 3:86576553-86576575 AAAATACCCTTCAAATATGAAGG - Intergenic
957966320 3:87325359-87325381 TAAATACCCTTCAAACATGAAGG + Intergenic
958057998 3:88438549-88438571 CAGAACCCCTTCTGGAATGAGGG - Intergenic
958487434 3:94730589-94730611 CCCAGACCCTTCAGGAATGAAGG - Intergenic
958489994 3:94760526-94760548 CAACAACCCTTCAAAAATAGGGG + Intergenic
958499648 3:94888774-94888796 TCCAGACCCTTCAGAAATGAAGG + Intergenic
959289184 3:104450711-104450733 CCCAGACCCTTCAGGAATGAAGG - Intergenic
959377220 3:105601996-105602018 CCCAGACCCTTCAGGAATGAAGG - Intergenic
959724722 3:109530371-109530393 CAAAAACATTTAAAAAATGAAGG + Intergenic
959998131 3:112700175-112700197 CCCAGACCCTTCAGGAATGAAGG + Intergenic
960254756 3:115500080-115500102 CACAAAATCTTCAGATATGAAGG + Intergenic
960538261 3:118837333-118837355 GAAAGAATCTTCAGAAATGAAGG - Intergenic
960623318 3:119656830-119656852 CAATAAACCTCCAGAAATAATGG - Intronic
961575110 3:127829195-127829217 AAAATATCCTTCAGGAATGAAGG - Intergenic
962257003 3:133878839-133878861 CAAAAATCTTTCAAAAATGAAGG + Intronic
962276011 3:134014046-134014068 CCAACACCCTTGAGAAATGCTGG - Intronic
962705625 3:138040806-138040828 CAAATACACTTCAAGAATGAAGG + Intergenic
962706553 3:138049953-138049975 AAAAAGCCCTTCAGGAATTATGG - Intergenic
962857821 3:139365125-139365147 TGAAAATCCTTCAGAAATGTAGG + Intronic
962862428 3:139417118-139417140 GAAAAACTTTTCAGACATGAAGG - Intergenic
963012131 3:140780274-140780296 CTTAGGCCCTTCAGAAATGAAGG + Intergenic
963355394 3:144204974-144204996 CCAAGACCCTTTAGGAATGAAGG - Intergenic
963443891 3:145376483-145376505 AAAATACCCTTCAAACATGAAGG + Intergenic
963719731 3:148848670-148848692 GTAAAATCATTCAGAAATGAAGG - Intronic
964146764 3:153473220-153473242 CCCAGACCCTTCAGGAATGAAGG + Intergenic
964519881 3:157553622-157553644 CAGGACCCCTTCTGAAATGAGGG - Intronic
965071255 3:163917551-163917573 CTCATACCCTTAAGAAATGAAGG + Intergenic
965807070 3:172552641-172552663 CAAACACCCTTCTTAATTGAGGG + Intergenic
965995962 3:174883789-174883811 CCCAGACCCTTCAGGAATGAAGG - Intronic
966025755 3:175279041-175279063 AATAAACTCTTCTGAAATGAAGG - Intronic
966044076 3:175529028-175529050 CCCAGACCCTTCAGGAATGAAGG - Intronic
966674890 3:182574120-182574142 AATATACCTTTCAGAAATGAAGG + Intergenic
967020969 3:185522291-185522313 CAACAACACTTCAGTAATGAGGG - Intronic
967551298 3:190798610-190798632 AAAATATCCTTCAGACATGAAGG + Intergenic
967760725 3:193223187-193223209 AAAAAACCTGACAGAAATGAAGG - Intergenic
968004710 3:195234293-195234315 AAAAAATCCTTCAAACATGAAGG - Intronic
969264295 4:6055031-6055053 CAAATGCCCTTGAGAAATGCAGG + Intronic
969586025 4:8093604-8093626 CAAAAAACTTCCAAAAATGAAGG - Intronic
970644817 4:18108088-18108110 CCCAAACCCTTCAGGAATGAAGG - Intergenic
970704482 4:18783498-18783520 CTCAGACCCTTCAGGAATGAAGG + Intergenic
970784383 4:19778643-19778665 CAAAAAACTCTTAGAAATGATGG - Intergenic
970924118 4:21430602-21430624 CCTAAACCCTTCATAAATAATGG - Intronic
970994062 4:22245772-22245794 CAGAACCTCTTCTGAAATGAGGG - Intergenic
971006437 4:22379087-22379109 GAAAACCCCTTCAAAAATCAGGG - Intronic
971100760 4:23464539-23464561 CCCAGACCCTTCAGGAATGAAGG - Intergenic
971394073 4:26212672-26212694 CAAGACCCCTTCTGAAATGAAGG - Intronic
971855248 4:32034450-32034472 AAAAAACACTTCTAAAATGAAGG + Intergenic
972085468 4:35208968-35208990 CCCAGACCCTTCAGGAATGAAGG + Intergenic
972192699 4:36613647-36613669 CCAAACCCTTTCAGGAATGAAGG + Intergenic
972933473 4:44103862-44103884 CTAAAATCTTTTAGAAATGAAGG - Intergenic
973120759 4:46519033-46519055 CCCAGACCCTTCAGGAATGAAGG - Intergenic
973638114 4:52878250-52878272 CAAAAACCATACAGCAGTGAAGG + Intronic
973679084 4:53297901-53297923 CAAAAAGGCTTCATAAGTGAAGG - Intronic
974436857 4:61867658-61867680 ACAAGAGCCTTCAGAAATGAAGG + Intronic
974550117 4:63361419-63361441 CAAGAACCCTTTTGGAATGAGGG - Intergenic
974565028 4:63570190-63570212 CCAAGACCATTCAGCAATGAAGG + Intergenic
974644370 4:64672905-64672927 CCCAGACCCTTCAGGAATGAAGG - Intergenic
974746723 4:66087407-66087429 CCCAGACCCTTCAGGAATGAAGG - Intergenic
975200951 4:71588888-71588910 CATATATCCTTTAGAAATGAGGG - Intergenic
975278986 4:72538530-72538552 AAAAATCCCTTCAAAATTGAGGG + Intronic
975692265 4:76977406-76977428 TAAAATGCCTTCAGAAATGGGGG + Intronic
975833689 4:78398170-78398192 AAAAAATCATTCAGAAATGGAGG + Intronic
975895218 4:79081415-79081437 AAAAAAATCTTCAAAAATGAAGG - Intergenic
976161404 4:82203193-82203215 CAAAAATCCTTCAAACATGAAGG + Intergenic
976187973 4:82461953-82461975 GGAAAACCATTCACAAATGATGG + Intergenic
976257625 4:83115815-83115837 ACAAAACCTTTCAGAAATGAGGG + Intronic
976301051 4:83515949-83515971 CCAAGACCCTTCAGAAATAAAGG - Intronic
976657917 4:87508546-87508568 CAGAACCCCTTCTGAAATGGGGG + Intronic
977031939 4:91894044-91894066 CCTAGACCCTTCAGGAATGAAGG + Intergenic
977398048 4:96496085-96496107 AAACTACCCTTCAGAAATGAAGG + Intergenic
977411014 4:96664147-96664169 GAAGAACCCTTCTGGAATGAGGG - Intergenic
977489837 4:97698191-97698213 CCCAGACCCTTCAGGAATGAAGG - Intronic
977930145 4:102741937-102741959 CCCAGACCCTTCAGGAATGAAGG - Intronic
978081974 4:104604737-104604759 AAAATGTCCTTCAGAAATGAAGG - Intergenic
978341314 4:107723667-107723689 CCCAGACCCTTCAGGAATGAAGG - Intergenic
978574068 4:110171005-110171027 CAAGATCCCTTCTGAATTGAGGG - Intronic
978731261 4:112029578-112029600 CAAACACCCTTCTGAAGTTATGG - Intergenic
979138804 4:117146664-117146686 CCCAGACCCTTCAGGAATGAAGG + Intergenic
979520359 4:121659269-121659291 CAATAACTCATGAGAAATGAAGG - Intergenic
979647300 4:123086263-123086285 AAAACATCCTTCAAAAATGAAGG - Intronic
979767229 4:124476173-124476195 CCCAGACCCTTCAGAAATGAAGG + Intergenic
979898163 4:126187188-126187210 CCCAGACCCTTCAGGAATGAAGG - Intergenic
980167610 4:129248212-129248234 CCAAAACCCTTCTTAACTGATGG - Intergenic
980202255 4:129670793-129670815 CAGATCCCCTTCAGAAATGAAGG - Intergenic
980629769 4:135416150-135416172 CCGAGACCCTTCAGGAATGAAGG + Intergenic
980693217 4:136322232-136322254 AAAATATCCTTCAGACATGAAGG + Intergenic
980881033 4:138710096-138710118 ATAAAAGCCATCAGAAATGAAGG + Intergenic
980907827 4:138965700-138965722 CAAAAACCATGAAGAAAAGATGG - Intergenic
980958048 4:139448194-139448216 TCCAGACCCTTCAGAAATGAAGG + Intergenic
981154760 4:141421830-141421852 AAAATACCCTTCAGACATGAAGG - Intergenic
981295216 4:143123854-143123876 CTCAAACCCCTCAGGAATGAGGG + Intergenic
981558400 4:146021228-146021250 AAAAAACCCTTCAAACATGAGGG - Intergenic
981763576 4:148220941-148220963 CTCAAAGCCTTCAGAAATGTTGG - Intronic
982545917 4:156732977-156732999 AAAATATCCTTCAGAAGTGAAGG + Intergenic
982787979 4:159558489-159558511 CCCAGACCCTTCAGGAATGAAGG - Intergenic
983027661 4:162757168-162757190 CCCAGACCCTTCAGGAATGAAGG + Intergenic
983328842 4:166297095-166297117 AAAAAATCCTTCAAAAATAATGG - Intergenic
983493331 4:168414131-168414153 AAAATATCCTTCAGACATGAAGG + Intronic
983582952 4:169326731-169326753 CCCAGACCCTTCAGGAATGAAGG + Intergenic
983762786 4:171433352-171433374 AACATACACTTCAGAAATGAAGG + Intergenic
984589609 4:181602440-181602462 CAAAATCTCATCACAAATGATGG - Intergenic
985229689 4:187801122-187801144 AAAATATCCTTCAGACATGAAGG + Intergenic
985562337 5:594956-594978 AGAATACCCTTCAGAAATGAAGG + Intergenic
985562347 5:595060-595082 AGAACACCCTTCGGAAATGAAGG + Intergenic
985562351 5:595096-595118 AGAACACCCTTCGGAAATGAAGG + Intergenic
986576691 5:9220466-9220488 CAAAAAAACTTCAGAATAGATGG + Intronic
986888127 5:12265798-12265820 CTCAGACCCCTCAGAAATGAGGG - Intergenic
986938082 5:12916869-12916891 CCCAGACCCTTCAGGAATGAAGG - Intergenic
987265593 5:16250901-16250923 AAACTATCCTTCAGAAATGAAGG + Intergenic
987858965 5:23459086-23459108 CAAAAATTCTACAAAAATGATGG + Intergenic
987937752 5:24489626-24489648 CAAAAAACATTCAAAAAAGAGGG - Intronic
988229008 5:28450002-28450024 CCCAGACCCTTCAGGAATGAAGG + Intergenic
988785274 5:34561073-34561095 CCCAGACCCTTCAGGAATGAAGG - Intergenic
989373964 5:40740384-40740406 AAAATATCTTTCAGAAATGAAGG - Intronic
989410412 5:41113535-41113557 CTCAGACCTTTCAGAAATGAGGG + Intergenic
989486125 5:41994507-41994529 CCCAGACCCTTCAGGAATGAAGG - Intergenic
989784144 5:45307045-45307067 CAAGAACCCCACAGTAATGAAGG + Intronic
990049350 5:51477601-51477623 AAAGAATTCTTCAGAAATGAAGG - Intergenic
990260969 5:54022041-54022063 AAAATATCCTTCAGAAATGAAGG + Intronic
991203909 5:64027355-64027377 CAAAAACCTTTAAGAAAAGATGG + Intergenic
991561123 5:67954571-67954593 CAAATACCCTGCAGTTATGAAGG - Intergenic
992002450 5:72449232-72449254 AAAAAACCTTTCAGCCATGATGG - Intronic
992092625 5:73331953-73331975 AAAATATCCTTCAGGAATGAAGG - Intergenic
992109608 5:73480811-73480833 CTCAGACCCTTCAGGAATGAAGG - Intergenic
992243218 5:74791738-74791760 CCCAGACCCTTCAGGAATGAAGG + Intronic
992568967 5:78032283-78032305 TAAGAAGCCTTCAGAAATGCTGG - Intronic
993321029 5:86467315-86467337 CACAGGCCCTTCAGGAATGAAGG + Intergenic
993537549 5:89105381-89105403 CCCAGACCCTTCAGGAATGAAGG - Intergenic
994205355 5:97028690-97028712 CAAAGACACTTCAGAAAAGATGG - Exonic
994604982 5:101955583-101955605 CCTAAACCCTTCAGGAGTGAAGG - Intergenic
994638919 5:102380616-102380638 CATAAAACCTTTAGCAATGAAGG + Intronic
994640682 5:102405579-102405601 AAAATATCCTTCAGGAATGAAGG + Intronic
994917197 5:105995355-105995377 CTCAGACCCTTCAGGAATGAAGG + Intergenic
995280368 5:110328834-110328856 CAAAAAACATTCACAAAGGAAGG - Intronic
995548636 5:113257613-113257635 AGAAAACCCTTCAGAAAGGCTGG + Intronic
995626803 5:114088113-114088135 AAAATATCCTTCAAAAATGAAGG - Intergenic
996381479 5:122866549-122866571 CCCAGACCCTTCAGGAATGAAGG - Intronic
996391960 5:122971906-122971928 CCCAGACCCTTCAGGAATGAAGG - Intronic
996901309 5:128544780-128544802 GAAATATCCTTCAGAAATAAAGG + Intronic
996908703 5:128632078-128632100 CCCAGACCCTTCAGGAATGAAGG - Intronic
996954126 5:129163564-129163586 CTAAAATCTTTCAGAAATGAAGG - Intergenic
996994176 5:129674986-129675008 AAAATATCCTTCAGAGATGAAGG - Intronic
997671435 5:135677760-135677782 CAATTATCCTTCACAAATGAAGG - Intergenic
997891432 5:137680459-137680481 AAGAAACTCTTTAGAAATGAAGG + Intronic
999808136 5:155102799-155102821 CAAATACTCTTCCGAAATTAGGG + Intergenic
1000043375 5:157501631-157501653 CACAGACCCATCAGAAAGGAGGG - Intronic
1000262999 5:159607338-159607360 AAAATGCCCTTCAAAAATGAAGG - Intergenic
1000417273 5:160996085-160996107 CTCAGACCCTTCAGGAATGAAGG + Intergenic
1000730686 5:164830157-164830179 CCCAGACCCTTCAGAAATGAAGG + Intergenic
1001142987 5:169160938-169160960 CAGAAAGCCTTCAGAGATGGTGG + Intronic
1001173777 5:169445818-169445840 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1001200925 5:169715820-169715842 CAAAAACCCATCTACAATGATGG - Intronic
1001531820 5:172468322-172468344 AAAAAATCCTTCAGGAATAAAGG - Intergenic
1001609686 5:172990196-172990218 AAAAAACTCTTCAGAATTTATGG + Intronic
1002391788 5:178919462-178919484 CAAAAATCTTTCAGGAATGAAGG - Intronic
1002615304 5:180450265-180450287 GAAAATACCATCAGAAATGAAGG - Intergenic
1002629399 5:180560461-180560483 AAAACATCCTTCAGGAATGAAGG - Intronic
1002998236 6:2306648-2306670 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1003034452 6:2631100-2631122 ACAAAACCCTTCAGATGTGATGG + Intronic
1003576989 6:7306541-7306563 AAAAAACCTTTCAGGAATGATGG + Intronic
1003673758 6:8183520-8183542 CAAAACCCCCTAAGAAATGCTGG - Intergenic
1003752444 6:9075042-9075064 AAAAAATCCTTCAGGAATGAAGG - Intergenic
1005985473 6:30871298-30871320 AAAATACCCTTCATGAATGAAGG - Intergenic
1006048611 6:31321628-31321650 CCCATACCCTTCAGGAATGAAGG - Intronic
1006500713 6:34457374-34457396 CACAAAGCCTTCAGAAATGAAGG + Intergenic
1006684523 6:35821366-35821388 CAAAAACTCATTAGAAATGCAGG - Intronic
1006969785 6:38030681-38030703 AAAATACCCTGCAGAAATAAAGG + Intronic
1007118773 6:39363185-39363207 CAAAAGCCCTTCACAAAAAAAGG + Intronic
1007192766 6:40033573-40033595 CAAAAAAGCTACAGAAAGGAAGG + Intergenic
1008079121 6:47176686-47176708 CCAAGACCCTTCAGGAATGAGGG - Intergenic
1008177409 6:48286318-48286340 CAAATATCCTTCAAATATGAGGG - Intergenic
1008400527 6:51057315-51057337 CCCAGACCCTTCATAAATGAAGG + Intergenic
1008448098 6:51617192-51617214 AAAAAACATTTCAGAAGTGAAGG - Exonic
1008820641 6:55627009-55627031 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1008923597 6:56868368-56868390 CAAAAAAGCTTTAGAGATGATGG - Intronic
1009348829 6:62649316-62649338 TACAGACCCTTCAGGAATGAAGG + Intergenic
1009787069 6:68354099-68354121 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1009948041 6:70362987-70363009 AAAAAACACTTCAGGTATGACGG - Intergenic
1010291887 6:74147160-74147182 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1010325873 6:74561271-74561293 CCCAGACCCTTCAGAAATGAAGG + Intergenic
1010406765 6:75515018-75515040 CCCAAACTCTCCAGAAATGAAGG - Intergenic
1010514427 6:76755431-76755453 AAAATACCCTTCAAACATGAAGG + Intergenic
1010625108 6:78129489-78129511 AAACAATCCTTCAGAAATGAAGG + Intergenic
1010629957 6:78187917-78187939 AAAAAATCCTTCAAACATGAAGG - Intergenic
1011039098 6:83011425-83011447 CCCAGACCCTTCAGGAATGAAGG - Intronic
1011056176 6:83205785-83205807 AAAATATCCTTCAGAAATTAAGG - Intergenic
1011271300 6:85582260-85582282 AAAATACCCTTCAAACATGAAGG + Intronic
1011372699 6:86655053-86655075 AAAATACCCTTCAGGAATGAAGG + Intergenic
1011528310 6:88291045-88291067 AAAATATCCTTCAGAGATGAAGG + Intergenic
1012025704 6:93987472-93987494 AAGCAATCCTTCAGAAATGAAGG + Intergenic
1012174074 6:96057146-96057168 CATAATCCCATCAGAAATTAAGG + Intronic
1012504805 6:99932101-99932123 AAAATACCCTTCAAACATGAAGG - Intronic
1012705416 6:102522279-102522301 AAAAAACCCTTCAGATATAATGG - Intergenic
1012821039 6:104084646-104084668 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1012823979 6:104124578-104124600 AAAATATCCTTCAGACATGAAGG - Intergenic
1013623733 6:111917063-111917085 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1013725333 6:113088596-113088618 AAAATTTCCTTCAGAAATGAAGG + Intergenic
1013943736 6:115697189-115697211 AAAAAACCCATCAAAAATGGGGG + Intergenic
1014235157 6:118945934-118945956 CAAAACAACTTCATAAATGAAGG + Intergenic
1014407193 6:121066444-121066466 CAAAAACTATTCAGAAAAGCGGG + Intergenic
1014414956 6:121172510-121172532 CTCAGACCCTTCAGGAATGAAGG + Intronic
1014818748 6:125961921-125961943 CAGAATCCCTTCAGAAATGAGGG + Intronic
1014855359 6:126394772-126394794 GAAAAATCCTTCAAAGATGAAGG - Intergenic
1015135721 6:129867840-129867862 CCTCAACCCTTCAGAAATAATGG + Intergenic
1015558506 6:134488257-134488279 TCTATACCCTTCAGAAATGAAGG + Intergenic
1015569718 6:134608316-134608338 CAGAAAACCTTCTGAAGTGAAGG + Intergenic
1015688653 6:135895614-135895636 CAAAAACATTTCAGAAATATTGG + Intronic
1015968375 6:138718176-138718198 CAGAAACACTCCAGAAATTAAGG + Intergenic
1016119688 6:140330801-140330823 CCCAAACCCTTCAGGAATGAAGG - Intergenic
1016342377 6:143077433-143077455 AAAATATCCTTCAGGAATGAAGG - Intronic
1016419410 6:143869125-143869147 CCCAGACCCTTCAGGAATGAAGG - Intronic
1016612155 6:146002195-146002217 AAAATACCCTTCAAACATGAAGG + Intergenic
1016857562 6:148686310-148686332 CAAAAACGCTTTGGAAGTGATGG - Intergenic
1017034711 6:150256874-150256896 CAAAAACCATGCAGAAATGAAGG + Intergenic
1017227552 6:152039212-152039234 CCCAGACCCTTCAGGAATGAAGG - Intronic
1017588818 6:155956141-155956163 AAAAAACCCTTTAGAAAAGCAGG + Intergenic
1017796918 6:157853189-157853211 AAAACATCCTTCAAAAATGATGG - Intronic
1017856106 6:158350570-158350592 CAAAAACCAGTCAGGAATGGTGG + Intronic
1018083885 6:160284645-160284667 AAAATACCTTTCAAAAATGAAGG - Intergenic
1018951914 6:168384770-168384792 CAAAAACCACTCATAAATCATGG + Intergenic
1019222117 6:170481142-170481164 TTCAGACCCTTCAGAAATGAAGG + Intergenic
1019383038 7:737657-737679 GAAAAATCCTTCAAACATGAAGG - Intronic
1019815741 7:3198795-3198817 AAAACATCCTTCAGAAATGAAGG - Intergenic
1019819245 7:3228986-3229008 AAAATATCTTTCAGAAATGAAGG - Intergenic
1020489668 7:8765192-8765214 CCAAAAATATTCAGAAATGAGGG - Intergenic
1020655543 7:10924528-10924550 CATAACCCCTTCTGAAATGAGGG - Intergenic
1020773502 7:12425380-12425402 AAAATACCTTTCAAAAATGATGG - Intergenic
1020817877 7:12928353-12928375 AGAAAGCCCTTCATAAATGATGG + Intergenic
1021752314 7:23814732-23814754 AAAAAAAACTTCAGAAATCAGGG - Intronic
1021989081 7:26124803-26124825 CCTAGACCCTTCAGGAATGAAGG + Intergenic
1022011021 7:26308313-26308335 CAGAACCCCTCCTGAAATGAGGG - Intronic
1022079153 7:27002222-27002244 CCCAAACCCTTCCGGAATGAAGG + Intergenic
1022288631 7:28979302-28979324 CTTAGACCCTTCAAAAATGAAGG + Intergenic
1023109552 7:36795391-36795413 GAAAAATCATTGAGAAATGAAGG - Intergenic
1023208762 7:37780637-37780659 AAAATACCCTACATAAATGAAGG - Intronic
1023298228 7:38739194-38739216 CAAGAACCATTCAGTAATGTAGG - Intronic
1023465936 7:40454761-40454783 GAAATATCCTTAAGAAATGAAGG + Intronic
1023713715 7:43021856-43021878 AAAAAAACCTTCAGAAATCTAGG - Intergenic
1024158955 7:46654874-46654896 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1024225513 7:47323370-47323392 GAAATACCATTCAGGAATGAAGG + Intronic
1024610640 7:51061033-51061055 CCCAGACCCTTCAGGAATGATGG + Intronic
1024713169 7:52041146-52041168 AAAATAGCCTTCAGAAATGAAGG + Intergenic
1024816243 7:53275296-53275318 TAAAGACCCTTCAGAGATGGTGG - Intergenic
1024866357 7:53908228-53908250 CCCACACCCTTCAGGAATGAAGG + Intergenic
1024956715 7:54928503-54928525 AAAAAATCCTTCAAACATGAAGG + Intergenic
1025240927 7:57273012-57273034 CAAAAACCCTGCAGACAAGAGGG - Intergenic
1026046225 7:66907270-66907292 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1026066770 7:67081612-67081634 AAAAAAGCCTACAGGAATGATGG - Intronic
1026074541 7:67154441-67154463 AAACTATCCTTCAGAAATGAAGG - Intronic
1026271843 7:68843622-68843644 AAAAAACCCTGCAGAAATGATGG + Intergenic
1026669299 7:72374016-72374038 GAAATATCCTTCAGGAATGAAGG + Intronic
1026702326 7:72657735-72657757 AAACTATCCTTCAGAAATGAAGG + Intronic
1026710152 7:72730729-72730751 AAAAAAGCCTACAGGAATGATGG + Intronic
1026885487 7:73940514-73940536 AAATTATCCTTCAGAAATGAAGG - Intergenic
1027221594 7:76217609-76217631 CATAAAACCTTCAGAAGTGGGGG + Intronic
1027361429 7:77414818-77414840 CAAAAACTTTTCAGACATGTGGG + Intronic
1027610306 7:80352044-80352066 CCTAGACCCTTAAGAAATGAAGG - Intergenic
1027686057 7:81279832-81279854 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1027808457 7:82860459-82860481 AAAATACCCTTCAAACATGAAGG + Intronic
1028141987 7:87283900-87283922 CACAGACCCTTCAGGAATGAAGG + Intergenic
1028734228 7:94189286-94189308 CTAAAATCCTTGAGAAATGAAGG - Intergenic
1028897700 7:96060843-96060865 CAATGACGCTTCAGTAATGAAGG + Intronic
1029103615 7:98155683-98155705 AAAATATCCTTCAGGAATGAAGG + Intronic
1029430275 7:100524411-100524433 CAAAAACCCGTCAGGCATGGCGG + Intergenic
1029677232 7:102078560-102078582 CACAAACCCTTCAAATATAAAGG + Intronic
1030094237 7:105883811-105883833 CAAAAACACACCACAAATGAGGG - Intronic
1030145640 7:106351696-106351718 CAAAAATCTTTCACAAATGCAGG + Intergenic
1030192498 7:106823625-106823647 CCCAGACCCTTCAGAAATGAAGG - Intergenic
1030192658 7:106824889-106824911 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1030355675 7:108539408-108539430 CCCAGACCCTTCAGGAATGAAGG + Intronic
1030369019 7:108675925-108675947 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1030559329 7:111064959-111064981 CCCAGACCCTTCAGAAATGAAGG + Intronic
1030839052 7:114325606-114325628 CTAAAATCTTTCTGAAATGATGG - Intronic
1031398825 7:121306488-121306510 CAGAAACCCTAAAGAAATGGTGG + Intergenic
1031449647 7:121899124-121899146 CAAAAGCCCTTCAGTACTAATGG + Intronic
1031472596 7:122184229-122184251 AAAATATCCTTCAAAAATGAAGG + Intergenic
1031833267 7:126651901-126651923 CCAAGACCCTTCAGGAATGAAGG + Intronic
1031861260 7:126982850-126982872 CTCAGACCCTTCAGGAATGAAGG - Intronic
1032431805 7:131868185-131868207 CAGGACCCCTTCTGAAATGAAGG + Intergenic
1032586392 7:133151105-133151127 CCAAACCCCTGCAGAAGTGAAGG - Intergenic
1033067820 7:138172909-138172931 CAGAACCCCTTCTGAAATGAGGG - Intergenic
1033234708 7:139629137-139629159 CAAAATCTCTTCCGAAATGTGGG - Intronic
1033387682 7:140894199-140894221 AAAGACCACTTCAGAAATGAAGG + Intronic
1033392519 7:140941306-140941328 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1034170182 7:149056781-149056803 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1034719645 7:153278639-153278661 AAAAAACCCCTCACAATTGAAGG + Intergenic
1034933735 7:155184642-155184664 CAAAACACCTTCAATAATGAAGG - Intergenic
1035187942 7:157140180-157140202 AAAGAACATTTCAGAAATGATGG - Intronic
1036396077 8:8372366-8372388 CAAAAATACTTCAGGAAAGAAGG - Intronic
1036487647 8:9194139-9194161 CAACAACTCTTCAGGAATGTGGG + Intergenic
1037263000 8:17027938-17027960 AAAAAAAGATTCAGAAATGAAGG + Intronic
1038316241 8:26486857-26486879 CAACAAACATTCAGGAATGAAGG - Intronic
1038784149 8:30595524-30595546 AAATAATCTTTCAGAAATGAAGG - Intronic
1039029983 8:33298771-33298793 AAAATATCCTTCAAAAATGAGGG + Intergenic
1040643649 8:49371620-49371642 AAAATATCCTTCAGGAATGAAGG - Intergenic
1040655102 8:49498880-49498902 AAAATATCCTTCAGGAATGATGG - Intergenic
1040826721 8:51629731-51629753 CAGAAACCATGCAGACATGAAGG + Intronic
1041152718 8:54953442-54953464 CTCAAACCCTTGAGAAATAAAGG - Intergenic
1041507270 8:58612973-58612995 AAAACACCCTTCGAAAATGAAGG + Intronic
1041749301 8:61241883-61241905 AAAATATCCTTCAGGAATGAAGG - Intronic
1041802841 8:61818642-61818664 CCCAAACCCTTTAGGAATGAAGG - Intergenic
1041814506 8:61953952-61953974 TAAATATCCTACAGAAATGAGGG - Intergenic
1041869075 8:62613259-62613281 CAAACATCCTTCAAACATGAAGG - Intronic
1042000804 8:64122115-64122137 CCAAGACCCTTCAGGTATGAAGG - Intergenic
1042328458 8:67553548-67553570 CATAAGCCCTTGAGAAATGAAGG - Intronic
1043258269 8:78162050-78162072 CCTAGACCCTTCAGGAATGAAGG + Intergenic
1043935178 8:86134215-86134237 TGAAAATCCTTCAGGAATGAAGG + Intronic
1044253719 8:90034958-90034980 AAAATACCCTTCAAAAATCAAGG - Intronic
1044582362 8:93835068-93835090 CAAAAACCAGTCAGAAGTGGCGG + Intergenic
1045050958 8:98324932-98324954 CATAGACAATTCAGAAATGATGG - Intergenic
1045120042 8:99027590-99027612 AAACTACCCTTCAGAAATGAAGG - Intronic
1045234474 8:100338411-100338433 CAAAAAGTCTTCAGGAATGTAGG + Intronic
1045719061 8:105085278-105085300 CAAAAAACCTCAGGAAATGAAGG - Intronic
1046150181 8:110213187-110213209 AAAATACCCTTCAAGAATGAAGG + Intergenic
1047327222 8:123851435-123851457 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1047376176 8:124299323-124299345 AAAATATCCTTCAAAAATGAAGG - Intergenic
1047378545 8:124331120-124331142 GAAAAACACTTTAGAAATAAAGG + Intronic
1047837766 8:128712857-128712879 CAAGAACCATCCAGAAAAGAAGG + Intergenic
1048432297 8:134381707-134381729 CAAAATCCCCTCATAAATGAAGG - Intergenic
1048499985 8:134966767-134966789 GATAAATACTTCAGAAATGAAGG + Intergenic
1049068993 8:140342496-140342518 TAAAACCCCAGCAGAAATGAAGG - Intronic
1049084362 8:140466533-140466555 CAAAAATACCTCAGAAGTGATGG + Intergenic
1050367174 9:4883386-4883408 GAAAAAAGCTTCTGAAATGAAGG + Intronic
1051057462 9:13004674-13004696 TGAAAACTCATCAGAAATGAAGG - Intergenic
1051198545 9:14590648-14590670 AAAATATGCTTCAGAAATGAGGG + Intergenic
1051203303 9:14655260-14655282 AATAAATCCTTCAAAAATGAAGG + Intronic
1052087470 9:24285598-24285620 AAAATATCCTTCATAAATGATGG - Intergenic
1052113671 9:24621638-24621660 AAAAAACACTTCAGTAATGGTGG + Intergenic
1052199368 9:25759202-25759224 AAAATAGCTTTCAGAAATGAAGG + Intergenic
1053523721 9:38807959-38807981 CCTAGACCCTTCAGGAATGAAGG - Intergenic
1053591336 9:39517487-39517509 CAATACCCCTTCATAAATCAAGG - Intergenic
1053849180 9:42272844-42272866 CAATACCCCTTCATAAATCAAGG - Intergenic
1054195950 9:62032373-62032395 CCTAGACCCTTCAGGAATGAAGG - Intergenic
1054574972 9:66847806-66847828 CAATACCCCTTCATAAATCAAGG + Intergenic
1054642455 9:67556316-67556338 CCTAGACCCTTCAGGAATGAAGG + Intergenic
1055170407 9:73251320-73251342 AAAATATCCTTCAGAAATGAAGG + Intergenic
1055903681 9:81269309-81269331 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1056595597 9:88005458-88005480 AAAATACCTTTCAAAAATGAAGG + Intergenic
1057320564 9:94008955-94008977 AAAATACCCTTTAGAAATGAAGG + Intergenic
1057418876 9:94891947-94891969 CTAAATCCTTTCAGAAATAATGG - Intronic
1057609887 9:96532229-96532251 CAAAACTCCTTCAAAAATAATGG - Intronic
1058124828 9:101179247-101179269 CCCAGACCCTTCAGGAATGAAGG + Intronic
1058204708 9:102089244-102089266 AAATTACCCTTCAAAAATGAAGG + Intergenic
1058259013 9:102807828-102807850 CCTAGACCCTTCAGGAATGAAGG - Intergenic
1058789717 9:108430859-108430881 AAACTACCCTTCAAAAATGATGG + Intergenic
1059080899 9:111248786-111248808 TAGAAATCATTCAGAAATGATGG + Intergenic
1059288973 9:113204496-113204518 AAAATATCCTTCAAAAATGAAGG - Intronic
1059618441 9:115976548-115976570 GAACAACCCTTTAAAAATGATGG + Intergenic
1059867505 9:118532599-118532621 CTGAAACTCTTCAGAAATGTTGG + Intergenic
1059951877 9:119473351-119473373 AAAATATCCTTCAAAAATGAAGG + Intergenic
1060412618 9:123410170-123410192 CAAAACCCCTCTAGGAATGAGGG + Intronic
1060669400 9:125455985-125456007 AAAATATCCTTCAGAAAGGAAGG - Intronic
1060804863 9:126568858-126568880 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1061311707 9:129767865-129767887 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1061469343 9:130811057-130811079 AAAATACCTTTCAAAAATGAAGG + Intronic
1061887228 9:133597891-133597913 AAAAAACCCTTCCAAAATGAAGG + Intergenic
1062135791 9:134927228-134927250 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1062481020 9:136751669-136751691 CAAATATCCTTCAAAACTGAGGG - Intergenic
1062719680 9:138032616-138032638 AAAATACCCTTCAGGAATGAAGG - Intronic
1185936497 X:4262633-4262655 CAGGACCCCTTCTGAAATGAGGG + Intergenic
1186469494 X:9810255-9810277 CCCAGACCCTTCAGGAATGAAGG - Intronic
1187622259 X:21070312-21070334 CAAACATTCTTCAAAAATGAAGG - Intergenic
1187634178 X:21208690-21208712 AAAAACTCCTTTAGAAATGAAGG + Intergenic
1187798636 X:23034298-23034320 AAATAATCCTTCAGAAATAATGG - Intergenic
1188066437 X:25666467-25666489 AAAATACCCTTCAGAAATGAAGG - Intergenic
1188505876 X:30884378-30884400 CATTATCCCTTCAAAAATGAGGG + Intronic
1189223850 X:39396304-39396326 CAAAAACCTTTCAGAAAACAGGG - Intergenic
1189426080 X:40901321-40901343 AAAATATCCTTCAGGAATGAAGG + Intergenic
1189441494 X:41040097-41040119 AACATATCCTTCAGAAATGAAGG + Intergenic
1189478182 X:41373293-41373315 AAAATATCCTTCAGAAATGTAGG - Intergenic
1189490053 X:41464052-41464074 AAAAATATCTTCAGAAATGAAGG - Intronic
1189628394 X:42923389-42923411 AAAATACCCTTCAAACATGAAGG + Intergenic
1189823796 X:44896720-44896742 AAAATATTCTTCAGAAATGAAGG - Intronic
1189890310 X:45594437-45594459 AAAATATCCTTCAGAGATGATGG - Intergenic
1189931035 X:46011461-46011483 AAATGACCATTCAGAAATGAAGG - Intergenic
1189952089 X:46243032-46243054 AAAACACCTTTCAAAAATGAAGG - Intergenic
1189999868 X:46675717-46675739 CAGGATCCCTTCTGAAATGAGGG - Intronic
1190032655 X:46989441-46989463 AAAATATCCTTCAGGAATGAAGG - Intronic
1190156327 X:47995908-47995930 AAAATCTCCTTCAGAAATGAAGG + Intronic
1190384019 X:49866993-49867015 AAAATATCCTTCAGGAATGAAGG - Intergenic
1190447857 X:50548052-50548074 AAAATATCCTTCAGGAATGAAGG + Intergenic
1190460873 X:50672939-50672961 AAAATATCCTTCAGGAATGAAGG + Intronic
1190488334 X:50954133-50954155 AAAATATCCTTCAAAAATGAGGG + Intergenic
1190765948 X:53475792-53475814 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1190968472 X:55325956-55325978 AAAATATCCTTCAGGAATGAAGG - Intergenic
1191113270 X:56825075-56825097 CCGAAACCCTTCAGGAATGAAGG - Intergenic
1191159574 X:57313651-57313673 CAAATAAGCTTCATAAATGAAGG + Intronic
1191703937 X:64072772-64072794 GAAAAACCCTTCAAATATGAAGG + Intergenic
1191769253 X:64738213-64738235 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1191819403 X:65286637-65286659 CATATATTCTTCAGAAATGAAGG + Intergenic
1191941012 X:66482010-66482032 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1191946600 X:66540901-66540923 CACAGACCCTTCAGGAATGAAGG + Intergenic
1192188571 X:68975948-68975970 AAAATATCCTGCAGAAATGAAGG - Intergenic
1192361254 X:70441428-70441450 AAAATATCCTTCAGGAATGAGGG + Intergenic
1192548720 X:72036230-72036252 AAAATATCCTTCAGGAATGATGG - Intergenic
1192673004 X:73166526-73166548 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1192859063 X:75046530-75046552 CAAAACTCATTCAGAAATGAAGG - Intergenic
1192891223 X:75392967-75392989 CCCAGACCCTTCAGGAATGAAGG - Intronic
1193109661 X:77715115-77715137 AAAACATCCTTCATAAATGAAGG - Intronic
1193119035 X:77804249-77804271 CAACAATCCTTCAAAAATGAAGG - Intergenic
1193211594 X:78812218-78812240 AAACTACCCTTCAAAAATGAAGG + Intergenic
1193531196 X:82656781-82656803 CATAGACCCTTCAGGGATGAAGG - Intergenic
1193665612 X:84311876-84311898 AAAATATCCTTCAGATATGAAGG + Intergenic
1193690218 X:84632785-84632807 TAAATAGCCTTCAAAAATGAAGG + Intergenic
1193876230 X:86865804-86865826 CACAAAACCTTCAGGAATGAAGG + Intergenic
1193899454 X:87159614-87159636 AAAATATCCTTCAGACATGAAGG - Intergenic
1193914563 X:87350083-87350105 CCCAGACCCTTCTGAAATGAAGG - Intergenic
1194082082 X:89481118-89481140 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1194140600 X:90204303-90204325 CTCAGACCCTTCAGAAATAAAGG - Intergenic
1194210538 X:91064226-91064248 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1194235593 X:91379792-91379814 CGCAAACTCTTCAGGAATGAAGG + Intergenic
1194485354 X:94479172-94479194 CTCAGACCGTTCAGAAATGAAGG + Intergenic
1194561737 X:95429869-95429891 AAAATATCCTTCAGACATGAAGG + Intergenic
1194649669 X:96499893-96499915 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1194746069 X:97629706-97629728 GAAAAACCCTTCAGTACTAATGG - Intergenic
1194834194 X:98660674-98660696 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1195019592 X:100813126-100813148 AAACTGCCCTTCAGAAATGAGGG + Intergenic
1195097115 X:101513770-101513792 CCCAAACTCTTCAGGAATGAAGG - Intronic
1195557547 X:106244116-106244138 CAGAACCCTTTCAGAAGTGAAGG - Intergenic
1195633253 X:107083156-107083178 AAAAAATCCTTCAAAAGTGAAGG - Intronic
1195639957 X:107162611-107162633 AAAATGTCCTTCAGAAATGAAGG + Intronic
1195748651 X:108143365-108143387 CCCAGACCCTTCAGGAATGAAGG - Intronic
1195845801 X:109226875-109226897 AAAATACACTTCAGAAATCAAGG + Intergenic
1195901299 X:109800346-109800368 AAAAAATCCTTTAGGAATGAAGG + Intergenic
1196275881 X:113764552-113764574 CCTAGACCCTTCAGGAATGAAGG + Intergenic
1196289914 X:113928189-113928211 AAATTACCCTTCACAAATGAAGG - Intergenic
1196394926 X:115249339-115249361 AAAAAGCCCTTCAAAAATGAAGG + Intergenic
1196508236 X:116474830-116474852 AAAATACCCTTCAGACATGAAGG - Intergenic
1197002544 X:121454794-121454816 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1197027934 X:121777950-121777972 AAACTACCCTTCATAAATGAAGG - Intergenic
1197182362 X:123549658-123549680 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1197405417 X:126042078-126042100 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1197420134 X:126228216-126228238 CTCAGACCCTTCAGGAATGAAGG + Intergenic
1197592127 X:128421269-128421291 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1197666212 X:129226545-129226567 AAAATATCCTTCAGGAATGAAGG + Intergenic
1197684319 X:129422581-129422603 GAAAAACCCTTCAAAAATCAAGG - Intergenic
1197988767 X:132294993-132295015 CCCAGACCCTTCAGGAATGAGGG - Intergenic
1198170296 X:134098578-134098600 CGTAGACTCTTCAGAAATGAAGG + Intergenic
1198412239 X:136382561-136382583 CCCAGACCCTTCAAAAATGAAGG - Intronic
1198688730 X:139256870-139256892 AAAATATCCTTCAGGAATGAAGG - Intergenic
1198701555 X:139402168-139402190 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1198702238 X:139409700-139409722 TAAAAACCCTTAAAAACTGAGGG - Intergenic
1198946694 X:142024061-142024083 AAAATATCCTTCAGATATGAAGG - Intergenic
1199116316 X:143997393-143997415 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1199159747 X:144595197-144595219 AAAATATCCTTCAAAAATGAAGG - Intergenic
1199921803 X:152413812-152413834 CAAAAAGCCTACAGAATGGAAGG + Intronic
1200362966 X:155630464-155630486 AAACTATCCTTCAGAAATGAAGG - Intronic
1200434754 Y:3137308-3137330 CCCAGACCCTTCAGGAATGAAGG + Intergenic
1200745720 Y:6902437-6902459 CCCAGACCCTTCAGGAATGAAGG - Intergenic
1201529418 Y:14976025-14976047 CACAGACACTTCAGGAATGAAGG - Intergenic
1201720783 Y:17094534-17094556 CAGGACCCCTTCTGAAATGAGGG + Intergenic