ID: 906358478

View in Genome Browser
Species Human (GRCh38)
Location 1:45130251-45130273
Sequence CTATTAAAGAACCTATTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906358478 Original CRISPR CTATTAAAGAACCTATTAAT AGG Intronic
901363833 1:8728331-8728353 ATATTTAAGAACTTATTAAAAGG + Intronic
902024622 1:13373520-13373542 CTATAAAAAAACATAGTAATAGG + Intergenic
902178068 1:14666376-14666398 ATAATAAAGAAGTTATTAATTGG + Intronic
902491354 1:16783705-16783727 CTATGAAAGACCCTGTTAAGAGG - Intronic
903920942 1:26800255-26800277 CTATTAAAGAGACTGTTAATAGG - Intergenic
906358478 1:45130251-45130273 CTATTAAAGAACCTATTAATAGG + Intronic
908092830 1:60704611-60704633 ATATTAAAGAAACTCTGAATTGG - Intergenic
909486024 1:76174967-76174989 GTATTATAGAACATATTTATTGG - Intronic
910954375 1:92685871-92685893 CAATTTCAGAACCTGTTAATTGG - Intronic
911223964 1:95283906-95283928 CTATCAAATAATATATTAATTGG + Intergenic
911498509 1:98659212-98659234 CCATTAAAAAACCTAGTGATAGG + Intergenic
911658437 1:100472541-100472563 CTGTAAAAGACCCTATTAAGAGG - Intronic
911673329 1:100631864-100631886 ATATTAAAGAATGTATTATTGGG + Intergenic
911709936 1:101059721-101059743 CTTTTAAAAAACTTATTAATTGG + Intergenic
911937469 1:103996825-103996847 CTATTAAAGGATAAATTAATTGG + Intergenic
912106231 1:106279258-106279280 CTATCAAAGACCCTATCAAAAGG - Intergenic
912844299 1:113065561-113065583 CTATTAAAGAGGCCATTTATAGG + Intergenic
913223297 1:116676764-116676786 CCATTCAGTAACCTATTAATTGG - Intergenic
914389566 1:147207745-147207767 CTATTAAACAACAGATTAACTGG - Intronic
917161696 1:172064171-172064193 TAATTAAATAACCTATAAATTGG - Intronic
917293710 1:173496488-173496510 ATATAAAAGAACTCATTAATTGG + Intergenic
917326217 1:173835389-173835411 TTCTTAAAGAACCAATTCATTGG - Intronic
917432280 1:174982995-174983017 GTATTAAAGGATTTATTAATAGG + Intronic
918963600 1:191310851-191310873 CTTTTAATGAACATAGTAATAGG + Intergenic
918969905 1:191400447-191400469 CTATCAAAGAACATCTTGATTGG - Intergenic
919114711 1:193266617-193266639 CTATGAAAGACCCTGTTAAGAGG - Intergenic
923529089 1:234798838-234798860 CTATGAAAGACCCTGTTAAGAGG + Intergenic
924269419 1:242317427-242317449 TTATAAAAGAACCTATAATTGGG + Intronic
1063041522 10:2343550-2343572 CTATTAAAAAAACCATTATTAGG - Intergenic
1066482822 10:35813302-35813324 CAATTAAAGGAACAATTAATTGG + Intergenic
1067252756 10:44601538-44601560 CTTTTAAAGAACCTAATATCAGG - Intergenic
1067817136 10:49488730-49488752 CTTTTAAAGAACATGTTGATGGG + Intronic
1068405883 10:56587925-56587947 ATATTAGTTAACCTATTAATAGG - Intergenic
1079914945 11:26357652-26357674 CTATAAAATACCCTGTTAATAGG - Intronic
1086202678 11:84222804-84222826 CTATTAAAAATCCTATTAATTGG + Intronic
1086651740 11:89300019-89300041 CTATTAAAGCACCTATGATGTGG + Intergenic
1086676470 11:89614038-89614060 TTTTTAAAGAAACTCTTAATAGG - Intergenic
1087993353 11:104773369-104773391 GTATTAAACACACTATTAATAGG + Intergenic
1088548913 11:110990763-110990785 CTATTAAACAACCCACTATTTGG - Intergenic
1088713468 11:112528419-112528441 CTATTTCAGATCCTTTTAATAGG - Intergenic
1089224795 11:116909009-116909031 CTTTTAAAATAGCTATTAATAGG + Intronic
1092328267 12:7557585-7557607 ATATTTAAGAATTTATTAATAGG + Intergenic
1096705175 12:53416420-53416442 TTATTAAAAAACTTTTTAATTGG - Intronic
1097491700 12:60279684-60279706 CTATTCAACAACATATTACTTGG - Intergenic
1097713994 12:62945889-62945911 CTATTAAAGCACAAATAAATAGG + Intergenic
1098441792 12:70526846-70526868 TTGTTAAAGAATTTATTAATAGG - Intronic
1098758641 12:74395605-74395627 CTATTAATGAACATGATAATGGG - Intergenic
1099043741 12:77689078-77689100 CTATTAAAGATTTTATCAATAGG + Intergenic
1099140762 12:78971981-78972003 GAATTAAAGTTCCTATTAATAGG + Intronic
1099222167 12:79928042-79928064 CTATTTAAAAACCTTTTAATAGG - Intronic
1100408927 12:94295459-94295481 CTTTTGAAGAGCCTATTATTTGG + Intronic
1106233120 13:27837922-27837944 TTATGAAAGACCCTATTAAGAGG - Intergenic
1106997315 13:35501131-35501153 ATACTAAAGTACCTATTAATGGG - Intronic
1107878424 13:44811066-44811088 ATATTAAAGAAAATATCAATTGG - Intergenic
1110563147 13:76930798-76930820 CCATTAAAGATGCTATTATTGGG - Intergenic
1111266934 13:85827934-85827956 CTTTCAAAGAACCTATCACTTGG - Intergenic
1114867519 14:26615187-26615209 CTATTAAACAACATACTAAAGGG - Intergenic
1116157551 14:41226678-41226700 AAACTAAAGAACCTATGAATTGG - Intergenic
1118158826 14:63268608-63268630 CTATAAAAGTATGTATTAATAGG + Intronic
1118911505 14:70065672-70065694 CTATTTATGAAACTTTTAATAGG - Intronic
1120153994 14:81070868-81070890 ATATTAAAGGAACTACTAATGGG + Intronic
1120237104 14:81904354-81904376 TTATTTAAGAACGTATTAAGGGG - Intergenic
1126831362 15:52609812-52609834 GAATTAAAGAGCCTATTAAAGGG + Exonic
1126894591 15:53244406-53244428 TTTTTAAAAAACTTATTAATGGG - Intergenic
1128829226 15:70751352-70751374 CTATATAAAAGCCTATTAATTGG + Intronic
1130245272 15:82241956-82241978 CTATTGAAGGAGATATTAATGGG - Intronic
1130404940 15:83590879-83590901 CTGTGAAAGACCCTATTAAGAGG - Intronic
1130455413 15:84101398-84101420 CTATTGAAGGAGATATTAATGGG + Intergenic
1130861178 15:87891732-87891754 CAATCAAAGTGCCTATTAATAGG - Intronic
1131987184 15:98054386-98054408 CTGTTAAAGACCCTATTTAGAGG - Intergenic
1132217397 15:100075552-100075574 ATTTTAGAGAACCTAATAATAGG - Intronic
1137740789 16:50770926-50770948 CTGTGAAAGACCCTATTAAGAGG - Intronic
1139159602 16:64488503-64488525 CTATTACAGAACCCTTTTATTGG - Intergenic
1139344617 16:66294519-66294541 CATTTACAGAACCTATTTATGGG + Intergenic
1140191854 16:72824294-72824316 CTATTAAAGGAAGTATTAATGGG - Intronic
1140512553 16:75518407-75518429 CTTGTAAAAAACCTATTAAAAGG + Intergenic
1140549375 16:75847562-75847584 CTAAAAAAGATCCTATTAAAAGG - Intergenic
1141333277 16:83131774-83131796 GTTTTAAAGACCCTATAAATTGG + Intronic
1144424091 17:15125171-15125193 CTATGAAAGATCCTGTTAAGAGG + Intergenic
1144541091 17:16144196-16144218 CTATCAAAGAATTTCTTAATTGG + Intronic
1145276759 17:21436284-21436306 CTATGAAAGACCCTCTTAAGAGG + Intergenic
1145314595 17:21722177-21722199 CTATGAAAGACCCTCTTAAGAGG + Intergenic
1145713048 17:26994140-26994162 CTATGAAAGACCCTCTTAAGAGG + Intergenic
1148189735 17:45670093-45670115 CTAGTAAAAAACCTATTATCAGG - Intergenic
1148471722 17:47897824-47897846 CTATCAGACAACCTATCAATTGG + Intronic
1149188262 17:54028146-54028168 CTATTATAGAACATTTTAGTTGG + Intergenic
1151058669 17:71064652-71064674 CTATAAAAGAAGCTATAAACCGG + Intergenic
1151532889 17:74718536-74718558 GTTTTTAAGCACCTATTAATTGG + Intronic
1154076504 18:11207796-11207818 CTATTAAAAAACTTATCAACTGG + Intergenic
1155538593 18:26843329-26843351 CTATTAAAAAATAAATTAATAGG + Intergenic
1156000973 18:32383500-32383522 CTAAAAAAGAACCTTTTAAAAGG + Intronic
1156636667 18:39039189-39039211 ATATTAAAGAAAATATAAATGGG + Intergenic
1157759930 18:50254061-50254083 CTGTAAAAGATCCTTTTAATAGG + Intronic
1159225989 18:65536730-65536752 CTGCTAAAGAACTTATTCATGGG + Intergenic
1159262660 18:66035734-66035756 CTATTACAGGACAAATTAATTGG - Intergenic
1159512462 18:69413775-69413797 CTGTGAAAGACCCTATTAAGAGG + Intronic
1160110296 18:76022649-76022671 TTATTAAAGTAACTAGTAATTGG + Intergenic
1161049371 19:2154576-2154598 GGACTAAAGAACCTATAAATAGG - Intronic
1165671636 19:37684658-37684680 CTTTAAAAGAACCTATAATTTGG + Intronic
1168490677 19:56806232-56806254 ATATTTAAGCATCTATTAATTGG - Intronic
925486691 2:4341793-4341815 CTATTAAAGATACTACTAAGAGG - Intergenic
925868533 2:8249595-8249617 TTATTTAAGCACCAATTAATGGG - Intergenic
927603693 2:24466876-24466898 TTATTAAACAAGCTTTTAATAGG - Intergenic
928519089 2:32070489-32070511 TTATTAAAGCAAATATTAATTGG + Intronic
929251255 2:39757968-39757990 CTGTTAAAGAACCTAGGAAATGG - Intronic
929872052 2:45767323-45767345 CTTTTAACCAACCTCTTAATGGG + Intronic
930503256 2:52250227-52250249 CTATTAAAGACACCATTAACCGG - Intergenic
930514508 2:52389121-52389143 ATATTAAATATCCTATTATTAGG - Intergenic
931930390 2:67127049-67127071 CTATTAATAAACTTCTTAATAGG + Intergenic
932519592 2:72396356-72396378 CTATCAAAGAACTCATTAAAAGG + Intronic
932805795 2:74782182-74782204 GTATTAAAGCACCTATGGATGGG - Intergenic
933098838 2:78224132-78224154 CTATTAAAGAACAATTAAATGGG + Intergenic
935436209 2:103036889-103036911 CATTTAAAGCACTTATTAATAGG + Intergenic
935856283 2:107278041-107278063 CTATTAATATAACTATTAATTGG + Intergenic
939217453 2:139257490-139257512 CTGTTAAAGCCCCCATTAATGGG + Intergenic
941378354 2:164759595-164759617 CTGTGAAAGACCCTATTAAGGGG + Intronic
943315565 2:186383461-186383483 TTATTAGAAAAACTATTAATAGG + Intergenic
943948274 2:194095016-194095038 CTACTATAGAGCCTATTATTAGG - Intergenic
945223565 2:207508780-207508802 ATATTAAAGAACATCTTAGTAGG - Intergenic
945962113 2:216146512-216146534 CTTTTAAACAACTTATAAATTGG - Intronic
946509696 2:220341663-220341685 CTAATAAAGAATCTAGTAACAGG - Intergenic
947507303 2:230717972-230717994 CTATTAAAGATCATACAAATAGG - Intronic
1168742590 20:205691-205713 ATATTAAAGGACCCATTAGTGGG + Intergenic
1170482536 20:16781025-16781047 TTATTAGAGAAGCTATTAACAGG - Intergenic
1171314159 20:24172925-24172947 CTTTTTAAGAATATATTAATTGG + Intergenic
1174888346 20:54360884-54360906 ATATGCAAGAACCTATTAACTGG + Intergenic
1181575953 22:23794954-23794976 CAATTAAAAAACCAAGTAATTGG + Intronic
1183158284 22:36092436-36092458 CTATTAAAAAAAAAATTAATAGG - Intergenic
1185421347 22:50736074-50736096 CTGTTAAAGAAAATATTATTCGG - Intergenic
949716381 3:6936259-6936281 CTATTACAGAACCTCTTGATGGG - Intronic
956956542 3:74347804-74347826 CCATCAATGAACCTTTTAATGGG - Intronic
958033664 3:88146359-88146381 CCATTTAAGGAGCTATTAATAGG - Intronic
958110549 3:89137963-89137985 CTATTAAAAATCCTATTGCTGGG - Intronic
958568425 3:95846619-95846641 CTAATAACTAAACTATTAATAGG + Intergenic
958951419 3:100420756-100420778 CTATGAAAGACCCTGTTAAGAGG - Intronic
961754187 3:129117854-129117876 CTATAAAGGAACCAATTAACAGG + Intronic
963192869 3:142492816-142492838 CTAGTAAAGAAGTTATAAATTGG + Intronic
964169943 3:153758162-153758184 CTATTTAAGTAGATATTAATAGG + Intergenic
964616227 3:158668962-158668984 CTATAAAATACACTATTAATGGG - Intronic
966010166 3:175065369-175065391 CTCTGAAAGAATCTAATAATAGG - Intronic
967043346 3:185714650-185714672 ATATTAAAGAACCTATGGTTAGG + Intronic
972145178 4:36015137-36015159 TTATTTAAGAAACTATTATTTGG + Intronic
972683024 4:41325166-41325188 CTATTATAGAACCTAAGGATTGG - Intergenic
972782293 4:42296596-42296618 CTAATAGAGAACCTATAAACTGG - Intergenic
974737045 4:65949254-65949276 CCATGAAATAACATATTAATAGG - Intergenic
977112097 4:92970443-92970465 TTATTAAACAATCTATTATTAGG - Intronic
977753603 4:100638112-100638134 CTTATAAAGAACAAATTAATTGG - Intronic
978751556 4:112253815-112253837 ATATTACACAACCTATTAAGTGG + Intronic
978861896 4:113460268-113460290 ACATTAAAGCACCTATTAATTGG - Intronic
979837677 4:125392688-125392710 ATATAAAAGAACCTAAAAATAGG + Intronic
981045635 4:140262619-140262641 CTATGAGAGAACGTATTAGTCGG + Intronic
982796475 4:159651413-159651435 CTTTTAAAGAACCTGTCCATAGG + Intergenic
982922762 4:161296498-161296520 CTATTAAAGAAAAAGTTAATAGG + Intergenic
983868434 4:172796581-172796603 CTATAAAAGAAAGTATTAAGGGG - Intronic
983968295 4:173841456-173841478 CTATTATAGTAAATATTAATGGG - Intergenic
986720645 5:10558684-10558706 CTATTAAAAGACCTACTGATCGG - Intergenic
987768246 5:22264286-22264308 CTATTAAATCACATATTCATGGG - Intronic
987803321 5:22727182-22727204 CTATTCAAGCTCCTGTTAATTGG - Intronic
988930283 5:36030357-36030379 CTATTAAAGGACCTCTGAGTGGG + Intergenic
990859066 5:60305179-60305201 TTAATAAAGAACCAATAAATTGG + Intronic
991988178 5:72311114-72311136 CTATGAGAGACCCTATTATTGGG + Intronic
994038028 5:95224982-95225004 GTAATAAAGAACATATTAAGAGG + Intronic
994518308 5:100797451-100797473 CTTTTAAAATGCCTATTAATTGG + Intergenic
995087308 5:108127640-108127662 CTATTAAAGATTTTTTTAATTGG - Intronic
995916147 5:117247337-117247359 CTATTTAAGAACCAATCAAATGG - Intergenic
997773915 5:136581125-136581147 CTATTAATAAATGTATTAATGGG + Intergenic
1000711235 5:164581574-164581596 CTATTAGAGACCCTTTAAATTGG + Intergenic
1002205178 5:177557796-177557818 CTATTTAAGAACTTATTCAATGG + Intergenic
1004794361 6:19064561-19064583 TTCTTAAAGAACATCTTAATAGG - Intergenic
1007814084 6:44507960-44507982 CTATGAAAGAACATGTGAATTGG + Intergenic
1008264893 6:49412950-49412972 CTATTAGAGCATTTATTAATTGG - Intergenic
1009227687 6:61033506-61033528 ATATTAAGGAACATATTAAAGGG + Intergenic
1010136389 6:72558941-72558963 ATCTTAAAAAACGTATTAATTGG - Intergenic
1011202086 6:84847680-84847702 ATATTAAATAACCATTTAATTGG - Intergenic
1012729088 6:102857650-102857672 ATATTAAAGAACCTAATTTTAGG + Intergenic
1013030384 6:106326608-106326630 CTAATAAAGAATCTTTGAATTGG + Intergenic
1014395096 6:120917695-120917717 CTGTTGAAGAACCTTGTAATAGG - Intergenic
1015230095 6:130904990-130905012 CTATTCAAAAAATTATTAATGGG + Intronic
1015967511 6:138709976-138709998 CTATAAAGAAATCTATTAATGGG - Intergenic
1017158942 6:151347707-151347729 GCATTAAAGAAAGTATTAATTGG + Intronic
1018367340 6:163134616-163134638 CTATTAATGTACATCTTAATTGG + Intronic
1019888890 7:3929474-3929496 CTTATAAGGAACCTATAAATAGG + Intronic
1021118617 7:16772091-16772113 TTATTAATGAGCCTATTAGTTGG + Intronic
1022119681 7:27295904-27295926 TTATTAGAGAGCTTATTAATAGG + Intergenic
1022881547 7:34592981-34593003 CTATTCAAGAACCATTTCATAGG - Intergenic
1023277736 7:38538642-38538664 CTATTAAAAAGCCTCTTAACTGG - Intronic
1023801544 7:43839205-43839227 ATGTTAAAGAAATTATTAATCGG + Intergenic
1027356257 7:77358884-77358906 TGTTTAAAGAAACTATTAATAGG + Intronic
1027821084 7:83045579-83045601 CAACTAAAGAACTTACTAATAGG - Intronic
1027848376 7:83415938-83415960 CTGTGAAAGAATGTATTAATGGG - Intronic
1028225062 7:88240986-88241008 CTGTTAAGTGACCTATTAATTGG + Intergenic
1028237392 7:88378854-88378876 CTACTAAGGAACTTATTCATGGG - Intergenic
1028969723 7:96845223-96845245 CTATGAAAGACTCTATTAAAAGG + Intergenic
1030717444 7:112826327-112826349 CTATTGAAGAAATTATGAATTGG - Intronic
1033274233 7:139959117-139959139 TTATTAAAGATCCAATTACTGGG + Intronic
1034056295 7:148038648-148038670 CAATTAAAGAAACATTTAATGGG - Intronic
1037464377 8:19145135-19145157 CTATTAAAATACCTACTACTTGG + Intergenic
1039244050 8:35588563-35588585 CTATTAAACAAACAATTAAGAGG - Intronic
1040950078 8:52929660-52929682 CTGTTAAAGAACGAATTGATAGG - Intergenic
1044422643 8:92015568-92015590 TTATTAATGTACATATTAATGGG - Intronic
1044644080 8:94419633-94419655 CTATTAAAGAAAATATTAAATGG - Intronic
1045210477 8:100092805-100092827 CTATGACTGAAACTATTAATTGG + Intronic
1047425420 8:124741075-124741097 ATTTTAAAGAATCCATTAATGGG - Intergenic
1050710591 9:8457915-8457937 CTATAAAAGACACTATTCATTGG + Intronic
1050853833 9:10324234-10324256 CTATCAAAGCATCTAATAATTGG - Intronic
1056496148 9:87157415-87157437 GTATAAAATAACCTATAAATAGG + Exonic
1057997514 9:99831928-99831950 TTATGAAATGACCTATTAATAGG + Intronic
1058009013 9:99954161-99954183 CTATTAAAGACCTAATTACTAGG + Intronic
1058495226 9:105551646-105551668 ATATTAAAGAACATTTTAATTGG - Intronic
1059050909 9:110924365-110924387 CTTTTAAAGAATCTATAAAGTGG + Intronic
1186577606 X:10783187-10783209 CTATTTAAGAATGTAGTAATGGG - Intronic
1186706966 X:12150885-12150907 ATATTAAAGAACCTATGATCAGG + Intronic
1187368624 X:18685316-18685338 GAATTAAACAACCTACTAATTGG - Intronic
1188412818 X:29895123-29895145 CTCTTAAAGAACAGATGAATGGG - Intronic
1188526685 X:31095083-31095105 CTAATAATGAACCCATTGATGGG - Intergenic
1189060860 X:37752208-37752230 CTATCACAGAACCTACTAGTAGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189791098 X:44605781-44605803 CCAATAAAGAACATATAAATGGG - Intergenic
1189996153 X:46640570-46640592 CTATGAAAGACCCTATTAAAAGG + Intronic
1192041080 X:67622077-67622099 ATATTAAAGAAGCTATTTACTGG - Intronic
1192111996 X:68374414-68374436 CTATGAAAGACCCTAATAAGAGG + Intronic
1192461769 X:71323057-71323079 CTATTAAAAAAAATAGTAATAGG - Intergenic
1194162124 X:90466836-90466858 CTAATTAGGAACCTAATAATAGG + Intergenic
1196328944 X:114445028-114445050 CTTTTAAAGTACTTACTAATAGG + Intergenic
1197713674 X:129690177-129690199 CTAATAAAGAACATTCTAATGGG - Intergenic
1197924091 X:131628304-131628326 CTGTTAAATAACCTCTTAAATGG - Intergenic
1199701622 X:150381991-150382013 TTGTGAAAGAACCTATTAAAAGG - Intronic
1200508400 Y:4044577-4044599 CTAATTAGGAACCTAATAATAGG + Intergenic
1201348501 Y:13011867-13011889 TTTTTAAAGATCATATTAATAGG + Intergenic