ID: 906364667

View in Genome Browser
Species Human (GRCh38)
Location 1:45196675-45196697
Sequence TGGGCTTCAGCCGGGCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1320
Summary {0: 1, 1: 3, 2: 15, 3: 175, 4: 1126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906364667_906364673 9 Left 906364667 1:45196675-45196697 CCACCACGCCCGGCTGAAGCCCA 0: 1
1: 3
2: 15
3: 175
4: 1126
Right 906364673 1:45196707-45196729 TCTTTAAAATCAAATTTTTGAGG 0: 1
1: 0
2: 3
3: 115
4: 1204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906364667 Original CRISPR TGGGCTTCAGCCGGGCGTGG TGG (reversed) Intronic
900017964 1:167421-167443 TGGAATTCATCTGGGCGTGGTGG - Intergenic
900048222 1:526017-526039 TGGAATTCATCTGGGCGTGGTGG - Intergenic
900589776 1:3454496-3454518 TGGGCTCCAGCCGGCCCAGGTGG + Exonic
900618214 1:3574928-3574950 TTGGCTCAAGCCAGGCGTGGTGG - Intronic
900631792 1:3640385-3640407 TGAGCATCAGCAGGGCGGGGTGG + Intronic
900631842 1:3640607-3640629 TGAGCGTCAGCAGGGCGGGGTGG + Intronic
900694820 1:4003149-4003171 TGCGTCTCAGCCGGGCATGGTGG + Intergenic
900718671 1:4161195-4161217 TGGACTCGAGCCGGGCGCGGTGG - Intergenic
901090787 1:6639617-6639639 TGGGCCTCGGCTGGGCGTGGTGG - Intronic
901147488 1:7075948-7075970 TGAGATTGGGCCGGGCGTGGTGG - Intronic
901333187 1:8426165-8426187 TGTCTTTCAGCCGGGCGCGGTGG + Intronic
901421368 1:9153451-9153473 TGCTCTTAGGCCGGGCGTGGTGG + Intergenic
901547714 1:9971597-9971619 TTGGCTTTGGCTGGGCGTGGTGG - Intronic
901601717 1:10427886-10427908 TTTAGTTCAGCCGGGCGTGGTGG - Intergenic
901707211 1:11083234-11083256 TTGGCTTCAGCCAGGTGAGGTGG - Intronic
901721849 1:11205008-11205030 TGGGCTCCAGCAGGGCATGAAGG + Intronic
901829937 1:11886210-11886232 TGGGACTCAGCTGGGCGAGGAGG + Intergenic
901863409 1:12088909-12088931 TGGGCTTCAGCTGAGTGTGCTGG + Intronic
901927732 1:12577535-12577557 TGAGCTACGGCCAGGCGTGGTGG + Intronic
902062968 1:13660732-13660754 TGTGTGTCAGCCGGGCATGGTGG + Intergenic
902351977 1:15863046-15863068 TGGGATTCGGCCGGGAGCGGTGG - Intronic
902405810 1:16182849-16182871 TAGTCATCGGCCGGGCGTGGTGG + Intergenic
902557726 1:17256747-17256769 CAGGCTTCAGCCAGGCGCGGTGG + Intronic
902595718 1:17508228-17508250 TGGGCTGCAGGTGGGCGTCGGGG + Intergenic
902717251 1:18281270-18281292 TGGCTTTCTGCCGGGCATGGTGG + Intronic
902995639 1:20222689-20222711 TGGGGTTCAGAGGGGCGAGGTGG + Intergenic
903041844 1:20536593-20536615 TGTGTTTTAGCCAGGCGTGGTGG + Intergenic
903063989 1:20688334-20688356 TGGGCTTGGGCCAGGCGCGGTGG - Intronic
903139544 1:21330987-21331009 TTGGATTCAGCCAGGGGTGGTGG + Intronic
903148851 1:21390858-21390880 TGGGTTTGGGCTGGGCGTGGTGG + Intergenic
903223964 1:21884694-21884716 GGGGCTGCAGCCGGCTGTGGTGG + Intronic
903506831 1:23842281-23842303 TTGGATACAGCCAGGCGTGGTGG + Intergenic
903557012 1:24201391-24201413 TGGGCTTGGGCCGGGCGCCGTGG + Intergenic
903612995 1:24630463-24630485 TGTACTGCAGCTGGGCGTGGTGG + Intergenic
903729191 1:25477956-25477978 TGTGTTTCAGCTGGGCGTGGTGG + Intronic
904069600 1:27783620-27783642 TAGGACTCAGCTGGGCGTGGTGG - Intronic
904080071 1:27866688-27866710 TGGGCATGGGCCGGGCATGGTGG + Intergenic
904116726 1:28167924-28167946 TGGTTTTCAGTTGGGCGTGGTGG - Intronic
904479353 1:30784319-30784341 TGGGAAGTAGCCGGGCGTGGTGG - Intergenic
904637874 1:31898383-31898405 TGGGCCTGGGCCGGGCGTGGTGG - Intergenic
904915780 1:33969823-33969845 AGAAATTCAGCCGGGCGTGGTGG + Intronic
905080651 1:35317143-35317165 AGTGCTTCAGCCAGGCGTGGTGG + Intronic
905308457 1:37034299-37034321 TGGGCGGCAGCCAGGCGGGGCGG - Intergenic
905347131 1:37318776-37318798 TGTGCTTCAGGAGGGTGTGGGGG + Intergenic
905392550 1:37646795-37646817 TGCACTTCTGCCGGGTGTGGTGG + Intergenic
905542470 1:38771358-38771380 TGGGCTGGAGCTGGGCATGGTGG + Intergenic
905911899 1:41661353-41661375 TGGGCTTCAGACAGAAGTGGTGG - Intronic
906272392 1:44490178-44490200 AAGGTATCAGCCGGGCGTGGTGG + Intronic
906364667 1:45196675-45196697 TGGGCTTCAGCCGGGCGTGGTGG - Intronic
906484693 1:46225047-46225069 CAGGCCTCAGCCGGGCATGGTGG - Intergenic
906859798 1:49347570-49347592 TTGCTTTCAGCTGGGCGTGGAGG + Intronic
906912699 1:49972194-49972216 TGCACTTGGGCCGGGCGTGGTGG - Intronic
906977811 1:50594570-50594592 TAGGCTTGGGCCAGGCGTGGTGG + Intronic
906997844 1:50816489-50816511 TGGGCAAAAGCCAGGCGTGGTGG - Intronic
907355303 1:53867649-53867671 TCAGTGTCAGCCGGGCGTGGTGG - Intronic
907450855 1:54544995-54545017 TGGGCCTCGGCCGGGCGCAGTGG + Intronic
907894986 1:58679738-58679760 TGTGAGTCAGCCGGGCGTGGTGG + Intronic
908252845 1:62278680-62278702 TGTGGGTCAGCCGGGCGTGGTGG - Intronic
908454903 1:64294111-64294133 TGGCCTTCGGCCGGGCACGGTGG + Intergenic
909360152 1:74750274-74750296 AGGGCCTCAGCTGGGCGCGGTGG + Intronic
909760822 1:79284549-79284571 TAGCTTTCAGCCGGGCGCGGTGG + Intergenic
909817109 1:80009446-80009468 TGGGCTTCGGCTGGGCGCGATGG + Intergenic
910026843 1:82665522-82665544 TTGTCATTAGCCGGGCGTGGTGG + Intergenic
910585353 1:88873340-88873362 TGGGCATTAGCCTGGCGTGGTGG - Intronic
910854932 1:91685607-91685629 AGTGTTTCAGCCGGGCGTGGTGG - Intronic
910910331 1:92227253-92227275 TGGTATTTGGCCGGGCGTGGTGG + Intronic
911350293 1:96745777-96745799 TTGACTTAGGCCGGGCGTGGTGG + Intronic
911625612 1:100120761-100120783 TGGGCTAGGGCCGGGCGCGGTGG + Intronic
911835879 1:102617978-102618000 TGTGGTACAGCCGGGCGTGGTGG - Intergenic
912067049 1:105757170-105757192 TGGGCTTCAGCAGGTCCTGAAGG + Intergenic
912370826 1:109172805-109172827 GGGTCTTCTGCCGGGCATGGTGG + Intronic
912766028 1:112411833-112411855 TTAGATTTAGCCGGGCGTGGTGG - Intronic
912766492 1:112416777-112416799 TGAAATTCTGCCGGGCGTGGTGG - Intronic
912835042 1:112988807-112988829 TGGTTCTCGGCCGGGCGTGGTGG + Intergenic
912935199 1:113997639-113997661 TTGGCTTTAGCTGGGCATGGTGG + Intergenic
913265098 1:117035837-117035859 GAGTCTTCTGCCGGGCGTGGTGG - Intronic
913460146 1:119076850-119076872 AGATCTGCAGCCGGGCGTGGTGG + Intronic
914254533 1:145950651-145950673 TGTACTACAGCCGGGCGTGGTGG - Intronic
914455087 1:147828922-147828944 TTAGCATCAGTCGGGCGTGGTGG + Intergenic
914576761 1:148978733-148978755 AAGGTTTGAGCCGGGCGTGGTGG - Intronic
914722879 1:150304021-150304043 GAGACATCAGCCGGGCGTGGTGG + Intronic
914873715 1:151496892-151496914 GGGATTTCAGCCGGGAGTGGTGG - Intergenic
914916773 1:151823916-151823938 GGAGGTGCAGCCGGGCGTGGTGG - Intronic
914935666 1:151977549-151977571 TGGGAATTAGCCAGGCGTGGTGG - Intergenic
916067483 1:161148085-161148107 AGGAATTCAGCCAGGCGTGGTGG - Intergenic
916201244 1:162273450-162273472 GAGGCTTCGGCCGGGCGCGGTGG - Intronic
917353529 1:174102881-174102903 TGAACTTTAGCCGGGCGCGGTGG + Intergenic
917859659 1:179134257-179134279 TTGGCTTCAGCCAGGCACGGTGG + Intronic
917862476 1:179160224-179160246 TCTACTTCAGCCGGGGGTGGTGG + Intronic
918243290 1:182638636-182638658 AGGTGCTCAGCCGGGCGTGGTGG + Intergenic
918659428 1:187071697-187071719 TGGGCGTGGGCCGGGCGGGGTGG - Intergenic
918933895 1:190894905-190894927 TGAGCTTCAGCCAGGCGCGGTGG - Intergenic
919550827 1:198984151-198984173 CAGGCTTCGGCCGGGCGCGGTGG - Intergenic
920017288 1:202922771-202922793 GGATCTTCAGCTGGGCGTGGTGG - Intronic
920243077 1:204567983-204568005 TAGTGTTCAGCCGGGCATGGTGG - Intergenic
920519508 1:206612810-206612832 CAGGCTTCGGCCGGGCGCGGTGG + Intergenic
921021405 1:211238914-211238936 TGAACATCAGCTGGGCGTGGTGG - Intergenic
921140911 1:212305308-212305330 GGGGCTGGAGCCGGGCGCGGTGG - Intronic
921301796 1:213758288-213758310 TGTGATTCAGCAGGGCATGGTGG + Intergenic
921355212 1:214279612-214279634 TGGACATCAGCCGGCTGTGGTGG - Intergenic
921374481 1:214459752-214459774 TGGGGATCGGCCAGGCGTGGTGG - Intronic
921756944 1:218868644-218868666 TGACTTTCAGCCGGGCATGGTGG + Intergenic
921866408 1:220091884-220091906 TGCGCTTCAGCTGGGCGCGGTGG - Intergenic
922146068 1:222946084-222946106 TGAGCCTTGGCCGGGCGTGGTGG + Intronic
922289736 1:224200239-224200261 TGCTTTTCGGCCGGGCGTGGTGG + Intergenic
922674541 1:227542466-227542488 TGGGCCGGAGCCGGGCGTGGGGG + Intergenic
922978645 1:229805988-229806010 TGAGATTTGGCCGGGCGTGGTGG + Intergenic
923096764 1:230781154-230781176 TGTCCTGCAGCCTGGCGTGGTGG - Intronic
923377762 1:233382046-233382068 AGGACTTCAGCCAGGTGTGGTGG + Intronic
923410076 1:233699416-233699438 TGGAGTTCGGCCGGGCGCGGTGG + Intergenic
923539672 1:234878892-234878914 TGCTCCTCAGCCGGGCGCGGTGG + Intergenic
923893662 1:238243919-238243941 TGTGCATCGGCCGGGCGCGGTGG + Intergenic
924064003 1:240205746-240205768 AGGGCATTGGCCGGGCGTGGTGG - Intronic
924347991 1:243090857-243090879 TGGAATTCATCTGGGCGTGGTGG - Intergenic
924471980 1:244350604-244350626 TTCACTTAAGCCGGGCGTGGTGG - Intergenic
924538594 1:244959864-244959886 TGGGGATCAGCCGGGCGCGGTGG - Intergenic
924578356 1:245301116-245301138 TGTGCCTCGGCCGAGCGTGGTGG - Intronic
924697421 1:246415002-246415024 CTGGCTCCAGCCGGGCGCGGTGG - Intronic
924714263 1:246557954-246557976 GGTAATTCAGCCGGGCGTGGTGG - Intronic
924716361 1:246578383-246578405 TTGCCTTCGGCTGGGCGTGGTGG + Intronic
924754857 1:246931708-246931730 GCGGCTTCAGCCGGGCGGAGGGG - Intronic
924800171 1:247323627-247323649 TGGAGTTCAGCCGTGTGTGGTGG + Intronic
1062848844 10:728087-728109 TGGATCTCAGCCGGGCGCGGTGG + Intergenic
1062864048 10:834861-834883 TGGTCCTCGGCCGGGCGCGGTGG + Intronic
1063489046 10:6446651-6446673 TGGGCATGGGCCGGGCATGGTGG - Intronic
1063500562 10:6549917-6549939 TGAATTTCAGCCGGGCGCGGTGG - Intronic
1063506656 10:6605945-6605967 TGGTCACCAGCCGGGCGCGGTGG - Intergenic
1064065003 10:12174151-12174173 AGGGGTTCAGCCGGGCGCAGTGG - Intronic
1064080903 10:12307296-12307318 GGGATTTCGGCCGGGCGTGGTGG + Intergenic
1064286315 10:13994462-13994484 TGGGCATTAGCCAGGCATGGTGG - Intronic
1064661373 10:17611282-17611304 AGGGCTTGGGCCGGGCGCGGTGG - Intronic
1064670274 10:17706664-17706686 TGGGCCTCGGCCGGGCGCGATGG - Intronic
1065514352 10:26510253-26510275 TCTGATTCAGCCGGGCATGGTGG - Intronic
1065579225 10:27154720-27154742 AGGAAATCAGCCGGGCGTGGTGG - Intronic
1065665448 10:28054964-28054986 TGGTAATCAGCCGGGCGTGGTGG - Intronic
1065888670 10:30101653-30101675 TTAGCCTGAGCCGGGCGTGGTGG - Intronic
1065929942 10:30470668-30470690 TGGGATGCAGCCGGACGTGGTGG + Intergenic
1066068183 10:31777805-31777827 TCTGCCTCAGCAGGGCGTGGTGG + Intergenic
1066107770 10:32170628-32170650 AGCGCTTCAGCTGGGCATGGTGG - Intergenic
1066123029 10:32309905-32309927 TGGGCTTTGGCCAGGTGTGGTGG + Intronic
1066964423 10:42249221-42249243 GAGGCTTTGGCCGGGCGTGGTGG + Intergenic
1066976377 10:42371570-42371592 TGGGTTTTGGCCGGGCGCGGTGG - Intergenic
1067892421 10:50148521-50148543 TTTGTTTCAGCCGGGCGCGGTGG + Intergenic
1067900854 10:50240113-50240135 TGTGAGTCAGCCGGGTGTGGTGG - Intronic
1068846100 10:61676772-61676794 TAATTTTCAGCCGGGCGTGGTGG + Intronic
1069427082 10:68297976-68297998 AGGGCTTTAGCTGGGCATGGTGG + Intronic
1069747970 10:70727806-70727828 TTGGCCTCGGCCGGGCGCGGTGG + Intronic
1069754705 10:70766575-70766597 TGGGCTTCAGACTTGCATGGGGG + Intergenic
1070047904 10:72857523-72857545 TGGGCTTTGGCCAGGCATGGTGG - Intronic
1070118509 10:73552501-73552523 TATACATCAGCCGGGCGTGGTGG + Intronic
1070130469 10:73652379-73652401 CTGGCTTCTGCCGGGCATGGTGG + Intronic
1070142110 10:73745872-73745894 TCGGTTTTGGCCGGGCGTGGTGG + Intronic
1070179797 10:74002410-74002432 TCCAATTCAGCCGGGCGTGGTGG - Intronic
1070268836 10:74931997-74932019 ATGCTTTCAGCCGGGCGTGGTGG - Intronic
1070800912 10:79243790-79243812 TGGGCTCCCTCCGGGCGCGGGGG + Intronic
1070945355 10:80386816-80386838 TGGGGGCCAGCCGGGCGCGGTGG + Intergenic
1071209895 10:83328256-83328278 TTGAATTCGGCCGGGCGTGGTGG - Intergenic
1071620317 10:87113036-87113058 TGTGGTCCAGCCGGGTGTGGTGG + Intronic
1072873372 10:99145167-99145189 AATGCTTCAGCCAGGCGTGGTGG + Intronic
1072977859 10:100074702-100074724 GGGTTTTCGGCCGGGCGTGGTGG - Intronic
1073315942 10:102580892-102580914 TAGGCTTGGGCTGGGCGTGGTGG + Intronic
1073490091 10:103847610-103847632 AGTGCTTCAGCTGGGCATGGTGG - Intronic
1073799546 10:107026330-107026352 TGGGTTTTGGCCGGGCATGGTGG + Intronic
1074333522 10:112544486-112544508 TCTGTCTCAGCCGGGCGTGGTGG - Intronic
1074721840 10:116271471-116271493 TGAGTTTCAGCCGGGCGGAGCGG - Intronic
1074840457 10:117345951-117345973 AGGGGTTCAGCCAGGCGCGGTGG + Intronic
1075107191 10:119548083-119548105 ATGTCTGCAGCCGGGCGTGGCGG + Intergenic
1075531653 10:123235176-123235198 TGAACTTGGGCCGGGCGTGGTGG - Intergenic
1075571911 10:123552375-123552397 TGAGAGTCAGCCGGGCGCGGTGG - Intergenic
1075871857 10:125776982-125777004 TTGGCATCGGCCGGGCGTGGTGG + Intergenic
1076067862 10:127463537-127463559 TGGGCTTCAGGCAGGCTGGGAGG - Intergenic
1076650423 10:131982818-131982840 TGGGAGCCAGCCTGGCGTGGGGG + Intergenic
1077053570 11:578836-578858 TGTGAATCAGCCGGGCGTGGTGG - Intronic
1077085889 11:750535-750557 TGAACTTCGGCCGGGTGTGGTGG + Intronic
1077086974 11:757994-758016 TGGGCATGGGCCAGGCGTGGTGG + Intronic
1077635047 11:3836609-3836631 TGAGCCTCAGCTGGGCATGGTGG + Intronic
1077812026 11:5647806-5647828 GGTGTCTCAGCCGGGCGTGGTGG - Intergenic
1078012869 11:7587058-7587080 TGGGCATCAACCGGGGTTGGTGG - Intronic
1078172436 11:8938534-8938556 TGATCTCCGGCCGGGCGTGGTGG - Intergenic
1078193900 11:9118795-9118817 TGGACTTCAGCCGGGCATGGTGG + Intronic
1078237048 11:9495154-9495176 TGGGCTAAGGCTGGGCGTGGTGG + Intronic
1078767990 11:14318209-14318231 TTGAGTGCAGCCGGGCGTGGTGG + Intronic
1078911758 11:15739265-15739287 TGAGCTTCAGCAGGCCATGGTGG + Intergenic
1079061590 11:17253390-17253412 TGCTCTTCTGCCCGGCGTGGTGG - Intronic
1079243250 11:18735526-18735548 TGGATTTAGGCCGGGCGTGGTGG + Intronic
1080045210 11:27800857-27800879 TGGGGCTCGGCCGGGCGCGGTGG - Intergenic
1080534362 11:33207271-33207293 TGGTTCTCAGCCGGGAGTGGTGG - Intergenic
1080546436 11:33323528-33323550 TGGAATCCAGCCGGACGTGGTGG - Intronic
1080989922 11:37519508-37519530 ATGGCTTCAGCCGGGCGTGGTGG - Intergenic
1081605051 11:44521838-44521860 TGGACAACAGCTGGGCGTGGTGG + Intergenic
1081686714 11:45048155-45048177 TGTGCTTTGGCTGGGCGTGGTGG - Intergenic
1081721680 11:45294140-45294162 TGGGAGTCATCCGGGCATGGTGG - Intergenic
1081722327 11:45299443-45299465 TGGGAGTCAGCCAGGCATGGTGG - Intergenic
1082029024 11:47591673-47591695 GGGGTTTCGGCCGGGCGCGGTGG - Intronic
1082034449 11:47633395-47633417 AGGGATACGGCCGGGCGTGGTGG - Intronic
1082837632 11:57663270-57663292 GGGATCTCAGCCGGGCGTGGTGG + Intergenic
1083152506 11:60801077-60801099 TGGGTTTCAGCCAGGGGTGGTGG - Exonic
1083389976 11:62341484-62341506 CTGTTTTCAGCCGGGCGTGGTGG - Intronic
1083438398 11:62659288-62659310 TGGACATTAGCCGGGCGTGGTGG + Intronic
1083453116 11:62759874-62759896 AGGGAGTCAGCCGGGCGCGGTGG + Intergenic
1083595721 11:63917511-63917533 TGGGCTCCACCCGGGCGGGCGGG - Intergenic
1083729234 11:64643874-64643896 TGGGGTTCATCCGGGTGGGGTGG - Intronic
1083744522 11:64727802-64727824 TGGGCTGAGGCCGGGCATGGTGG - Intronic
1083769488 11:64858473-64858495 TAGGCTCCAGCCAGGCATGGTGG - Intronic
1083872035 11:65494480-65494502 TAGGCTGGAGCCGGGCGTGGTGG - Intergenic
1083951048 11:65956422-65956444 TGAGCCTCGGCCGGGCGCGGTGG - Intronic
1083979945 11:66159148-66159170 AGGGTCTCGGCCGGGCGTGGTGG + Intronic
1084045756 11:66567013-66567035 TGGGTCTTGGCCGGGCGTGGTGG - Intronic
1084108805 11:66999410-66999432 TGTGTCTCAGCCAGGCGTGGTGG + Intergenic
1084121035 11:67069118-67069140 TTGGCATCAGCCGGGCTTGGTGG - Intronic
1084405384 11:68969105-68969127 TAGGTTTCGGCCGGGCGTGGTGG + Intergenic
1084602923 11:70157077-70157099 TTGGCTTCAGCCGGGCGTGGTGG + Intronic
1084658979 11:70536111-70536133 TGGGCTTCAGCCCAGGGTGAGGG - Intronic
1084764605 11:71299993-71300015 TGGCCTCCAGCCGGGCGTGGTGG + Intergenic
1084764781 11:71301285-71301307 TGGCCTCCAGCCGGGCATGGTGG - Intergenic
1084893378 11:72248278-72248300 AGGGCTTAAGCCAGGCATGGTGG - Intergenic
1085149673 11:74239865-74239887 TGAGCTTAGGCCGGGCATGGTGG - Intronic
1085161887 11:74355264-74355286 TTGGACTCAGCCAGGCGTGGTGG + Intronic
1085504712 11:77051082-77051104 CAGGCATCAGCCAGGCGTGGTGG - Intergenic
1085574670 11:77591580-77591602 AAGCCTTCAGCCGGGCGCGGTGG + Intronic
1085710836 11:78827774-78827796 TGGGCTTTGGCCGGGCGCAGTGG - Intronic
1087062287 11:93991934-93991956 TGGGCATTAGCCAGGTGTGGTGG + Intergenic
1087356540 11:97100811-97100833 TTGCCTTCAGCCAGGCGTGGTGG - Intergenic
1087855498 11:103087455-103087477 GGGGTTTCAGCCGGGTGTGGTGG - Intronic
1089251443 11:117165237-117165259 TCTGCTTCAGCCAGGCGTGATGG - Intronic
1089388291 11:118082271-118082293 TGAGGCTCAGCCGGGTGTGGTGG + Intronic
1089435527 11:118462239-118462261 GGTGCTGCAGCCGGGCATGGTGG - Intronic
1089592783 11:119555426-119555448 TAGGGATCGGCCGGGCGTGGTGG + Intergenic
1089702081 11:120251259-120251281 TGGTTGTCAGCCGGGCATGGTGG - Intronic
1089734500 11:120540331-120540353 TGGGGCTCGGCTGGGCGTGGCGG + Intronic
1089964089 11:122641240-122641262 CTGGCTTGAGCCGGGCGAGGTGG + Intergenic
1090026357 11:123170726-123170748 CAGGCTTCGGCTGGGCGTGGTGG - Intronic
1090053600 11:123402302-123402324 TGGTCCTTGGCCGGGCGTGGTGG - Intergenic
1090301075 11:125640252-125640274 TGGGTTTTGGCCGGGCGCGGTGG + Intronic
1090336209 11:125968007-125968029 TAGGTTTTAGCCAGGCGTGGTGG - Intronic
1090596683 11:128328216-128328238 GGGTAATCAGCCGGGCGTGGTGG + Intergenic
1090760644 11:129834141-129834163 TGGACATTAGCCGGGCGCGGTGG + Intronic
1090792744 11:130105988-130106010 CAGGCATCGGCCGGGCGTGGGGG - Intronic
1091530123 12:1346653-1346675 TGGTTTTCGGCCGGGCGCGGTGG + Intronic
1091533978 12:1388072-1388094 TTAGCCTCGGCCGGGCGTGGTGG + Intronic
1091543499 12:1484016-1484038 TTTGTTCCAGCCGGGCGTGGTGG + Intronic
1091771292 12:3152873-3152895 GGGGGCTCAGCTGGGCGTGGTGG - Intronic
1091792739 12:3281021-3281043 TGGGCTTCAGCCGGGCCCACTGG - Intronic
1091862077 12:3794775-3794797 TGGGTGTAGGCCGGGCGTGGTGG + Intronic
1091978920 12:4850135-4850157 GGGGGTTCAGCCGGGCCTAGAGG + Intronic
1092456277 12:8645856-8645878 TGTGTATCAGCCGGGCGTGGTGG - Intronic
1092503507 12:9071105-9071127 AGATCCTCAGCCGGGCGTGGTGG - Intronic
1092644090 12:10550895-10550917 TGAGCCTCGGCCGGGCGCGGTGG + Intergenic
1092797802 12:12130471-12130493 TAGAAATCAGCCGGGCGTGGTGG - Intronic
1093026743 12:14252523-14252545 TGAAAGTCAGCCGGGCGTGGTGG + Intergenic
1093075399 12:14752903-14752925 TTGGTCTCAGCCGGGCGTAGTGG + Intergenic
1093127888 12:15352361-15352383 AGGTTTTCAGCCAGGCGTGGTGG + Intronic
1093337816 12:17930567-17930589 TGGGCTTCAGCGTGGTGTAGAGG - Intergenic
1093423445 12:19000816-19000838 TGATATTCAACCGGGCGTGGTGG - Intergenic
1093494147 12:19736091-19736113 TCGGTTTCAGCTGGGCATGGTGG - Intergenic
1093539152 12:20260395-20260417 GTGATTTCAGCCGGGCGTGGTGG + Intergenic
1093685822 12:22053004-22053026 TGCAGTTCAGCCGAGCGTGGTGG + Intronic
1094551691 12:31457999-31458021 AGTGCTTCGGCTGGGCGTGGTGG - Intronic
1094584619 12:31766618-31766640 TGGTTTGCAGCCAGGCGTGGTGG + Intergenic
1095563575 12:43594419-43594441 TACCATTCAGCCGGGCGTGGTGG + Intergenic
1095594591 12:43944824-43944846 TGGGCCACAGCTGGGCATGGTGG + Intronic
1096112304 12:49036639-49036661 TGGGTGTGAGCCGGGCGCGGTGG - Intronic
1096409406 12:51366203-51366225 TGTACTTGGGCCGGGCGTGGTGG - Intronic
1096529257 12:52233090-52233112 TGGGCTTCGGCGGGGCGGGCGGG + Intronic
1096688518 12:53305153-53305175 TGGGTTTAGGCCGGGCGCGGTGG - Intronic
1096747478 12:53738292-53738314 TGGGATTCAGCGAGGTGTGGCGG + Intergenic
1097012342 12:55962121-55962143 TGCACTTCAGCCGGGCGCAGTGG - Intronic
1097042884 12:56166436-56166458 TGCACATCAGCCGGGCGCGGTGG - Intronic
1097089179 12:56492066-56492088 TGTGGACCAGCCGGGCGTGGTGG + Intergenic
1097220180 12:57444967-57444989 CAGGCTTCAGCCAGGCGTGGTGG - Intronic
1097243162 12:57590270-57590292 CGGGCATTAGCCGGGCGTGGTGG - Intergenic
1097395909 12:59074442-59074464 GAGGCTCCAGCTGGGCGTGGTGG - Intergenic
1097840538 12:64317471-64317493 TGTGTTTCGGCCAGGCGTGGTGG + Intronic
1098335358 12:69398861-69398883 TGTGCTTTGGCCGGGTGTGGTGG + Intergenic
1098468923 12:70821949-70821971 TAGGTTTCGGCCGGGCGTGGTGG - Intronic
1098536985 12:71604189-71604211 TGGTCTTGAGACAGGCGTGGTGG - Intergenic
1098950641 12:76637284-76637306 TTGGGTTCGGCTGGGCGTGGTGG - Intergenic
1099218070 12:79877801-79877823 TGAGTATCAGCCGGGTGTGGTGG - Intronic
1099934647 12:89110640-89110662 GCAGCCTCAGCCGGGCGTGGTGG + Intergenic
1100199084 12:92279277-92279299 TGAGCTCCAGCCGGACTTGGAGG + Intergenic
1100218369 12:92477304-92477326 TTGGCTTCGGAGGGGCGTGGAGG + Intergenic
1100471527 12:94897843-94897865 AGATCATCAGCCGGGCGTGGTGG + Intronic
1100543849 12:95583008-95583030 GAGGCTAGAGCCGGGCGTGGTGG + Intergenic
1100600540 12:96108626-96108648 TGTGATTCAGCTGGGGGTGGGGG - Intergenic
1100869278 12:98894377-98894399 TGCGCTTAACCCGGGGGTGGTGG + Intronic
1100972344 12:100083899-100083921 TTGGCTTAGGCCGGGCGTGGTGG + Intronic
1101201797 12:102444112-102444134 AGCACTTCAGCCGGGCGTGGTGG - Intronic
1101489782 12:105200119-105200141 CTGGGTTCAGCCGGGCGCGGTGG - Intronic
1101888838 12:108693083-108693105 TGTGGTTTAGCCGGGCGCGGTGG - Intronic
1101911282 12:108861874-108861896 TGTGGTTCAGCTGGGCATGGTGG + Intronic
1102028573 12:109727208-109727230 TGAGCTTGAGCCGGGCCGGGCGG + Intronic
1102069338 12:110004326-110004348 TGAATTCCAGCCGGGCGTGGTGG + Intronic
1102280357 12:111613860-111613882 TTGGCTTCGGCCGGGAGCGGTGG - Intergenic
1102380786 12:112465142-112465164 GGTGCTTGGGCCGGGCGTGGTGG + Intronic
1102542440 12:113631943-113631965 TAGAATTCAGCTGGGCGTGGTGG - Intergenic
1102566293 12:113799551-113799573 TGAGCTTCAGCCGGGCGCAGTGG - Intergenic
1102960196 12:117087688-117087710 TGTGCTTTAGCTGGGCGTGCTGG + Intronic
1102971092 12:117167457-117167479 AGAACCTCAGCCGGGCGTGGTGG + Intronic
1102992793 12:117327088-117327110 TGGGCATCAGGTGGGCATGGAGG - Intronic
1103110259 12:118270962-118270984 TGACATTTAGCCGGGCGTGGTGG - Intronic
1103275572 12:119708773-119708795 TGGACTTGGGCCGGGCGTGGTGG - Intronic
1103342644 12:120229258-120229280 TGTGCTGCAGTCGGGGGTGGGGG - Intronic
1103365150 12:120376815-120376837 TGTGTATCAGCCAGGCGTGGTGG - Intergenic
1103430768 12:120883812-120883834 TAGACGTAAGCCGGGCGTGGTGG + Intronic
1103470864 12:121179860-121179882 TGGGGTTCCGCCTGGCGTGGTGG + Intronic
1103535433 12:121630485-121630507 CTGGCTTCAGCCAGGCATGGTGG - Intronic
1103577720 12:121890957-121890979 TGGGTTTGGGCCGGGCCTGGTGG + Intronic
1103679141 12:122679602-122679624 TGGGCTTCCGCCCAGCATGGCGG + Intergenic
1103843235 12:123882503-123882525 GTGGCTTCGGCCGGGCGTGGTGG + Intronic
1104001970 12:124865624-124865646 AGGACTTCAGGGGGGCGTGGAGG - Intronic
1104023535 12:125009812-125009834 TGGACATCGGCCGGGCATGGTGG + Intronic
1104075336 12:125384228-125384250 AGAGTTTCAGCCGGGCGTGATGG - Intronic
1104356425 12:128090595-128090617 AAGGATTGAGCCGGGCGTGGTGG - Intergenic
1104656175 12:130575223-130575245 TAGGCTACTGCCGGGGGTGGGGG - Intronic
1104977696 12:132559684-132559706 AGGGCGACAGCCGGGCGCGGTGG - Intronic
1105691410 13:22843450-22843472 TGGTTTGCGGCCGGGCGTGGTGG - Intergenic
1105926346 13:25012125-25012147 ACTGCTTCAGACGGGCGTGGTGG + Intergenic
1105933134 13:25071056-25071078 TGGGCGTCGGCCGGGCGCGGTGG + Intergenic
1105940688 13:25145582-25145604 TGGCTTTTGGCCGGGCGTGGTGG + Intergenic
1106018149 13:25888571-25888593 TAGAGTTCAGCCGGGTGTGGTGG + Intronic
1106099656 13:26683181-26683203 TGGGAAACAGCCGGGCGCGGTGG + Intronic
1106139291 13:26998194-26998216 TGTGTTTCAGCTGGGCGTGGTGG - Intergenic
1106232315 13:27830165-27830187 CGGACTTCACCCGGGCGCGGGGG - Intergenic
1107363800 13:39648344-39648366 AAGGGTTCAGCCAGGCGTGGTGG - Intergenic
1108077032 13:46691973-46691995 ATGGCATCAGCCAGGCGTGGTGG - Intronic
1108639490 13:52369737-52369759 TGTGCTTCGGCCGGGCGCGGTGG - Intergenic
1108684553 13:52807540-52807562 GAGGAATCAGCCGGGCGTGGTGG + Intergenic
1109045327 13:57403645-57403667 GGGGATTTAGCTGGGCGTGGTGG + Intergenic
1109303669 13:60615662-60615684 TTGCTTTGAGCCGGGCGTGGTGG - Intergenic
1110716456 13:78710390-78710412 TGGTCTTGGGCCGGGTGTGGTGG - Intergenic
1110973273 13:81795161-81795183 AGGGTTTGAGCCGGGCGCGGTGG + Intergenic
1111226327 13:85276710-85276732 AGGATTTCAGCCAGGCGTGGTGG + Intergenic
1111315857 13:86558274-86558296 TGGGATTTGGCCAGGCGTGGTGG + Intergenic
1112019143 13:95356691-95356713 TGGGTGCCGGCCGGGCGTGGTGG - Intergenic
1112277223 13:98032799-98032821 TGTGTCTCAGCCGGGCGCGGTGG + Intergenic
1112285173 13:98097500-98097522 AGGGACTCAGCAGGGCGTGGTGG - Intergenic
1112582001 13:100684552-100684574 TGGCATTCGGCTGGGCGTGGTGG + Intergenic
1113220518 13:108096236-108096258 TTGTTTTCAGCCGGGCGTGGTGG - Intergenic
1113260340 13:108554560-108554582 TCTGTCTCAGCCGGGCGTGGTGG + Intergenic
1113678504 13:112225306-112225328 TGGGCTTGGGCAGGGTGTGGTGG - Intergenic
1113803699 13:113100963-113100985 TTTGCTGCAGCCGGGCGCGGTGG - Intergenic
1113804320 13:113104461-113104483 TGGGCTTCAGCTGTGCTGGGTGG + Intergenic
1114178186 14:20342863-20342885 TAGCCATTAGCCGGGCGTGGTGG - Intergenic
1114302085 14:21387342-21387364 CGGGAGTCAGCCAGGCGTGGTGG + Intronic
1114516875 14:23306327-23306349 TGGGCTTCAGCCAGGCATTAGGG - Intronic
1114819950 14:26006803-26006825 TAGGTTTTGGCCGGGCGTGGTGG - Intergenic
1115179669 14:30608827-30608849 TAGGCCTTAGCCAGGCGTGGTGG + Intronic
1115222379 14:31070763-31070785 TGGGCTGAGGCCGGGCGCGGTGG + Intronic
1115257130 14:31415123-31415145 TAGGAACCAGCCGGGCGTGGTGG - Intronic
1115546930 14:34472290-34472312 GCGGCCTCAGCTGGGCGTGGTGG - Intergenic
1116893324 14:50290814-50290836 TGAAATTCAGCCAGGCGTGGTGG - Intronic
1117783642 14:59259755-59259777 TGAGATTAGGCCGGGCGTGGTGG + Intronic
1117800049 14:59433964-59433986 CGGGATTGGGCCGGGCGTGGTGG - Intronic
1117979421 14:61327961-61327983 TGGGCCTGGGCCGGGCGCGGTGG + Intronic
1118373610 14:65158195-65158217 TGTCCTTCAGCCGGGCGCGATGG - Intergenic
1118418901 14:65576988-65577010 TGGGCATAGGCCAGGCGTGGTGG - Intronic
1118456463 14:65949304-65949326 TGGTCTTTAGCCGGGCATGGTGG + Intergenic
1118834997 14:69471396-69471418 TGGGGATGAGCCAGGCGTGGTGG - Intergenic
1118852939 14:69598555-69598577 TGGGCATTGGCCGGGCGCGGTGG - Intergenic
1119447343 14:74677084-74677106 TAGATTCCAGCCGGGCGTGGTGG - Intronic
1119652858 14:76395885-76395907 AGGCCTTCAGCCGGGCATGGTGG + Intronic
1120118030 14:80643039-80643061 TGTGGGTCAGCCGGGCGCGGTGG - Intronic
1120319591 14:82942128-82942150 TAGGTTTCAGCCAGGCGCGGTGG - Intergenic
1120754012 14:88224895-88224917 TGGCTTTCTGCCGGGCATGGTGG - Intronic
1120784686 14:88522137-88522159 TGGGCTTAGGCCGGGCGTGGTGG + Intronic
1121362870 14:93278123-93278145 TGTTTTTCAGCCAGGCGTGGTGG + Intronic
1121755697 14:96400325-96400347 TGGTTTTGGGCCGGGCGTGGTGG - Intronic
1121771148 14:96541173-96541195 ATGGTTTCAGCCGGGTGTGGTGG - Intronic
1121975456 14:98399320-98399342 TGTGCTCCAGCCGGGTGTGGTGG - Intergenic
1122233740 14:100320532-100320554 TGGGCTTCAGGCAGGCAGGGTGG - Intergenic
1122427138 14:101617560-101617582 CTGGGGTCAGCCGGGCGTGGTGG + Intergenic
1122545727 14:102521391-102521413 TGAGTTTGGGCCGGGCGTGGTGG - Intergenic
1122565256 14:102649910-102649932 TGGCCTTGGGCCGGGCGCGGTGG + Intronic
1122738478 14:103857120-103857142 TGGGCTGCAGCCAGATGTGGAGG - Intergenic
1122866350 14:104606185-104606207 TGTTGTTCAGCCGGGCGCGGTGG + Intergenic
1122903170 14:104790306-104790328 GGGGCTGCGGCCGGGCCTGGAGG + Intronic
1123415616 15:20092895-20092917 TGGGGTTTGGCCGGGCATGGTGG + Intergenic
1123524955 15:21100009-21100031 TGGGGTTTGGCCGGGCATGGTGG + Intergenic
1123667002 15:22615794-22615816 CTGGCTTTAGCCGGGTGTGGTGG - Intergenic
1123678891 15:22741792-22741814 TTTGTTTCTGCCGGGCGTGGTGG - Intergenic
1123707764 15:22962689-22962711 TGAGCTATGGCCGGGCGTGGTGG - Intronic
1124320843 15:28710362-28710384 CTGGCTTTAGCCGGGTGTGGTGG - Intronic
1124322773 15:28727221-28727243 TGGGTTTCCGCCGGGCGCAGTGG - Intronic
1124331100 15:28816085-28816107 TTTGTTTCTGCCGGGCGTGGTGG - Intergenic
1124351941 15:28962282-28962304 TGGGTTTCGGCTGGGCGCGGTGG + Intronic
1124439127 15:29674553-29674575 TGTGCTCAAGCCGGGCGCGGTGG - Intergenic
1124481649 15:30084993-30085015 CTGGCTTTAGCCGGGTGTGGTGG + Intronic
1124488106 15:30137088-30137110 CTGGCTTTAGCCGGGTGTGGTGG + Intronic
1124521941 15:30412204-30412226 CTGGCTTTAGCCGGGTGTGGTGG - Intronic
1124536723 15:30554014-30554036 CTGGCTTTAGCCGGGTGTGGTGG + Intronic
1124543197 15:30606065-30606087 CTGGCTTTAGCCGGGTGTGGTGG + Intronic
1124755421 15:32401231-32401253 CTGGCTTTAGCCGGGTGTGGTGG - Intronic
1124761929 15:32453578-32453600 CTGGCTTTAGCCGGGTGTGGTGG - Intronic
1124774448 15:32573952-32573974 AAGGCCTTAGCCGGGCGTGGTGG - Intergenic
1124776700 15:32595490-32595512 CTGGCTTTAGCCGGGTGTGGTGG + Intronic
1124836205 15:33198224-33198246 TGGGCCTTGGCCGGGCTTGGTGG - Intergenic
1125011574 15:34882091-34882113 TGGTTTTCAGCCAGGTGTGGTGG - Intronic
1125387633 15:39155123-39155145 TGGGCAGCAGCCGGGTGCGGTGG + Intergenic
1125495902 15:40193619-40193641 AGGGTCTCAGCCGGGCGTGGTGG + Intronic
1125526152 15:40376330-40376352 TGGGCATGGGCCGGGCGCGGTGG + Intergenic
1125583575 15:40804712-40804734 TAGATTTCAGCCGGGCGCGGTGG + Intronic
1125794975 15:42397352-42397374 TTTGCTTAAGCCGGGCGCGGTGG + Intronic
1125974272 15:43937358-43937380 TGCTCTTCGGCCAGGCGTGGAGG + Intronic
1126055135 15:44723095-44723117 TGGGTCTCGGCCGGGCGCGGTGG - Intergenic
1126138667 15:45418054-45418076 AGAGATTTAGCCGGGCGTGGTGG + Intronic
1127796908 15:62446278-62446300 AGAGCTTAAGCCGGGCGCGGTGG - Intronic
1127915998 15:63455613-63455635 TGAATTTCGGCCGGGCGTGGTGG - Intergenic
1127984269 15:64057191-64057213 TGTCTTCCAGCCGGGCGTGGTGG + Intronic
1128229844 15:66026773-66026795 TAGGCTTCGGCCAGGTGTGGTGG - Intronic
1128248989 15:66151862-66151884 TGGGCAGCAGCCGGGTGGGGAGG - Intronic
1128337054 15:66793652-66793674 TGGGGTGGGGCCGGGCGTGGTGG + Intergenic
1128480046 15:68029450-68029472 AAGGCTTCAGCTGGGCGTGGTGG - Intergenic
1128483429 15:68060286-68060308 TAAGCATCAGCTGGGCGTGGTGG - Intronic
1128566957 15:68707111-68707133 TAGGCGGCAGCTGGGCGTGGTGG - Intronic
1129120854 15:73395637-73395659 TGGAGCTCAGCTGGGCGTGGTGG - Intergenic
1129225218 15:74166221-74166243 TGTGACTCGGCCGGGCGTGGTGG + Intergenic
1129643296 15:77405289-77405311 TTGACCTCAGCCGGGCGTGGTGG - Intronic
1129804963 15:78448295-78448317 TAGAAATCAGCCGGGCGTGGTGG - Intronic
1129867380 15:78919596-78919618 TGTGCCTCGGCCGGGCATGGTGG + Intergenic
1130406148 15:83603845-83603867 TGGGTTTCAGCCCGGTGCGGTGG + Intronic
1131081590 15:89541143-89541165 TGAGTCTCAGCTGGGCGTGGTGG + Intergenic
1131139640 15:89966617-89966639 TTGACATCAGCCGGGTGTGGTGG - Intergenic
1131176754 15:90214052-90214074 TGAGCTTCGGCTGGGCGCGGTGG + Intronic
1131766087 15:95677254-95677276 TGTTTTTCAGCCGGGCGTGGTGG - Intergenic
1132057784 15:98665236-98665258 TGGGTTCCTGCCGGGCGCGGTGG - Intronic
1132206613 15:99990321-99990343 TGTGCTTTGGCTGGGCGTGGTGG - Intronic
1132368731 15:101277660-101277682 TTGGCTTGAGTCGGGGGTGGAGG + Intergenic
1132860258 16:2067481-2067503 CAGGCATCAGCCGGGTGTGGTGG + Intronic
1133034087 16:3025339-3025361 AGTGCTTAAGCCGGGTGTGGTGG - Intronic
1133039584 16:3053179-3053201 TGGGCTTCGGCTGGGCGTGGTGG + Intronic
1133043427 16:3072812-3072834 TGGGCTTCGGATGGGCGTGGTGG + Intronic
1133176432 16:4018498-4018520 TCAGCATCAGCCGGGCGCGGTGG - Intronic
1133261411 16:4553160-4553182 GGCTCTTCAGCCAGGCGTGGAGG - Intergenic
1133304003 16:4798820-4798842 TGGGCTCCAGCTGGGTATGGAGG + Intronic
1133397835 16:5462453-5462475 TGGGTTTCGGCCGGGCGCGGTGG - Intergenic
1133755255 16:8757764-8757786 TGAGTTTCAGCAGGGCGGGGTGG - Exonic
1134014913 16:10881124-10881146 TGTGTTTTAGCCGGGCATGGTGG + Intronic
1134102728 16:11463255-11463277 TGGCCATCAGGGGGGCGTGGGGG - Intronic
1134114578 16:11538526-11538548 TACAATTCAGCCGGGCGTGGTGG - Intergenic
1134275993 16:12776631-12776653 TGCCTTTCAGCTGGGCGTGGTGG + Intronic
1134612866 16:15624204-15624226 TATGGATCAGCCGGGCGTGGTGG - Intronic
1135100864 16:19604017-19604039 ATGGATTCGGCCGGGCGTGGTGG - Intronic
1135546180 16:23368249-23368271 CAAGCTTCAGCCAGGCGTGGTGG + Intronic
1135730018 16:24886318-24886340 TTGTTTTCAGCCGGGCGTGGTGG - Intronic
1135755375 16:25092800-25092822 AGGGCCTCCGCCGGGCGCGGTGG + Intergenic
1135850206 16:25956709-25956731 TGGGTTTTGGCTGGGCGTGGTGG + Intronic
1135994555 16:27238308-27238330 TGGGGTCCAGCCAGGGGTGGTGG - Intronic
1136174822 16:28509337-28509359 TGGGATTAGGCCGGGCGCGGTGG - Intronic
1136235641 16:28911957-28911979 TGGATTCCAGCCGGGCATGGTGG + Intronic
1136252762 16:29017094-29017116 TGTGCATCAGCCGGGCGTGGTGG - Intergenic
1136388127 16:29943135-29943157 GGGCCTTAGGCCGGGCGTGGTGG + Intronic
1136427505 16:30178869-30178891 TGGACTTTGGCCGGGCATGGTGG + Intergenic
1136562027 16:31045104-31045126 TGAGCCTCAGCCGGGCACGGTGG + Intergenic
1137289644 16:47043275-47043297 TGGGCTTTGGCAGGGCGCGGTGG - Intergenic
1137293112 16:47065818-47065840 TGGGCCTCAGCCATGGGTGGGGG - Intergenic
1137315726 16:47320072-47320094 TGGGCCTCTGCTGGGCGTGGTGG - Intronic
1137795308 16:51212542-51212564 TGGCTTTCGGCCGGGCGCGGTGG + Intergenic
1138608566 16:58105038-58105060 TGTGTTTTGGCCGGGCGTGGTGG + Intergenic
1138679397 16:58674110-58674132 TGGGCGTCCGCCAGGCATGGTGG - Intronic
1138685409 16:58720871-58720893 TGTGCCTCAGCCGGGCGCAGTGG - Intronic
1139486551 16:67260059-67260081 TGGGTTTCAGCCGGGTGCGATGG + Intronic
1139592115 16:67938960-67938982 TTGGGTTCGGCCGGGCGCGGTGG - Intergenic
1139717728 16:68826981-68827003 TATGCTTCGGCCGGGCGTGGTGG + Intronic
1139721102 16:68855595-68855617 TAAATTTCAGCCGGGCGTGGTGG + Intronic
1139758433 16:69164169-69164191 TGACCATCAGCCGGGCGCGGTGG - Intronic
1139760946 16:69184514-69184536 TGCTTTTCAGCTGGGCGTGGTGG + Intronic
1139822012 16:69728108-69728130 TGGCCAGCAGCCAGGCGTGGTGG + Intergenic
1139891636 16:70256825-70256847 TTCTTTTCAGCCGGGCGTGGTGG + Intronic
1139923172 16:70472176-70472198 TGGGCTGCAGCCTGTTGTGGTGG + Intronic
1139931657 16:70531911-70531933 TTGGCGTCAGCCAGGTGTGGTGG + Intronic
1140125339 16:72113395-72113417 TGGGCTTCTGCCAGGTGTGCTGG + Intronic
1140295931 16:73709892-73709914 TAGGTTTTGGCCGGGCGTGGTGG + Intergenic
1140390505 16:74582531-74582553 CTGGGTTCTGCCGGGCGTGGGGG + Intronic
1140392918 16:74603561-74603583 TGGTGTTCAGCCGGGCGCAGTGG - Intronic
1140399080 16:74655532-74655554 TCGGCTTCAGCTGGGCATGGTGG - Intronic
1140584628 16:76275006-76275028 GAGGCCTCAGCCGGGCGCGGTGG - Intergenic
1140769421 16:78189940-78189962 AGGATTTGAGCCGGGCGTGGTGG - Intronic
1141023085 16:80516302-80516324 GCTGCTTCAGCCAGGCGTGGTGG - Intergenic
1141761713 16:86033088-86033110 TGGGCTCCAGCCGGCAGAGGCGG + Intergenic
1141928290 16:87183690-87183712 TGGGCTTCAGCTGAGCCTTGGGG + Intronic
1142006207 16:87690653-87690675 GGGGGTACAGCCGGGAGTGGTGG + Intronic
1142321718 16:89387383-89387405 TGTGCTTGGGCCGGGCGCGGTGG + Intronic
1142445700 16:90135041-90135063 TGGAATTCATCTGGGCGTGGTGG + Intergenic
1142659828 17:1420227-1420249 TGGGATTAGGCCGGGTGTGGTGG - Intergenic
1142663001 17:1444284-1444306 AGGTCTTTAGCTGGGCGTGGTGG - Intronic
1142789776 17:2255115-2255137 TGATCTTCGGCCGGGCGCGGTGG + Intronic
1142838721 17:2609795-2609817 TTCGTTTCAGCCGGGCGCGGTGG - Intronic
1143011905 17:3870650-3870672 TGGGGTTTGGCCGGGCGTGGTGG - Intronic
1143181071 17:4984731-4984753 AAGGTTCCAGCCGGGCGTGGTGG + Intronic
1143463658 17:7120983-7121005 TGACTTTCGGCCGGGCGTGGTGG + Intergenic
1143567144 17:7729715-7729737 TCGGCTCAAGCCGGGTGTGGTGG - Intronic
1143757107 17:9075191-9075213 TGGGGTTCAGCTGGGCACGGTGG + Intronic
1143783845 17:9242782-9242804 GGGGCTGCAGTCGGGAGTGGTGG - Exonic
1143842687 17:9745480-9745502 TGGGCCCTGGCCGGGCGTGGTGG - Intergenic
1143857089 17:9860028-9860050 TGGGCTCCAGCAGCGTGTGGAGG - Exonic
1144368364 17:14567154-14567176 TGGACTTGCGCCGGGCATGGTGG - Intergenic
1144517374 17:15928093-15928115 ATGGCCTCGGCCGGGCGTGGTGG - Intergenic
1144570216 17:16392829-16392851 TGGGCGTGGGCCGGGCGCGGTGG + Intergenic
1144654633 17:17027762-17027784 TGAGCTTAAACCGGGTGTGGTGG + Intergenic
1144819228 17:18059796-18059818 TGGGGATCGGCCGGGCGTGGTGG + Intronic
1145075830 17:19853856-19853878 GGGGCCTTGGCCGGGCGTGGTGG - Intronic
1145103973 17:20099540-20099562 TTAGCCTTAGCCGGGCGTGGTGG + Intronic
1145362369 17:22222593-22222615 TGGGCATGGGCTGGGCGTGGTGG + Intergenic
1145800304 17:27678620-27678642 ATGACTTCAGCCAGGCGTGGTGG + Intergenic
1146376159 17:32295937-32295959 TGGGGTCCAGCCGGGCGCGGTGG + Intronic
1146660744 17:34663713-34663735 TGGGCTGCAGCAGGGGGAGGTGG - Intergenic
1146666989 17:34711833-34711855 TGGGCTGCAGCCCGGTGTTGGGG - Intergenic
1146737887 17:35254727-35254749 TGGATTTCGGCCGGGCGTGGTGG + Intronic
1146801430 17:35826843-35826865 TGAACTTCAGCCAGGCGTGGTGG - Intronic
1146804235 17:35852429-35852451 AGTGTTTCAGCCAGGCGTGGTGG - Intronic
1146804240 17:35852485-35852507 AGTGTTTCAGCCAGGCGTGGTGG - Intronic
1146829862 17:36059090-36059112 TTACCTTCAGCCGGGCGCGGTGG + Intergenic
1146978671 17:37139012-37139034 TGGGCTTCAGGCTGGGGTTGGGG + Intronic
1147018987 17:37515745-37515767 TTCCCTTTAGCCGGGCGTGGTGG - Exonic
1147111669 17:38266806-38266828 TGGGATTTCGCCGGGCGCGGTGG - Intergenic
1147123205 17:38348331-38348353 TGGTCCTCAGCCGAGCGTGGTGG - Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147177122 17:38662872-38662894 TGGGATAGAGCCGGGCATGGTGG - Intergenic
1147190254 17:38734244-38734266 CGGGCCTCAGCTGGGGGTGGAGG + Exonic
1147223733 17:38958114-38958136 TGGGCTTGGGCCGGGCATGGTGG - Intronic
1147239255 17:39079810-39079832 TGGGCTTGAGTAGGGCTTGGTGG - Intronic
1147386084 17:40083212-40083234 TGGGCGTAGGCCGGGCGCGGTGG - Intronic
1147607097 17:41780107-41780129 TGAGCTTCAGCTGGGCATGGTGG + Intronic
1147614165 17:41818678-41818700 GGTGCTTTGGCCGGGCGTGGTGG + Intronic
1147674960 17:42198828-42198850 AGGCTTTCAGCCGGGCGTAGTGG + Intergenic
1147675185 17:42200378-42200400 TGGGCTACAGCAGGTAGTGGAGG - Exonic
1148147864 17:45377361-45377383 TTAGCTGTAGCCGGGCGTGGTGG - Intergenic
1148417907 17:47521994-47522016 TGGGATTTCGCCGGGCGTGGTGG + Intergenic
1148462809 17:47847970-47847992 GGCGCTTCAGGCGGGCTTGGGGG - Exonic
1148513920 17:48198166-48198188 TGGGTTTTGGCCGGGCGCGGTGG + Intronic
1148527140 17:48350406-48350428 AGGTTTGCAGCCGGGCGTGGTGG + Intronic
1148905770 17:50911081-50911103 TGGGCTTGGGCCGGGCGCTGTGG + Intergenic
1148929016 17:51113064-51113086 TTGGCCGCTGCCGGGCGTGGTGG + Intronic
1149620680 17:58042683-58042705 TTGTGTTCAGCCGGGCGTGGTGG - Intergenic
1149668484 17:58383588-58383610 TGGGCTTCAGCTGGGTGCAGTGG - Intronic
1149694277 17:58604183-58604205 TTTGCTTCGGCCGGGCGTGGTGG + Intronic
1149804044 17:59597647-59597669 TGGGCTTGGGCCGGGCACGGTGG + Intronic
1149842452 17:59977831-59977853 TGGGCTTGGGCCGGGCACGGTGG - Intergenic
1149850207 17:60029613-60029635 TGCGCCTCAGCCGGGCGCAGTGG - Intergenic
1149859959 17:60116911-60116933 TGCGCCTCAGCCGGGCGCAGTGG + Intergenic
1149940660 17:60861994-60862016 CTGGCTTCGGCCGGGCGTGGTGG + Intronic
1150218063 17:63481197-63481219 TGGGCTCAAGCCTGGGGTGGTGG + Intergenic
1150375814 17:64680869-64680891 AGGGCCGGAGCCGGGCGTGGTGG + Intergenic
1150845284 17:68650951-68650973 TGGGGATCAGCTGGGTGTGGTGG + Intergenic
1151159922 17:72156745-72156767 TAGGCTTGTGCCGGGCGCGGTGG + Intergenic
1151250296 17:72829062-72829084 TGGGCCTCAGCCAGGTGCGGCGG + Intronic
1151487413 17:74409925-74409947 TGCTCTCCAGCTGGGCGTGGTGG - Intergenic
1151536411 17:74741298-74741320 TGGGCTTGGGCCGGGCATGGTGG + Intronic
1151666517 17:75548428-75548450 TGTCCTTTAGCCGGGCGTGGTGG - Intronic
1151863826 17:76786427-76786449 TGGTCCTCAGCCAGGTGTGGTGG - Intergenic
1151912425 17:77092659-77092681 TGGGTTAGAGCCGGGCGTGGTGG + Intronic
1152274581 17:79348861-79348883 TGGGTTTAGGCCGGGGGTGGTGG - Intronic
1152460450 17:80439493-80439515 TGGGCTGCTGCCGGGGTTGGGGG - Intergenic
1152654960 17:81515034-81515056 GGGGCGGGAGCCGGGCGTGGGGG + Intronic
1152705640 17:81842132-81842154 TGACTTTCAGCCGGGCGCGGTGG + Intergenic
1153033079 18:733494-733516 TGGCTTTCGGCCGGGCGCGGTGG + Intronic
1153045478 18:851963-851985 TGTGATCCAGCCGGGCGTGGTGG + Intergenic
1153252879 18:3140117-3140139 TAGAATGCAGCCGGGCGTGGTGG + Intronic
1153688165 18:7567124-7567146 CGGGCGTCAGCCGCGCGGGGAGG - Exonic
1153854671 18:9134855-9134877 AATGCTTAAGCCGGGCGTGGTGG - Intergenic
1155152913 18:23136271-23136293 TGGGCGCCGGCCGGGCGTCGGGG + Exonic
1155294411 18:24371986-24372008 GGTACTTCAGCCGGGCATGGTGG + Intronic
1156403642 18:36762507-36762529 AGGGCATCAGCCGGGCACGGTGG + Intronic
1156711392 18:39950571-39950593 AGAGCTTCAGCTGGGCATGGTGG - Intergenic
1156795969 18:41046436-41046458 TTAGCATTAGCCGGGCGTGGTGG - Intergenic
1156852314 18:41742681-41742703 TGTGCTTAGGCCAGGCGTGGTGG - Intergenic
1156961429 18:43036385-43036407 CGGAAATCAGCCGGGCGTGGTGG + Intronic
1157421306 18:47549895-47549917 TAGGTTTTAGCCGGGCGTGATGG - Intergenic
1157486849 18:48093766-48093788 TAGGCTTCGGCCAGGCGCGGTGG + Intronic
1157592989 18:48847020-48847042 TGAGCTCCAGCCGGACATGGTGG + Intronic
1158006283 18:52675340-52675362 TGGGATTAGGCCGGGCATGGTGG - Intronic
1158021384 18:52846252-52846274 TCAGCTTCAGCCAGGCATGGTGG + Intronic
1158227052 18:55212056-55212078 TGGGTTTAGGCCGGGTGTGGTGG - Intergenic
1158450221 18:57557514-57557536 TGGGTTTCAGCCAGGCACGGTGG + Intronic
1158482145 18:57831324-57831346 CGGGGTTCGGCCGGGCATGGTGG + Intergenic
1158594727 18:58806388-58806410 TGGGGTTTAGCTGGGCGTGGTGG - Intergenic
1159055354 18:63458201-63458223 AGGCTTACAGCCGGGCGTGGTGG + Intergenic
1159104433 18:63989654-63989676 TGTGCTTAGGCCGGGCGCGGTGG + Intronic
1159274639 18:66200804-66200826 TAGTATTCGGCCGGGCGTGGTGG - Intergenic
1159585286 18:70277980-70278002 GGGGTTTGAGCCGGGCATGGTGG - Intergenic
1159665761 18:71157672-71157694 AGGGCTTTGGCCGGGCGTGGTGG - Intergenic
1160344622 18:78123231-78123253 CTGGTTTGAGCCGGGCGTGGGGG - Intergenic
1160388097 18:78509905-78509927 TGAGCTTCAGCTGGGCACGGTGG - Intergenic
1160443500 18:78911331-78911353 GGGGCTTCGGCCTGGGGTGGAGG - Intergenic
1160689246 19:453556-453578 TGGGTTCTGGCCGGGCGTGGTGG - Intronic
1160854592 19:1210873-1210895 AGGGCTGGGGCCGGGCGTGGTGG + Intronic
1160919411 19:1512863-1512885 TGGGCTGCAGCCCGGACTGGCGG + Intronic
1160950152 19:1662771-1662793 GGGGTCTCAGCTGGGCGTGGTGG + Intergenic
1161030572 19:2056180-2056202 AGGGCTCCAGCTGGGGGTGGAGG - Intergenic
1161165585 19:2785536-2785558 TGGTCCTCAGGCGGCCGTGGCGG + Exonic
1161253174 19:3292232-3292254 TGGTCTTTGGCCGGGTGTGGTGG - Intronic
1161275925 19:3417170-3417192 TGGGATTAGGCCAGGCGTGGTGG - Intronic
1161283351 19:3457128-3457150 TGGGCTGAAGCCTGGGGTGGGGG - Intronic
1161478046 19:4497158-4497180 TGGGCTGCAGCCAGGCACGGTGG - Intronic
1161500751 19:4614035-4614057 TGGGCTTGGGCCGGGCACGGTGG - Intergenic
1161512973 19:4682133-4682155 TGGGCATGGGCCGGGCGCGGTGG - Intronic
1161533665 19:4805372-4805394 TGGGCATCCACCGGGTGTGGTGG + Intergenic
1161674477 19:5637055-5637077 TGATTTTCGGCCGGGCGTGGTGG + Intronic
1161674873 19:5640138-5640160 TCGGCTCCAGCCAGGCGCGGTGG - Intronic
1161686956 19:5707650-5707672 TGGGGTGCAGCCAGGCGTGGGGG + Intronic
1161734264 19:5981181-5981203 TGACTTTCAGCCGGGCGCGGTGG + Intergenic
1161785503 19:6322821-6322843 GGAGTTTCAGCCGGGCGTGGTGG + Intronic
1161918154 19:7245731-7245753 TGGGGCTCGGCTGGGCGTGGTGG - Intronic
1162072820 19:8165033-8165055 TGGGATTAAGCTGGGCATGGTGG - Intronic
1162133597 19:8542342-8542364 GGGGCTGCAGCCTGGCGGGGGGG + Intronic
1162311013 19:9907166-9907188 TGGTCTGGGGCCGGGCGTGGTGG + Intronic
1162371307 19:10281254-10281276 TGGGCTTCGGCATGGCGTGGTGG - Intronic
1162658195 19:12148265-12148287 AGGGCCTCAGCCAGGCTTGGTGG - Intronic
1162801064 19:13110678-13110700 GGGGCCTGGGCCGGGCGTGGTGG + Intronic
1162856103 19:13469744-13469766 GGTGGTTCAGCCGGGCGCGGTGG - Intronic
1162872358 19:13595876-13595898 TGGAGATCAGCCGGGCATGGTGG + Intronic
1162882525 19:13670576-13670598 TGGTCTTAGGCCGGGCGTGGTGG + Intergenic
1163276871 19:16290427-16290449 CTAGCATCAGCCGGGCGTGGTGG - Intergenic
1163410831 19:17153352-17153374 AGGACTCTAGCCGGGCGTGGTGG - Intronic
1163582640 19:18147583-18147605 TGGGCTTCGGCAGGGAGTGGTGG - Exonic
1163654724 19:18539099-18539121 TGGGTGTGGGCCGGGCGTGGTGG - Intronic
1163706853 19:18819472-18819494 AGGGCCTCAGCCGGGCGCGGTGG - Intergenic
1163740545 19:19009198-19009220 GAGGCATCAGCTGGGCGTGGTGG - Intronic
1163936356 19:20448096-20448118 TGAGTACCAGCCGGGCGTGGTGG + Intergenic
1164055547 19:21619197-21619219 TTAGCTTCAGCCAGGCATGGTGG - Intergenic
1164394284 19:27850336-27850358 TGGGCTTGAGCAGGGGGTGCAGG + Intergenic
1164636361 19:29794355-29794377 AGGCCTTCCTCCGGGCGTGGTGG + Intergenic
1165124375 19:33583440-33583462 TAGGCCTCAGCCAGGCCTGGGGG - Intergenic
1165197158 19:34113228-34113250 AGGGCATCAGCCAGGCGTTGTGG - Intergenic
1165375334 19:35437733-35437755 TGGACTCCAGCCGGGCGCGGGGG + Intergenic
1165462716 19:35953498-35953520 TGGGTTCCAGCTGGGCGTGGTGG + Intergenic
1165675275 19:37717506-37717528 TGAGCTGCGGCTGGGCGTGGTGG + Intronic
1165770566 19:38377647-38377669 TGGACTCTAGCAGGGCGTGGTGG - Intronic
1165884461 19:39067804-39067826 AGGCCCTCAGCCGGGAGTGGTGG - Intergenic
1165892115 19:39119470-39119492 GATGCTTAAGCCGGGCGTGGTGG - Intergenic
1165945134 19:39437253-39437275 AGAGATTCGGCCGGGCGTGGTGG - Intronic
1166033712 19:40152091-40152113 TGTCCATCAGCCAGGCGTGGTGG - Intergenic
1166155965 19:40911185-40911207 TGGGCCTCAGCCAGGCGCGGTGG - Intergenic
1166196711 19:41211115-41211137 TGGGCTATAGCCGGGCATGGTGG + Intergenic
1166235244 19:41450963-41450985 TGAGCTTTGGCCGGGCGCGGTGG + Intergenic
1166362713 19:42261200-42261222 GGGTTTTCAGCCAGGCGTGGTGG - Intergenic
1166669177 19:44699682-44699704 TAGGCTCTGGCCGGGCGTGGTGG - Intronic
1166844986 19:45721818-45721840 TGGGGTGGTGCCGGGCGTGGTGG - Intronic
1166868925 19:45858800-45858822 TGGTCGTCGGCCGGGCGCGGTGG - Intronic
1166950481 19:46424252-46424274 TGTGTTTCCGCCGGGCGCGGTGG + Intergenic
1166992794 19:46703337-46703359 TGAGGTTCAGCTGGGCGCGGTGG + Intronic
1166993291 19:46705891-46705913 TGTGCTTCAGCCGGGGGTACAGG - Intronic
1167083364 19:47292295-47292317 TGCACTTCAGCCTGGCGCGGTGG - Intronic
1167134821 19:47609920-47609942 TGAGCCTCAGCTGGGGGTGGGGG - Intronic
1167252547 19:48408045-48408067 TGGGCGTTGGCCGGGCGTGGTGG + Intronic
1167315568 19:48761106-48761128 TGGTCTCCAGCCTGGCATGGCGG - Intergenic
1167468454 19:49662535-49662557 GGGGCTACAGCCAGGCTTGGGGG + Exonic
1167525687 19:49982428-49982450 ATGGCCTCAGCCAGGCGTGGTGG - Intronic
1167841289 19:52123283-52123305 TAAGCTTTGGCCGGGCGTGGTGG + Intronic
1167946540 19:52993176-52993198 TGGGGATTAGCCGGGCCTGGTGG + Intergenic
1168002712 19:53462385-53462407 TAGGCTTTGGCCGGGCGCGGTGG + Intergenic
1168042567 19:53770037-53770059 TAGGCTTCAGCCAGGCACGGTGG + Intergenic
1168069585 19:53942277-53942299 CGGGCCTCAGCAGGGCGAGGTGG - Exonic
1168142989 19:54401835-54401857 TGTGCAACAGCCGGGTGTGGTGG - Intergenic
1168221547 19:54964164-54964186 TGGGTTTTGGCCGGGCGCGGTGG - Intronic
1168287219 19:55340808-55340830 AAGGCTGCAGCCGGGCCTGGGGG - Intronic
1168393021 19:56026239-56026261 TTGGCTTCAGCTGGGCGCAGTGG + Intronic
1168480026 19:56712101-56712123 GGGTCTTCAGCCGGGCGCGGTGG - Intergenic
1168646394 19:58061608-58061630 TGGGCTTCAGCCAGGAGGAGTGG + Exonic
1168666986 19:58211588-58211610 TGGACTTCAGCCGGGAGGAGTGG + Exonic
925312120 2:2892195-2892217 GGGGCTTGGGCCGGGCGTGGTGG - Intergenic
925550915 2:5073604-5073626 AGGCATTTAGCCGGGCGTGGTGG + Intergenic
925976954 2:9148347-9148369 GGGGATCCGGCCGGGCGTGGTGG + Intergenic
926015919 2:9451474-9451496 TGGGTTTCAGCCAGGCTTGGTGG + Intronic
926154590 2:10446425-10446447 TGAGTTCTAGCCGGGCGTGGTGG - Intronic
926438548 2:12862268-12862290 TGGGCCTGGGCCGGGCGTGGAGG - Intergenic
926739151 2:16096734-16096756 AGGACTCCAGCCAGGCGTGGTGG - Intergenic
927188922 2:20502667-20502689 GGTGCTGCAGCCGGGCGTGGTGG - Intergenic
927478751 2:23434032-23434054 TAGGCTCCGGCCGGGCGCGGTGG + Intronic
927549093 2:23981604-23981626 TGTCCTTTGGCCGGGCGTGGTGG + Intronic
927591667 2:24362107-24362129 TGGGTCTTGGCCGGGCGTGGTGG - Intergenic
927668214 2:25046788-25046810 TGTACTTCGGCCGGGCGCGGTGG - Intronic
927760232 2:25745931-25745953 TTGGTTTCAGCCAGGCGTGGTGG - Intronic
927810910 2:26179760-26179782 TGGGCTTCAGGCTGCCGCGGAGG + Intronic
927874197 2:26643758-26643780 TGGGCCTGGGCCGGGCATGGTGG + Intergenic
928520227 2:32081379-32081401 TGAGCCACAGCCAGGCGTGGTGG - Intronic
928521333 2:32091898-32091920 TTAGCTTCAGCTGGGCGTGGTGG - Intronic
928526896 2:32150376-32150398 AAGCTTTCAGCCGGGCGTGGTGG - Intronic
928769258 2:34686926-34686948 TGGGTTCCAGCTGGGCGCGGTGG + Intergenic
928890963 2:36202411-36202433 TAGGGATCAGCTGGGCGTGGTGG - Intergenic
929573323 2:43037048-43037070 TGGGTTTCGGCCAGGTGTGGTGG + Intergenic
929788541 2:45008431-45008453 TGGGCTGTGGCCGGGCCTGGGGG + Intronic
930132120 2:47862765-47862787 ACGTTTTCAGCCGGGCGTGGTGG + Intronic
931326149 2:61226112-61226134 TGGCCCTCAGCCAGGTGTGGTGG - Intronic
931359206 2:61563983-61564005 TGGGCATAGGCCGGGCGTGGTGG + Intergenic
931419193 2:62110355-62110377 TGCCCTTCAGCTGGGTGTGGTGG - Intronic
931623233 2:64232007-64232029 TGGAGTTCAAACGGGCGTGGTGG + Intergenic
931717110 2:65037917-65037939 TGGAATTCAGCTGGGCATGGTGG + Intergenic
932205719 2:69880552-69880574 TGGGTGTCAGCCAGGTGTGGTGG + Exonic
932252027 2:70252881-70252903 TGGGCGTGGGCCGGGCATGGTGG - Intergenic
932343337 2:70980026-70980048 TGGGCTTTAGCCGGGCATGGTGG + Intronic
932726841 2:74186798-74186820 TCTACTTTAGCCGGGCGTGGTGG - Intergenic
932731527 2:74225306-74225328 TGGTTCTCAGCCAGGCGTGGTGG + Intronic
932767245 2:74478737-74478759 TGGGCATTGGCCGGGTGTGGTGG + Intronic
932774699 2:74520958-74520980 TCTTCTTCAGCCAGGCGTGGTGG - Intronic
933687609 2:85155793-85155815 TGGGGTGCAGACGGGCCTGGTGG - Intronic
933827948 2:86180551-86180573 TGTGTTTAGGCCGGGCGTGGTGG - Intronic
934186421 2:89681269-89681291 GAGGCTTTGGCCGGGCGTGGTGG + Intergenic
934196551 2:89841674-89841696 TGGGCTTCAGCCTGGGGTTCTGG - Intergenic
934559931 2:95307748-95307770 TGGGCTGCAGACGGGGCTGGGGG + Intronic
934560276 2:95309709-95309731 AGTGGATCAGCCGGGCGTGGTGG - Intronic
934636290 2:95992372-95992394 TGGGCTTCGGCCGGGGGTGCAGG - Intergenic
934749287 2:96782151-96782173 TTGGCATCGGCCAGGCGTGGTGG + Intronic
934797352 2:97113054-97113076 TGGGCTTCCGCCGGGGGTGCAGG + Intergenic
934836052 2:97590385-97590407 TGGGCTTCGGCCGGGGGTGCAGG - Intergenic
935090680 2:99892107-99892129 TGGGCTTTGGCCGGGTGTGGTGG - Intronic
935138301 2:100327659-100327681 AGGGCTTTGGCCGGGCGCGGTGG - Intergenic
935229933 2:101087069-101087091 TGAAATTCAGCCGGGCGCGGTGG - Intronic
935634385 2:105238506-105238528 TGACCTTCAGCGGGGCGCGGTGG - Intergenic
936039366 2:109138166-109138188 CGGGCGTTAGCCGGGCGTGGTGG - Intronic
936102599 2:109596182-109596204 TGATTTTCAGCCGGGTGTGGTGG - Intronic
936277097 2:111108662-111108684 TGCGCTTCGGCCGGGCATGGTGG - Intronic
936410729 2:112255567-112255589 TGGGCTGGGGCCGGGCGCGGTGG - Intergenic
936643901 2:114347335-114347357 TCCTCTTCAGCTGGGCGTGGTGG - Intergenic
937162940 2:119782977-119782999 GGGATTTCAGCCAGGCGTGGTGG - Intronic
937224340 2:120359685-120359707 TGGGCTTCTGCCGGCCTGGGAGG + Intergenic
937542936 2:122981591-122981613 AGGACTTTGGCCGGGCGTGGTGG - Intergenic
938007335 2:127798078-127798100 TGAATTTAAGCCGGGCGTGGTGG + Intronic
939749998 2:146032086-146032108 TGGTTCTCAGCCGGGCGCGGTGG - Intergenic
940204282 2:151185719-151185741 TTGTATTCAGCTGGGCGTGGTGG + Intergenic
940293653 2:152100539-152100561 TAGGATTCAGCCGGGTGTGTAGG - Intergenic
940421618 2:153485745-153485767 AAGGCTTTAGCCGGGCATGGTGG + Intergenic
941509993 2:166395538-166395560 GGAGCTTTAGCCGGGCGCGGTGG - Intergenic
941662215 2:168206586-168206608 TAGATCTCAGCCGGGCGTGGTGG - Intronic
941678500 2:168370250-168370272 AGAACTTCAGCCGGGCATGGTGG + Intergenic
941913460 2:170790206-170790228 TAAACTTCAGCTGGGCGTGGTGG + Intronic
942155300 2:173121672-173121694 TGTTCTCCAGCCGGGCGCGGTGG - Intronic
942225061 2:173807760-173807782 GGGTCCTCGGCCGGGCGTGGTGG - Intergenic
942357390 2:175132796-175132818 TGTTCTTCAGCCAGGTGTGGTGG + Intronic
942436958 2:175989060-175989082 TGTCTTTCAGCCAGGCGTGGTGG - Intronic
942735877 2:179112004-179112026 AGAGCTTCAGCCGGGCGTGGTGG - Intronic
943362612 2:186939821-186939843 TGGTCTTCGGCCGGGCATGGTGG - Intergenic
944091485 2:195916810-195916832 ATTGCGTCAGCCGGGCGTGGTGG + Intronic
944435159 2:199681164-199681186 AGGCTTTCAGCCAGGCGTGGTGG + Intergenic
944547532 2:200812319-200812341 GGGGCTTCCGGCGGGCGGGGCGG + Intronic
944653635 2:201856934-201856956 TGGGTTCCGGCCGGGCGCGGTGG + Intronic
944694586 2:202189575-202189597 TCTATTTCAGCCGGGCGTGGTGG - Intronic
944911048 2:204310712-204310734 TGGGCCTCGGCCGGGGGTGGTGG - Intergenic
944963470 2:204902380-204902402 TGAGTTTCAGCCAGGCGCGGTGG + Intronic
944992596 2:205254949-205254971 TGAACTTCGGCCGGGCGCGGTGG - Intronic
945146916 2:206748091-206748113 TAGAAGTCAGCCGGGCGTGGTGG + Intronic
946065776 2:216986035-216986057 TGGGCTTTAGCTTGGAGTGGTGG - Intergenic
946426843 2:219603327-219603349 AGGTATTCAGCCGGGCGTGGTGG - Intronic
946595138 2:221297726-221297748 AGGGTTTTGGCCGGGCGTGGTGG - Intergenic
946808541 2:223497351-223497373 CTGGCTTCAGCCGGGTGTGGTGG - Intergenic
946843014 2:223836841-223836863 TGGGCTTCTGCCAGGTGAGGCGG - Intronic
946919834 2:224567450-224567472 TAGGCTTCGGCCGGGCACGGTGG + Intronic
947540333 2:230972949-230972971 TGGGCATAAGCCGGGCGCAGTGG - Intergenic
947589773 2:231379024-231379046 TGGCCTTCGGCTGGGCTTGGTGG - Intergenic
947756016 2:232565804-232565826 GGGGCTTCAGCCAGGCGCAGTGG + Intronic
948990229 2:241550377-241550399 TGGGCTTCAGCCAGGCCAGGGGG - Intergenic
1169110816 20:3032478-3032500 TGGCTTTCGGCCGGGCGCGGTGG + Intronic
1169319819 20:4623377-4623399 ACTGCATCAGCCGGGCGTGGTGG - Intergenic
1169991140 20:11504015-11504037 TGGACTTTGGCCGGGCGCGGTGG + Intergenic
1170169087 20:13391678-13391700 TGAGCTTAGGCCGGGCGTGGTGG + Intronic
1170310959 20:14990797-14990819 TAGTTCTCAGCCGGGCGTGGTGG - Intronic
1170344532 20:15368748-15368770 TGTGATTGGGCCGGGCGTGGTGG - Intronic
1170429177 20:16261058-16261080 TGGGGTGCAGCGGGGGGTGGGGG - Intergenic
1170876776 20:20257325-20257347 AGAACTTCAGCCAGGCGTGGTGG + Intronic
1170887483 20:20354218-20354240 TCGGGTACAGCCGGGCATGGTGG + Intronic
1170893379 20:20394388-20394410 CAGGCTGCAGCCGGGCGCGGTGG + Intronic
1170996570 20:21365970-21365992 TGGGTTTCGGCCGGGCACGGTGG - Intronic
1171368807 20:24646906-24646928 TGAGCATCAGCCGGGCTTGGTGG - Intronic
1171497871 20:25569895-25569917 GGTACTGCAGCCGGGCGTGGTGG + Intronic
1171995503 20:31727868-31727890 GTGGCTTCAGCTGGGCGCGGTGG + Intergenic
1172003214 20:31797907-31797929 TGGGATTCCACCGGGTGTGGTGG + Intronic
1172014949 20:31867930-31867952 TGGGCATCAGCCGGGCACGATGG - Intronic
1172047361 20:32089976-32089998 TGGGCCTCAGCTGGGCCTGCTGG + Intronic
1172350429 20:34235152-34235174 TCTGCTTCAGCCGGGCGCAGTGG + Intronic
1172651433 20:36505272-36505294 TGTGCGTCAGCCAGGCGTGGTGG - Intronic
1172655672 20:36535907-36535929 TGTGCTTCGGCCGGGCGCGGTGG + Intergenic
1172884210 20:38220599-38220621 AGTGTCTCAGCCGGGCGTGGTGG - Intronic
1173129887 20:40381967-40381989 TGTACTACGGCCGGGCGTGGTGG - Intergenic
1173493497 20:43502225-43502247 TGGGGGTCGGCCAGGCGTGGTGG - Intergenic
1173630481 20:44510524-44510546 TGAGTTGCAGCCGGGCGTGGTGG + Intronic
1173815622 20:45985930-45985952 GGGGCTTCAGCAGGGCGCTGAGG + Intergenic
1174028269 20:47597956-47597978 CAGGCTTCTGCCGGGCGTGGTGG + Intronic
1174028362 20:47598622-47598644 TAGGTTTCAGCCAGGTGTGGTGG - Intronic
1174231714 20:49050696-49050718 TGGGCTCAGGCCGGGCGCGGTGG - Intronic
1174241258 20:49136979-49137001 TGGTTTCCCGCCGGGCGTGGTGG - Intronic
1174336202 20:49862546-49862568 TGGGCTGATGCCGGGCGTGGTGG - Intronic
1174473070 20:50775172-50775194 ATGGCTTGTGCCGGGCGTGGTGG - Intergenic
1174613454 20:51817891-51817913 TGGGTGTGGGCCGGGCGTGGTGG - Intergenic
1174638377 20:52021470-52021492 TTGGCCTCAGCCGGGCGCGGTGG + Intergenic
1174946216 20:54988520-54988542 TCTGCCTCAGCCGGGCGTGGTGG - Intergenic
1175114150 20:56670111-56670133 AGGGCTGCGGCCGGGCGCGGTGG + Intergenic
1175139976 20:56853767-56853789 TGGGTTAGGGCCGGGCGTGGTGG + Intergenic
1175336133 20:58197512-58197534 TTGGATTTGGCCGGGCGTGGTGG + Intergenic
1175398906 20:58688243-58688265 AGGACACCAGCCGGGCGTGGTGG - Intronic
1175737795 20:61399417-61399439 TGGGTTTTGGCCGGGCGCGGTGG - Intronic
1175868739 20:62196739-62196761 GGATATTCAGCCGGGCGTGGTGG + Intronic
1176065522 20:63192446-63192468 AGCGCCTCAGCCGGGCGCGGTGG - Intergenic
1176188991 20:63798385-63798407 TGGGCGTTGGCCGCGCGTGGTGG + Intronic
1176224823 20:63990939-63990961 TGGGTGTGAGCCTGGCGTGGTGG - Intronic
1176252069 20:64129957-64129979 GGAGCCTCAGCCGGGCGCGGTGG + Intergenic
1176693895 21:9950124-9950146 TGTGCCTCAGCCGGGAGGGGAGG + Intergenic
1176720126 21:10385921-10385943 TGGGAGCCAGCCGGGTGTGGTGG + Intergenic
1177199582 21:17938763-17938785 TGGGTTTCGGCCGGGCGCCGTGG - Intronic
1177771904 21:25526368-25526390 TGGTCTTTGGCCAGGCGTGGTGG - Intergenic
1177941865 21:27421463-27421485 TACAATTCAGCCGGGCGTGGTGG - Intergenic
1179013197 21:37572597-37572619 TGGGATTTGGCAGGGCGTGGTGG - Intergenic
1179016379 21:37597363-37597385 AGCACTTGAGCCGGGCGTGGTGG - Intergenic
1179116854 21:38501352-38501374 TGTGCCTTGGCCGGGCGTGGTGG - Intronic
1179548237 21:42126277-42126299 TGGCCCACAGCAGGGCGTGGGGG + Intronic
1179795730 21:43781940-43781962 TCGCTTTCAGCCGGGCCTGGTGG - Intergenic
1179803507 21:43823276-43823298 GGGTCTTGCGCCGGGCGTGGTGG + Intergenic
1179843191 21:44090903-44090925 TATTTTTCAGCCGGGCGTGGTGG + Intronic
1180077898 21:45472496-45472518 TGCGCTTCGGCCGGGCGCAGTGG - Intronic
1180590769 22:16935383-16935405 TGGGCTTCAGCCTGGGGTTCTGG + Intergenic
1180781374 22:18521795-18521817 GGGGTCTCAGCCGGGCGCGGTGG - Intergenic
1180791677 22:18578279-18578301 TGGGCGTCAGCCTGTCGGGGGGG - Intergenic
1181230059 22:21417030-21417052 TGGGCGTCAGCCTGTCGGGGGGG + Intergenic
1181238258 22:21461138-21461160 GGGGTCTCAGCCGGGCGCGGTGG - Intergenic
1181248590 22:21517836-21517858 TGGGCGTCAGCCTGTCGGGGGGG - Intergenic
1181442514 22:22943969-22943991 TGGGTTGCAGGCGGGGGTGGGGG + Intergenic
1181601082 22:23952234-23952256 TGGGCTGCTGCCGGGCCTTGTGG + Intergenic
1181607427 22:23989092-23989114 TGGGCTGCTGCCGGGCCTTGTGG - Intergenic
1181623976 22:24109880-24109902 TAGTTCTCAGCCGGGCGTGGTGG + Intronic
1181652842 22:24270576-24270598 TGGGCTGGAGCCGGGCAAGGCGG - Intergenic
1181757715 22:25036629-25036651 TGAACTTTGGCCGGGCGTGGTGG + Intronic
1181972632 22:26703811-26703833 TGGATTTCGGCCGGGCGCGGTGG + Intergenic
1182177282 22:28303996-28304018 TGGGCAGCAGCCGGGCGCGGTGG + Intronic
1182219759 22:28748802-28748824 TGGGTTTTGGCCGGGCTTGGTGG - Intronic
1182343047 22:29639907-29639929 AGGACTTCAGCCGGGCGGGTTGG + Intronic
1182403490 22:30102915-30102937 TGGGTTTAGGCCGGGTGTGGTGG - Intronic
1182417866 22:30232953-30232975 TGGGCTGCAGCCAGGCCGGGGGG - Intergenic
1182509464 22:30808665-30808687 TGGACTTATGCCGGGCGTGGTGG + Intronic
1182643802 22:31791032-31791054 AGGGTTTCGGCTGGGCGTGGTGG - Intronic
1182693054 22:32176728-32176750 TGGGAATCGGCCGGGCGCGGTGG + Intergenic
1183183366 22:36277009-36277031 CTGCTTTCAGCCGGGCGTGGTGG + Intergenic
1183194782 22:36345859-36345881 TGGGCTGGGGCCGGGCGTGGTGG + Intronic
1183307905 22:37092781-37092803 TGGGCATGGGCCGGGCGTGGTGG - Intronic
1183518943 22:38285141-38285163 CAAGCTCCAGCCGGGCGTGGTGG - Intergenic
1183571893 22:38659535-38659557 TGGGCCTAAGCCGGGCACGGTGG - Intronic
1183696285 22:39425083-39425105 TGAGATTCGGCTGGGCGTGGTGG + Intronic
1183900561 22:41002822-41002844 AGGCCTACAGCTGGGCGTGGTGG - Intergenic
1183932591 22:41244697-41244719 AGAGCTTCACCCGGGTGTGGTGG - Intergenic
1184206660 22:43008534-43008556 TGAACTTAGGCCGGGCGTGGTGG - Intronic
1184232043 22:43163476-43163498 TGGGCTTCAGCAGAGGGAGGGGG + Intergenic
1184702610 22:46186600-46186622 TGAGGTTCAGCCAGGCGTAGTGG + Intronic
1184756849 22:46521214-46521236 TTGTTTTCAGCCGGGCGCGGTGG + Intronic
1184832336 22:46996675-46996697 TGGGCCTCAGCCGGTGGTCGGGG - Intronic
1184838756 22:47040230-47040252 TGGGCACCGGCCAGGCGTGGTGG - Intronic
1185013280 22:48328341-48328363 TGGGCTTTGGCCGGGTGTGTTGG - Intergenic
1185071053 22:48656127-48656149 TCAGCGTCGGCCGGGCGTGGTGG - Intronic
949675621 3:6449738-6449760 TGGTTCTCAGCCAGGCGTGGTGG + Intergenic
949995844 3:9616529-9616551 GTGGCTTGGGCCGGGCGTGGTGG + Intergenic
950060442 3:10067010-10067032 GGAGATTCAGCCAGGCGTGGTGG - Intronic
950258029 3:11521837-11521859 TGGGCTGGGGCCGGGCGTGGTGG - Intronic
950390779 3:12694801-12694823 TGAGGTACAGCCGGGCGTGGTGG - Intergenic
950465708 3:13152581-13152603 TTGGTTCCAGCTGGGCGTGGTGG + Intergenic
952108219 3:30093032-30093054 TGCGCCTCAGCCTGGAGTGGAGG + Intergenic
952375921 3:32767229-32767251 TGGCTTTCAGCCGGGCGCAGTGG + Intronic
952423804 3:33154233-33154255 TGAGCTTAGGCCGGGCATGGTGG + Intronic
952765232 3:36947441-36947463 CAGGCCTCAGCCAGGCGTGGTGG + Intergenic
953323609 3:41993833-41993855 GAGGTTTCACCCGGGCGTGGAGG - Intergenic
953337450 3:42105239-42105261 TTAGCTTCTGCTGGGCGTGGTGG - Intronic
953366630 3:42351049-42351071 TGTGCTTGAGTCAGGCGTGGTGG - Intergenic
953488304 3:43324220-43324242 TGGCGTTAGGCCGGGCGTGGTGG + Intronic
953838852 3:46372241-46372263 TGAGTTGCAGCCGGGCATGGTGG + Intronic
953936860 3:47052458-47052480 GGTTTTTCAGCCGGGCGTGGTGG - Intronic
953968285 3:47326949-47326971 TGTGTTTTGGCCGGGCGTGGTGG + Intronic
954113417 3:48449124-48449146 TGAGTTTCAGCCGGGTGTGGTGG + Intronic
954161348 3:48724916-48724938 CGGGCTAGGGCCGGGCGTGGTGG + Intronic
954183651 3:48900495-48900517 TCAGATTCGGCCGGGCGTGGTGG + Intergenic
954204713 3:49049913-49049935 TGTGCTTGAGCTGGGCGCGGTGG + Intronic
954744014 3:52776702-52776724 AGGGTTTCAGTCGGGCGAGGTGG - Intergenic
954887137 3:53884914-53884936 TGGACTTCAGCCTGGCGCGGTGG - Exonic
955182629 3:56685974-56685996 TGGGCATGGGCCAGGCGTGGTGG + Intergenic
955262347 3:57406061-57406083 TGGGCTTGGGCTGGGCGCGGTGG + Intronic
955269751 3:57485684-57485706 TGGCCTCCAGCCGGGTGCGGTGG - Intronic
955618444 3:60834569-60834591 GGGTCTTAGGCCGGGCGTGGTGG + Intronic
956410261 3:68971711-68971733 TGGGTTACAGCTGGGCGTGGTGG - Intergenic
956412987 3:68997654-68997676 TGCCATTCAGCAGGGCGTGGTGG - Intronic
956475659 3:69617416-69617438 TGAGTTTCGGCCGGGCGCGGTGG - Intergenic
957048805 3:75396250-75396272 TGGGCTTCGGCCCGGGGTGCAGG - Intergenic
957509572 3:81169866-81169888 TAGGTTTCGGCCGGGCGTGGTGG - Intergenic
958619115 3:96533681-96533703 CTGCCTTTAGCCGGGCGTGGGGG + Intergenic
960474511 3:118107679-118107701 TAGGTTCCGGCCGGGCGTGGTGG - Intergenic
960529979 3:118753444-118753466 GGGGTTTTAGCTGGGCGTGGTGG - Intergenic
960814133 3:121656134-121656156 ATGGTTTCGGCCGGGCGTGGTGG - Intronic
961696069 3:128705807-128705829 GGAGCTCCAGCCAGGCGTGGTGG + Intergenic
961861548 3:129920552-129920574 TGTGTTTCAGCCAGGCGTGGTGG + Intergenic
962094255 3:132277291-132277313 TGAGGTTCGGCCGGGCGCGGTGG + Intronic
962179142 3:133187460-133187482 TGGTCTTGGGCCGGGCATGGTGG + Intronic
962282593 3:134063510-134063532 ATGACTTCAGCCAGGCGTGGTGG + Intergenic
962298319 3:134214092-134214114 TGAGCTTCGGCCGGGCGCGGTGG - Intronic
962334917 3:134519419-134519441 TTCAATTCAGCCGGGCGTGGTGG - Intronic
963131597 3:141863317-141863339 AGGGAATCAGCCGGGCATGGTGG - Intergenic
963273513 3:143308287-143308309 AGGATTTCAGCCAGGCGTGGTGG + Intronic
963595430 3:147318903-147318925 TGGACTTTGGCCGGGCATGGTGG - Intergenic
963743330 3:149101020-149101042 TCGGTTTCAGCTGGGTGTGGTGG - Intergenic
963748423 3:149149248-149149270 AGGGTTTCGGCCAGGCGTGGTGG - Intronic
963926775 3:150959339-150959361 TAGGTTACAGCCGGGCTTGGTGG + Intronic
963950733 3:151197433-151197455 GTGACTCCAGCCGGGCGTGGTGG - Intronic
964106939 3:153049653-153049675 TTAGCTTCAGCCGGGAGCGGTGG + Intergenic
964523437 3:157591543-157591565 TGGAATTGGGCCGGGCGTGGTGG - Intronic
964717420 3:159737019-159737041 TGGTCTTTGGCCGGGCGTGGTGG - Intronic
965250436 3:166336825-166336847 TATTCATCAGCCGGGCGTGGTGG + Intergenic
965780547 3:172281395-172281417 ATGGCATTAGCCGGGCGTGGTGG - Intronic
966079369 3:175980311-175980333 TGGGCCTGTGCCGGGCGTGGTGG - Intergenic
966382805 3:179360201-179360223 TTAGTCTCAGCCGGGCGTGGTGG - Intronic
966384839 3:179385198-179385220 AGGACTTCGGCCGGGCGCGGTGG - Intronic
966385650 3:179394700-179394722 TGGCTTTCGGCCGGGCGCGGTGG - Exonic
966540202 3:181080940-181080962 GGAAGTTCAGCCGGGCGTGGTGG + Intergenic
966613968 3:181894791-181894813 TGGGCTTTGGCCTGGCGTGGTGG - Intergenic
966648117 3:182269598-182269620 AAGTTTTCAGCCGGGCGTGGTGG + Intergenic
966663555 3:182444452-182444474 TTATTTTCAGCCGGGCGTGGTGG - Intergenic
966712005 3:182980685-182980707 GGGGCTTCCCCCGGGCGCGGGGG + Intronic
966801445 3:183767802-183767824 TGGTATCCTGCCGGGCGTGGTGG - Intronic
967870857 3:194227795-194227817 TGCACTTCGGCCGGGCATGGTGG - Intergenic
968121838 3:196131365-196131387 TGGGGGACAGCCGGGCGTGGTGG + Intergenic
968156546 3:196385717-196385739 TGGGCGGCTGCCGGGCGTAGGGG - Intronic
968351390 3:198056750-198056772 TTGTCTTCGGCCGGGCGCGGTGG + Intergenic
968412002 4:397553-397575 TCTGCTTCTGCTGGGCGTGGTGG + Intergenic
968636201 4:1681428-1681450 GCGAGTTCAGCCGGGCGTGGTGG - Intronic
968691771 4:1993950-1993972 TAGGCCTGGGCCGGGCGTGGTGG - Intronic
969100567 4:4765198-4765220 TGGGCTCCGGCCGGGCGCGGTGG - Intergenic
969226412 4:5801389-5801411 AAGGCCTCGGCCGGGCGTGGTGG + Intronic
969254618 4:5993527-5993549 TGGGCTCAAGCCGGGTGTGGTGG + Intergenic
969426066 4:7124697-7124719 TGGGTATAGGCCGGGCGTGGTGG - Intergenic
969562679 4:7959598-7959620 GGGTCTCCGGCCGGGCGTGGTGG + Intergenic
970854489 4:20636558-20636580 AGGGGTTCAGCTGGGCGCGGTGG + Intergenic
970881684 4:20939657-20939679 TGGGCTGAGGCCAGGCGTGGTGG - Intronic
971215392 4:24657757-24657779 TGGTTTTCAGCCAGGTGTGGTGG + Intergenic
971888420 4:32483501-32483523 TGGTCACCAGACGGGCGTGGTGG - Intergenic
972483466 4:39520049-39520071 TAAGCTTCAGCCGGGCATGGTGG + Intronic
972500871 4:39676684-39676706 TGGGCATCGGACGGGCGCGGTGG + Intergenic
972506452 4:39724457-39724479 TGGGCATGGGCCGGGCATGGTGG + Intronic
972537969 4:40014847-40014869 TGGGGCACAGCTGGGCGTGGTGG - Intergenic
972563734 4:40251048-40251070 CCAGCTTCGGCCGGGCGTGGTGG + Intergenic
972567697 4:40284054-40284076 TTCCATTCAGCCGGGCGTGGTGG - Intergenic
972605001 4:40605541-40605563 TGGTCTTCGGCCGGGCACGGTGG + Intronic
972628047 4:40819962-40819984 TCACTTTCAGCCGGGCGTGGTGG - Intronic
972665512 4:41161317-41161339 TAGCATTCAGCCGGGCATGGTGG + Intronic
972788611 4:42349542-42349564 TGGGAGTAGGCCGGGCGTGGTGG + Intergenic
974053253 4:56960817-56960839 TGCATTTCAGCCGGGCGCGGTGG - Intergenic
974296961 4:60012643-60012665 TGAGCACCAGCCGGGGGTGGTGG - Intergenic
975201314 4:71593210-71593232 TTGGCTTCAGCTGGGGGAGGAGG - Intergenic
976089866 4:81446085-81446107 TGTCCTTAGGCCGGGCGTGGTGG + Intronic
977091087 4:92676465-92676487 AGAGGCTCAGCCGGGCGTGGTGG - Intronic
977276257 4:94980840-94980862 TGGGTATTAGCCGGGCGTGGTGG + Intronic
977608784 4:99011651-99011673 TGAGCTTGGGCTGGGCGTGGTGG + Intronic
978425704 4:108579980-108580002 TGGGTTTTAGCCGGACGCGGTGG + Intergenic
978573584 4:110166323-110166345 TGTGTTTCAGCCAGGCGCGGTGG + Intronic
978819630 4:112950793-112950815 TGTGCCTCGGCCGGGCGCGGTGG + Intronic
979946059 4:126832145-126832167 TGGTGTTCTGCCGGGCATGGTGG - Intergenic
980070197 4:128235551-128235573 GAGGCTTCGGCCGGGCATGGTGG - Intergenic
980427873 4:132650111-132650133 TGGACTTTGGCCGGGCGCGGTGG + Intergenic
980919109 4:139064590-139064612 TGACCTTCGGCCGGGCGTGTTGG + Intronic
981213069 4:142131666-142131688 TGCCCTACAGCCGAGCGTGGTGG + Intronic
981469282 4:145111612-145111634 AGGGCTTAGGCCAGGCGTGGTGG - Intronic
981705302 4:147653158-147653180 TTGGTTTCAGCCGGGCATGGTGG + Intronic
982017892 4:151174172-151174194 TGGGCCTCAGCTGGGAGTGCTGG - Intronic
982042446 4:151409266-151409288 TGAGTTTGAGCCGGGCCTGGAGG + Exonic
982461427 4:155674066-155674088 TGTGCTATGGCCGGGCGTGGTGG + Intronic
982607171 4:157529224-157529246 TGTAATTCAGCCAGGCGTGGTGG + Intergenic
982678824 4:158406058-158406080 ATGTCTTCAGCCGGGCGTGGTGG - Intronic
982965494 4:161901644-161901666 TGGGTTTAGGCCGGGCATGGTGG + Intronic
983011798 4:162556425-162556447 TGTCCTTCAGCTGGGTGTGGTGG - Intergenic
983016622 4:162621447-162621469 TCATCTTCAGCCGGGTGTGGTGG + Intergenic
983170282 4:164528380-164528402 CTTGCTTCAGCTGGGCGTGGTGG + Intergenic
983199459 4:164845175-164845197 CTGGCCTCAGCCGGGTGTGGTGG + Intergenic
983220172 4:165036579-165036601 TGTGCTTAGGCCGGGCGTGGTGG + Intronic
983263113 4:165477785-165477807 TGTGCTTCAGGAGGGGGTGGTGG + Intronic
983295852 4:165868159-165868181 TGGGCTTTAGCTGGGGATGGAGG + Intergenic
983441580 4:167793268-167793290 TGGCTTTCAGCTGGGCATGGTGG + Intergenic
984304749 4:177974085-177974107 GATGTTTCAGCCGGGCGTGGTGG + Intronic
984426841 4:179598207-179598229 TCTGTTTCAGCAGGGCGTGGTGG + Intergenic
984575984 4:181448456-181448478 TGGATTTCGGCCGGGCGCGGTGG - Intergenic
984688934 4:182703021-182703043 TGGGCTTGGGCCAGGCGCGGTGG - Intronic
984786035 4:183568040-183568062 TGAACTTGGGCCGGGCGTGGTGG + Intergenic
984848529 4:184130269-184130291 TGGGTTTTGGCCGGGCGCGGTGG + Intronic
984909033 4:184654737-184654759 ACTGCTTCAGCCGGGCGCGGTGG - Intronic
985288003 4:188356736-188356758 TGCTCTTCAGCCGGGCACGGTGG - Intergenic
985881741 5:2643440-2643462 TGGGATTCTGCCCGGCCTGGTGG + Intergenic
986395270 5:7323038-7323060 GGGACATCAGCCGGGCATGGTGG + Intergenic
986631509 5:9778165-9778187 TGGCCTCCCGCCGGGCGTGGTGG - Intergenic
986700889 5:10407664-10407686 TGGGCTAAGGCCAGGCGTGGTGG + Intronic
986913828 5:12590451-12590473 TGAGATTCTGCCGGGCGTGGTGG - Intergenic
987573916 5:19702476-19702498 TCCCTTTCAGCCGGGCGTGGTGG + Intronic
988566443 5:32323129-32323151 TGAACATCGGCCGGGCGTGGCGG + Intergenic
988588814 5:32531078-32531100 TGGGCTCTTGCTGGGCGTGGTGG - Intergenic
989058625 5:37388401-37388423 TGTATTTCAGCTGGGCGTGGTGG - Intronic
989205727 5:38807271-38807293 TGAGTTTCAGCCGGGCGTGGTGG + Intergenic
989264282 5:39455075-39455097 TGGGTCTTGGCCGGGCGTGGTGG - Intronic
989477680 5:41892905-41892927 AGGGCTGAAGCTGGGCGTGGTGG + Intergenic
989571300 5:42948624-42948646 TAGGCTGCAGCCGGGTGCGGTGG - Intergenic
990465003 5:56063436-56063458 GGGACTTGAGCCGGGCGTGGTGG + Intergenic
991249570 5:64544887-64544909 TGGCTTTTGGCCGGGCGTGGTGG + Intronic
991731459 5:69593647-69593669 AGGCTTTCAGCCGGGCGCGGTGG + Exonic
991807891 5:70448802-70448824 AGGCTTTCAGCCGGGCGCGGTGG + Intergenic
991863494 5:71034206-71034228 AGGCTTTCAGCCGGGCGCGGTGG - Intergenic
992232184 5:74674314-74674336 AGGTTTTCAGCCAGGCGTGGTGG + Intronic
992296342 5:75330663-75330685 TAGGAATGAGCCGGGCGTGGTGG + Intergenic
992439550 5:76786405-76786427 TGGATTTTAGCCGGGTGTGGTGG + Intergenic
992665025 5:78999618-78999640 TGGAGAACAGCCGGGCGTGGTGG - Intronic
992720380 5:79554845-79554867 TGGGCTTCAGCCAGGAATGGTGG - Intergenic
992727898 5:79627770-79627792 TTGGTTCCAGCCAGGCGTGGTGG - Intronic
992867896 5:80976128-80976150 ATTGCTTTAGCCGGGCGTGGTGG - Intronic
993608135 5:90020034-90020056 GGGGGATCGGCCGGGCGTGGTGG + Intergenic
995452214 5:112314378-112314400 TGGAAGTCAGCCGGGCATGGTGG + Intronic
995791886 5:115897847-115897869 TGAGCTGTGGCCGGGCGTGGTGG - Intronic
996719809 5:126618941-126618963 TTGTCTCCGGCCGGGCGTGGTGG - Intronic
997521401 5:134526389-134526411 CGGGCTCCGGCCGGGCGTAGGGG + Intronic
997549773 5:134741791-134741813 TTGGATTTAGCCGGGCGTGGTGG + Intronic
997950075 5:138235604-138235626 TCAGCTTCAGCTGGGCGTGGTGG + Intergenic
997983828 5:138488157-138488179 TGCACTCCAGCCTGGCGTGGTGG + Intergenic
998017211 5:138741976-138741998 TGGCCCTCAGTCGGGCGCGGTGG + Intronic
998491121 5:142547237-142547259 TTGGCTTTGGCCGGGCGTGGTGG - Intergenic
998812949 5:145984867-145984889 TTGGCTTCAGCTGGGCATGGTGG + Intronic
999136838 5:149326249-149326271 TTGCCCTCAGCCGGGCGTGATGG + Intronic
999458873 5:151740575-151740597 TGGATTTCAGCTGGGGGTGGTGG + Intergenic
999725979 5:154438069-154438091 ATGGCCTCGGCCGGGCGTGGTGG + Intergenic
999992988 5:157065901-157065923 TGGAAATTAGCCGGGCGTGGTGG + Intergenic
1000471338 5:161645925-161645947 CGGTCTCCAGCCAGGCGTGGTGG + Intronic
1000550228 5:162652961-162652983 TGGGTGCCAGCCGGGCGTGGTGG + Intergenic
1000680487 5:164177914-164177936 TGGGACTCGGCCGGGCGCGGTGG + Intergenic
1001683876 5:173578027-173578049 TGGGCTCCACCCTGGCGGGGAGG - Intergenic
1001811731 5:174634136-174634158 TGGGTATAGGCCGGGCGTGGTGG - Intergenic
1001967370 5:175920646-175920668 AGGGATTCAGCCAGGCGTGGTGG - Intronic
1002063436 5:176640172-176640194 TTGGCTTCTTCCCGGCGTGGTGG - Intronic
1002288786 5:178184184-178184206 TGGGCGTCAGCCGGGCATGGTGG - Intergenic
1002291113 5:178201512-178201534 TGAGGCTCAGCTGGGCGTGGTGG - Intergenic
1002365325 5:178705331-178705353 AGGTCTTAGGCCGGGCGTGGTGG - Intergenic
1002492370 5:179587741-179587763 TGTGCTTCAGGCAGGTGTGGTGG + Intronic
1002680287 5:180956814-180956836 CAGGCATCAGCCAGGCGTGGTGG - Intergenic
1003072547 6:2956532-2956554 AGGCCTCTAGCCGGGCGTGGTGG + Intronic
1003405498 6:5824181-5824203 TGGGCTAGAGCCAGGCGAGGTGG - Intergenic
1003518707 6:6839339-6839361 AGGGTTGCAGCTGGGCGTGGAGG - Intergenic
1003616502 6:7659626-7659648 TAGGCTTAGGCCAGGCGTGGTGG - Intergenic
1003898271 6:10628731-10628753 CTGGCTTGGGCCGGGCGTGGTGG + Exonic
1003917736 6:10803247-10803269 AGGATTACAGCCGGGCGTGGTGG + Intronic
1004023489 6:11796345-11796367 CTGGCTTCAGCCGGGCATGGTGG + Intronic
1004165053 6:13249509-13249531 GGTGATTAAGCCGGGCGTGGTGG + Intronic
1004295474 6:14406197-14406219 TGCTCTCCGGCCGGGCGTGGTGG + Intergenic
1004430330 6:15537131-15537153 TTGGCTTAGGCCGGGCGCGGTGG + Intronic
1005611037 6:27525496-27525518 CAGGCTTCGGCCGGGCGCGGTGG + Intergenic
1005616907 6:27582361-27582383 CGCGCATTAGCCGGGCGTGGTGG - Intergenic
1005618663 6:27600084-27600106 CGGGTTTTAGCTGGGCGTGGTGG + Intergenic
1005629853 6:27697164-27697186 TAGGCTTTTGCCGGGCGCGGTGG + Intergenic
1005965998 6:30726843-30726865 TGGGCTTGGGCCGGGCACGGTGG - Intergenic
1006609100 6:35282184-35282206 TGGGATTAAGCTGGGCTTGGTGG + Intronic
1006738009 6:36288743-36288765 GGGTCTCCAGCCGGGCATGGTGG - Intronic
1006835024 6:36992910-36992932 TGGGAATTAGCCAGGCGTGGCGG - Intergenic
1007016215 6:38469604-38469626 TGGGTTCCTGCCGGGCGCGGTGG - Intronic
1007272161 6:40646175-40646197 TGGGCATGAGCAGGGGGTGGTGG - Intergenic
1007548065 6:42709041-42709063 CGGGGTCCAGCCGGGCGCGGTGG + Intronic
1007561954 6:42816725-42816747 AGAGTATCAGCCGGGCGTGGTGG + Intronic
1008620971 6:53271262-53271284 TAGGCTCAGGCCGGGCGTGGTGG + Intronic
1010042565 6:71403377-71403399 AGGGCTTCAGCAGGGCATTGAGG - Intergenic
1010218209 6:73424145-73424167 TGTATTTCAGCCAGGCGTGGTGG + Exonic
1010687504 6:78869819-78869841 GGAGCCTGAGCCGGGCGTGGTGG + Intronic
1011037382 6:82992508-82992530 TGGATGTCAGCTGGGCGTGGTGG - Intronic
1011471041 6:87708036-87708058 AGGACTTCGGCCGGGCGCGGTGG - Intergenic
1011613191 6:89173469-89173491 TTAGCTTCAGCTGGGCATGGGGG - Intergenic
1011729375 6:90244904-90244926 TAGGCTTTAGCCAGGTGTGGTGG + Intronic
1012954048 6:105549174-105549196 TAAGATGCAGCCGGGCGTGGTGG - Intergenic
1013018847 6:106189466-106189488 TTAGCTTTAGCTGGGCGTGGTGG + Intronic
1013237905 6:108215060-108215082 CTGGTTTCAGCCGGGCGTGGTGG + Intronic
1013522103 6:110942792-110942814 TGGGCTTAGGCCGGGAGTGGTGG - Intergenic
1013965761 6:115953474-115953496 TGGCCTTGGGCCGGGCGCGGTGG - Intronic
1013969582 6:116000950-116000972 GGAGCTTGGGCCGGGCGTGGTGG + Intronic
1014090912 6:117402598-117402620 TGAGCTCCAGCTGGGCGAGGTGG + Intronic
1015101592 6:129488020-129488042 TAAACTTTAGCCGGGCGTGGTGG + Intronic
1015773228 6:136789977-136789999 TGTGCTTGGGCCAGGCGTGGTGG - Intronic
1016196613 6:141351221-141351243 AGTGGTTCAGCCGGGTGTGGTGG - Intergenic
1016401453 6:143685842-143685864 TGCACTTAGGCCGGGCGTGGTGG + Intronic
1016465669 6:144322649-144322671 TGGATTTCGGCCGGGCGCGGTGG + Intronic
1016673730 6:146738743-146738765 TGGGATTCGGCCGGGCGCAGTGG - Intronic
1017119596 6:151011773-151011795 TGGGGACCAGCCAGGCGTGGTGG + Intronic
1017132698 6:151121676-151121698 TGGATTTTGGCCGGGCGTGGTGG - Intergenic
1017503308 6:155045347-155045369 GGGCTTTCTGCCGGGCGTGGTGG - Intronic
1017806857 6:157953645-157953667 TGGCTTTGAGCCGGGCATGGTGG - Intergenic
1017889602 6:158627626-158627648 TGGGCGTCAGCATGGCGAGGTGG + Intronic
1017895835 6:158679080-158679102 TGGGATTAGGCCGGGTGTGGTGG + Intronic
1017953316 6:159156992-159157014 TGTGCTCCTGCCGGACGTGGTGG - Intergenic
1018010245 6:159663230-159663252 TGTGCTTGGGCCGGGTGTGGTGG - Intergenic
1018303080 6:162424446-162424468 TGGGGGTGTGCCGGGCGTGGTGG + Intronic
1019214672 6:170435466-170435488 CGGGCCTGAGCCTGGCGTGGGGG - Intergenic
1019469750 7:1212549-1212571 TGAGCAGCAGCCGGGCGTGGTGG - Intergenic
1020012045 7:4810846-4810868 TGAGATTAGGCCGGGCGTGGTGG + Intronic
1020282967 7:6659880-6659902 TGGCCTTGGGCCGTGCGTGGTGG + Intergenic
1020666346 7:11048283-11048305 TTGATTTCAGCTGGGCGTGGTGG + Intronic
1020816026 7:12907291-12907313 TGGATTTCAGCTGGGCATGGTGG - Intergenic
1020850302 7:13344766-13344788 TGGACTTGGGCCAGGCGTGGTGG - Intergenic
1020984279 7:15112931-15112953 TGGGCTTCAGCAGGTTGTGCAGG + Intergenic
1021466715 7:20952559-20952581 TTTGCTTTGGCCGGGCGTGGTGG + Intergenic
1021686889 7:23194646-23194668 TGGATTACAGCCGGGCGCGGTGG - Intronic
1021832871 7:24634515-24634537 TGTGCTTCAGCCGGGCGTGGTGG - Intronic
1021892527 7:25199838-25199860 TGGCCTGCAGCCAGGAGTGGTGG - Intergenic
1021976870 7:26019786-26019808 TGGGGGCAAGCCGGGCGTGGTGG + Intergenic
1021986756 7:26104935-26104957 TGGGTCCCAGCCGGGCATGGTGG - Intergenic
1022157618 7:27676126-27676148 GGGCCTTTGGCCGGGCGTGGTGG + Intergenic
1022162221 7:27722660-27722682 TGTGAATTAGCCGGGCGTGGTGG - Intergenic
1023023567 7:36031886-36031908 TGGTTCTCAGCTGGGCGTGGTGG - Intergenic
1023027799 7:36066810-36066832 TGGTTTTCCACCGGGCGTGGTGG + Intergenic
1023047949 7:36227973-36227995 TGGGATTAGGCCGGGTGTGGTGG - Intronic
1023156536 7:37257299-37257321 TGGGTTCCAGCCAGGCATGGTGG + Intronic
1023469193 7:40495197-40495219 ATAGTTTCAGCCGGGCGTGGTGG - Intronic
1023630477 7:42158780-42158802 TAGTCTTCAGCTGGGCGCGGTGG - Intronic
1023838619 7:44082778-44082800 TGGGCTGGAGCGGGGCGGGGAGG + Intergenic
1023953688 7:44868614-44868636 TGGTCTTCAGCCGGGCGTGGCGG - Intergenic
1023971508 7:44994676-44994698 TGGGTTTAAGCCAGGCGCGGTGG + Intergenic
1024024552 7:45399691-45399713 TGGGTTTCGGCCGGGCGCGGTGG + Intergenic
1024322927 7:48088318-48088340 TGGGGTTGGGCCGGGAGTGGTGG - Intergenic
1025114441 7:56245734-56245756 TGGTCTTCATCTGGGGGTGGTGG - Intergenic
1025120423 7:56297064-56297086 TTGGGTACAGCCGGGCGCGGTGG - Intergenic
1025166958 7:56720931-56720953 TGAGCCTTGGCCGGGCGTGGTGG - Intergenic
1025251703 7:57355648-57355670 TGGACCTGGGCCGGGCGTGGTGG - Intergenic
1025729682 7:64098843-64098865 TGGGATTTCACCGGGCGTGGTGG + Intronic
1025940525 7:66073545-66073567 GGGGTTTCAGCCGGGCGCAGTGG + Intergenic
1026164139 7:67895038-67895060 GGGGCTTGGGCCGGGCATGGTGG + Intergenic
1026174179 7:67981476-67981498 TGAGACTCAGCCGGGCATGGCGG - Intergenic
1026461830 7:70621196-70621218 GTGGCTTCTGCCGGGAGTGGGGG + Intronic
1026615527 7:71899428-71899450 GGTGTCTCAGCCGGGCGTGGTGG - Intronic
1026618709 7:71931552-71931574 TGGTTTTCAGCTGGGCGCGGTGG - Intronic
1026712840 7:72757937-72757959 TGGGTGTAGGCCGGGCGTGGTGG + Intronic
1026813253 7:73487273-73487295 TGTGGATCAGCTGGGCGTGGTGG + Intronic
1026839171 7:73659450-73659472 TGGGCATTGGCCGGGCGTGGTGG - Intergenic
1026929170 7:74213708-74213730 GGAGCTCCAGCAGGGCGTGGTGG - Intronic
1027027952 7:74868094-74868116 TTGTCTCCAGCCGGGCGCGGTGG - Intergenic
1027059798 7:75075977-75075999 TTGTCTCCAGCCGGGCGCGGTGG + Intergenic
1027159378 7:75791309-75791331 GGAGTTTCAGCCAGGCGTGGTGG - Intergenic
1027187070 7:75979082-75979104 AAGGATGCAGCCGGGCGTGGTGG - Intronic
1027590502 7:80113078-80113100 TGGGATTGGGCCGGGCGCGGTGG - Intergenic
1027661560 7:80993922-80993944 TGGACTTCGGCCGGGCGCAGTGG - Intergenic
1028166677 7:87546299-87546321 GGGGCTTGGGCCGGGCGTGGTGG + Intronic
1028199613 7:87945798-87945820 ATGGCTTCAGCCGGGCGTGGTGG - Intronic
1028565615 7:92227724-92227746 GGGGTTTCGGCCAGGCGTGGTGG + Intronic
1028583423 7:92430027-92430049 TGGGCTTTGGCCAGGCATGGTGG - Intergenic
1028604707 7:92643172-92643194 CGGGATTTGGCCGGGCGTGGTGG - Intronic
1028795100 7:94893746-94893768 TGGGCCTCGGCCGGGTGTGGTGG - Intergenic
1029027554 7:97433115-97433137 TTTCCTTCGGCCGGGCGTGGTGG - Intergenic
1029452440 7:100648704-100648726 GGGGCTTCGGCAGGGGGTGGGGG - Intronic
1029555386 7:101265241-101265263 GGGGCATCGGCCGGGCATGGTGG - Intergenic
1029579096 7:101423445-101423467 TGGGGTCCGGCCCGGCGTGGTGG + Intronic
1029625917 7:101720178-101720200 GGGGCTTGGGCCGGGCGCGGTGG - Intergenic
1030054936 7:105575748-105575770 GGGGCTTCAGCTGGGTGCGGTGG + Intronic
1030086659 7:105821324-105821346 GAGGTTTCAGCCAGGCGTGGTGG - Intronic
1031062371 7:117066472-117066494 TGAGATTCAGCCAGGCGTGGTGG + Intronic
1031571557 7:123365729-123365751 TGAGTTTCGGCCGGGCGCGGTGG - Intergenic
1032043797 7:128585290-128585312 AGGGCTTCAGCCAGGCTCGGGGG - Intergenic
1032055016 7:128677218-128677240 ACGGGCTCAGCCGGGCGTGGTGG + Intronic
1032096759 7:128942117-128942139 AGGGCTTCAGCCGCACGCGGCGG - Exonic
1032218280 7:129974275-129974297 AGGGTGTCGGCCGGGCGTGGTGG - Intergenic
1032399420 7:131613453-131613475 TGGCCTTCGGCCGGGCGCGGTGG + Intergenic
1032878710 7:136065864-136065886 TGTGCTTTGGCCGGGCGCGGTGG + Intergenic
1033082085 7:138307969-138307991 TGTGTTTTAGCCAGGCGTGGTGG + Intergenic
1033221657 7:139530523-139530545 AGGGCTTCAGCTGGGCATGGTGG + Intronic
1033519940 7:142150226-142150248 AGAGTTTCAGCCAGGCGTGGTGG - Intronic
1033977620 7:147121888-147121910 TGTTTGTCAGCCGGGCGTGGTGG + Intronic
1034547508 7:151798777-151798799 AGGGCTTCAGCCAGGAGAGGAGG - Intronic
1034614309 7:152401821-152401843 AGAGTTGCAGCCGGGCGTGGTGG + Intronic
1034636515 7:152571666-152571688 GGGGTTTCAGCCTGGCGTGGTGG + Intergenic
1035313505 7:157984269-157984291 TGGGGTGGAGCCTGGCGTGGGGG - Intronic
1035313553 7:157984396-157984418 TGGGGTGGAGCCTGGCGTGGGGG - Intronic
1035313574 7:157984451-157984473 TGGGGTGGAGCCTGGCGTGGGGG - Intronic
1035386383 7:158475563-158475585 TGGGTGTCAGCTGGGGGTGGAGG - Intronic
1036050912 8:5195596-5195618 TAAGCTACAGCCGGGCGTGGTGG - Intergenic
1036803493 8:11810371-11810393 TGGGCAGCAGCCTGGCATGGGGG + Intronic
1036901332 8:12671507-12671529 TTGGCTCCGGCCGGGCGCGGTGG - Intergenic
1037111270 8:15166533-15166555 TGTGCATCGGCCAGGCGTGGTGG - Intronic
1037830551 8:22186121-22186143 TTGGGTTGGGCCGGGCGTGGTGG - Intronic
1037881426 8:22575205-22575227 TGGCCTCCAGCTGGGTGTGGGGG + Exonic
1038041298 8:23726575-23726597 GAGGATGCAGCCGGGCGTGGTGG - Intergenic
1038191399 8:25324306-25324328 TGGGCTTCAGTAGTGTGTGGTGG + Intronic
1038193649 8:25346536-25346558 AGGGCTAAGGCCGGGCGTGGTGG + Intronic
1038250905 8:25903406-25903428 GGGGCTACAGCCGGGCGCGGTGG + Intronic
1038555089 8:28505636-28505658 TGGACTCCAGCCAGGCGCGGTGG - Intronic
1038658426 8:29475341-29475363 TGGGCCTAGGCTGGGCGTGGTGG + Intergenic
1038840356 8:31179251-31179273 TTTACTTCAGCCGGGCGCGGTGG + Intergenic
1038938622 8:32279636-32279658 TGAGCCTTGGCCGGGCGTGGTGG - Intronic
1039143153 8:34416093-34416115 TGGGTTTTGGCCGGGCGCGGTGG + Intergenic
1039226800 8:35397191-35397213 TGGGCTTGGGCTGGGCGTGGTGG - Intronic
1039516388 8:38137257-38137279 CGGGCATCGGCCGGGTGTGGCGG + Intronic
1039681488 8:39742456-39742478 CCAGCCTCAGCCGGGCGTGGTGG + Intergenic
1039697617 8:39929338-39929360 TGGGATGCAGCCAGGTGTGGTGG + Intergenic
1040413106 8:47174529-47174551 TGCCATTCAGCCGGGCGTGGTGG - Intergenic
1040419884 8:47229254-47229276 TGGATATCGGCCGGGCGTGGTGG + Intergenic
1040477548 8:47793340-47793362 TGGGCCTCAGCTGGGCATGGTGG + Intronic
1040591873 8:48800534-48800556 TGGCCTTGAGCTGGGCGCGGTGG + Intergenic
1041060807 8:54032750-54032772 TGGGTCTCGGCCGGGCATGGTGG + Intergenic
1041083282 8:54233737-54233759 TCAGATTCAGCAGGGCGTGGTGG - Intergenic
1041245956 8:55888823-55888845 AGGGATTCGGCCAGGCGTGGTGG - Intronic
1041652988 8:60319629-60319651 TGAGTTTTGGCCGGGCGTGGTGG + Intergenic
1041763530 8:61393167-61393189 TAGAATTCAGCCGGGTGTGGTGG - Intronic
1042413535 8:68492508-68492530 TGGACTTGAGCCTGGCATGGTGG - Intronic
1042569507 8:70147283-70147305 TGAGTTTGGGCCGGGCGTGGTGG - Intronic
1043227488 8:77749599-77749621 TTGGCCCCAGCTGGGCGTGGTGG + Intergenic
1043372915 8:79613260-79613282 TGGGCCTCAGCTGGGAGGGGTGG - Intronic
1043582382 8:81728671-81728693 TGAGGTTCAGCTGGGCATGGTGG - Intronic
1043979494 8:86621775-86621797 TTGTCTCCAGCCAGGCGTGGTGG + Intronic
1044285953 8:90412260-90412282 TGGGCTTGAGCAGGTCGTGAAGG - Intergenic
1044658606 8:94573678-94573700 AGGCTTTCAGCCAGGCGTGGTGG + Intergenic
1044888607 8:96807518-96807540 TAGTTTTCAGCCGGGCGCGGTGG - Intronic
1045169952 8:99654333-99654355 TCAGTGTCAGCCGGGCGTGGTGG - Intronic
1045312126 8:101011946-101011968 TAGACATCAGTCGGGCGTGGTGG - Intergenic
1045351036 8:101339767-101339789 TAAGCCTTAGCCGGGCGTGGTGG - Intergenic
1045368590 8:101498786-101498808 TTGGATAAAGCCGGGCGTGGTGG + Intronic
1045380359 8:101617790-101617812 GGCTTTTCAGCCGGGCGTGGTGG - Intronic
1045493740 8:102690559-102690581 TGGGTTTTAGCTGGGCCTGGGGG - Intergenic
1045569215 8:103352305-103352327 TGGGCTTTGGCCAGGCATGGTGG - Intergenic
1046055324 8:109071533-109071555 TGGATTTCAGCTGGGCGTGGTGG - Intergenic
1046775925 8:118163586-118163608 GGAGCTTCAGCCGGGTGCGGTGG + Intergenic
1046991839 8:120466583-120466605 TGGGTTTCAGCTGGGCGCGGTGG + Intronic
1047217329 8:122887224-122887246 TAAACTTCAGCCGGGCGTGGTGG + Intronic
1047235010 8:123033454-123033476 TGAGCTTCGGCCGGGAGTAGTGG + Intronic
1049175177 8:141188052-141188074 GTGGCATCAGCCAGGCGTGGTGG + Intronic
1049175181 8:141188071-141188093 GTGGCATCAGCCAGGCGTGGTGG + Intronic
1049616548 8:143578045-143578067 GGGGTTTCTGCCGGGCGTGGGGG + Intronic
1050464691 9:5909543-5909565 TAGGATCCAGCCAGGCGTGGTGG - Exonic
1050533918 9:6614520-6614542 AGGGCTTCAGCTGGGCGTGGTGG - Intronic
1050599534 9:7236256-7236278 AGGTTTTCAGCCCGGCGTGGTGG - Intergenic
1050692945 9:8249077-8249099 AGGTATTCAGCCAGGCGTGGTGG + Intergenic
1050742604 9:8839610-8839632 CTAGTTTCAGCCGGGCGTGGTGG - Intronic
1051146109 9:14029313-14029335 ATGTTTTCAGCCGGGCGTGGTGG + Intergenic
1051278473 9:15419090-15419112 AGGGCTCCAGCTGGGCATGGTGG + Intergenic
1051316459 9:15838717-15838739 TGGTATCCAGCCAGGCGTGGTGG - Intronic
1051439505 9:17069319-17069341 TTGGCTTTGGCCGAGCGTGGTGG + Intergenic
1051625513 9:19096275-19096297 CTGGCTTATGCCGGGCGTGGTGG + Intronic
1051980314 9:23006919-23006941 TGCCATTCTGCCGGGCGTGGTGG + Intergenic
1052284444 9:26769017-26769039 TGTGCATCAGCTGGGCGTGGTGG - Intergenic
1052775183 9:32726067-32726089 TCATCTTCAGCCGGGCGCGGTGG - Intergenic
1052934101 9:34078707-34078729 TGTGCCTCGGCCGGGTGTGGTGG - Intergenic
1053207206 9:36196634-36196656 TGGGTTACAGCTGGGCGCGGTGG - Intronic
1053214049 9:36256530-36256552 TGGGTTTCTGCCGGGCGTGGTGG - Intronic
1053331983 9:37220251-37220273 AGGGCATCGGCCAGGCGTGGTGG + Intronic
1053375043 9:37599125-37599147 TGTGCTTAGGCCGGGCGCGGTGG + Intronic
1053855039 9:42330090-42330112 TGGGCTTAGGCCGGGCGCGGTGG - Intergenic
1054717603 9:68572041-68572063 TTGGCTTCAGACAGGCCTGGAGG - Intergenic
1055026661 9:71729330-71729352 TGGGCACAGGCCGGGCGTGGTGG + Intronic
1055056251 9:72026955-72026977 TTGGCTTCAGCCAGGTATGGTGG - Intergenic
1055932427 9:81573207-81573229 TGGTCATAAGCCGGGCATGGTGG - Intergenic
1056158978 9:83869446-83869468 TTGTCTTCAGCTGGGCGCGGTGG + Intronic
1056517195 9:87365311-87365333 AGGTGCTCAGCCGGGCGTGGTGG + Intergenic
1056810325 9:89758775-89758797 TGAGTTTTAGCCGGGCGTGGTGG - Intergenic
1056987949 9:91382069-91382091 TCTGTTTCGGCCGGGCGTGGTGG + Intergenic
1057027300 9:91744510-91744532 TCAGCTTCAGCTGGGCGTGGTGG - Intronic
1057619580 9:96622854-96622876 TTGGTTTTGGCCGGGCGTGGTGG + Intergenic
1057920321 9:99091838-99091860 TTGTTTTCAGCCGGGCATGGTGG + Intergenic
1058277793 9:103067218-103067240 TGGTGTACGGCCGGGCGTGGTGG - Intergenic
1059105598 9:111508967-111508989 AGGCCATCAGCCAGGCGTGGTGG + Intergenic
1059108782 9:111535008-111535030 TGCACTGCAGCCGGGCGTGGTGG - Intronic
1059126118 9:111687233-111687255 TATACTTCAGCCGGGCATGGTGG - Intronic
1059572866 9:115459197-115459219 TCACTTTCAGCCGGGCGTGGTGG - Intergenic
1060112010 9:120913283-120913305 TGGGGCTCAGCCGGGCTTGAAGG + Intronic
1060277994 9:122196616-122196638 TTGGCTTTTGCCGGGCGCGGTGG - Intronic
1060457356 9:123811044-123811066 AGGGATTTGGCCGGGCGTGGTGG - Intronic
1060457743 9:123816287-123816309 TTGGTTTCAGCTGGGCGTGGTGG - Intronic
1060528520 9:124334062-124334084 TGGACTTGGGCCGGGCGTGGTGG - Intronic
1060535324 9:124381970-124381992 TGATTTTCAGCCGGGCATGGTGG + Intronic
1060956780 9:127647095-127647117 TTTGCTTTGGCCGGGCGTGGTGG - Intronic
1061191997 9:129087601-129087623 CGGCCTTCGGCCGGGCGAGGTGG - Intronic
1061210301 9:129188037-129188059 GGGCCTTCAGCCAGGCATGGTGG - Intergenic
1061233632 9:129329262-129329284 TGGGAGTAGGCCGGGCGTGGTGG + Intergenic
1061260223 9:129476255-129476277 ACGGTCTCAGCCGGGCGTGGTGG - Intergenic
1061454270 9:130685948-130685970 TGGGCATCGGCCGAGCGCGGTGG - Intergenic
1061721032 9:132551581-132551603 CAGGCTTGGGCCGGGCGTGGTGG - Intronic
1061960916 9:133988634-133988656 TGAGTTTCAGCCGGACGCGGGGG + Intronic
1062091354 9:134680248-134680270 TGGCCTGTAGCCGGGCCTGGAGG - Intronic
1062550983 9:137086437-137086459 AGGGCCTCACCCAGGCGTGGGGG - Intergenic
1062750681 9:138250037-138250059 TGGAATTCATCTGGGCGTGGTGG + Intergenic
1185540773 X:901581-901603 TGGGAGCCAGCCGGGCATGGTGG - Intergenic
1185654651 X:1674477-1674499 TTGGCTAAGGCCGGGCGTGGTGG - Intergenic
1185668977 X:1790757-1790779 TGAGTTTCAGCCAGGTGTGGTGG + Intergenic
1185734653 X:2487612-2487634 TGGGCGGTGGCCGGGCGTGGTGG - Exonic
1185748393 X:2590401-2590423 TGGGTTGCAGCCGGGCTTGGTGG + Intergenic
1185791405 X:2930171-2930193 TTGGAATTAGCCGGGCGTGGTGG - Intergenic
1185919072 X:4069043-4069065 TGACCCTCAGCCGGGCGCGGTGG + Intergenic
1185942320 X:4335422-4335444 TTGCCTTTAGCAGGGCGTGGTGG + Intergenic
1186178884 X:6953762-6953784 TGGGCTTCAGCCAGGCTTGGAGG - Intergenic
1186303057 X:8221441-8221463 TGGAAGTCGGCCGGGCGTGGTGG - Intergenic
1186461592 X:9752691-9752713 TGAGCTGCAGCCTGGCCTGGAGG + Intronic
1186642141 X:11467149-11467171 TGGGACTCAGCCAGGCATGGTGG + Intronic
1186752971 X:12640892-12640914 TGGGATTGAGCCAGGCATGGTGG + Intronic
1186946003 X:14568403-14568425 TGGGACTCAGCCGGGCATGGTGG + Intronic
1187175309 X:16891136-16891158 TGTGCCTCAGCTGGGCATGGTGG - Intergenic
1187505642 X:19876069-19876091 TGGGTTAAGGCCGGGCGTGGTGG + Intronic
1187864081 X:23708239-23708261 TGGCTTTAGGCCGGGCGTGGTGG + Intronic
1187866826 X:23730378-23730400 AGGACATCGGCCGGGCGTGGTGG - Intronic
1187919169 X:24184046-24184068 TGTGTTTCAGCCAGGCATGGTGG - Intronic
1188205228 X:27347844-27347866 TGGTTTTCAGCCTGGCGTGGTGG + Intergenic
1188547496 X:31325310-31325332 TGGGCTAAGGCCAGGCGTGGTGG + Intronic
1188731475 X:33651388-33651410 TTGTTTTCAGCCGGGCGCGGTGG + Intergenic
1189003634 X:36972183-36972205 TGAGCTTCAGCTGGTGGTGGGGG - Intergenic
1189359089 X:40335020-40335042 TTGGCTCTGGCCGGGCGTGGTGG + Intergenic
1189433976 X:40974826-40974848 AAAGGTTCAGCCGGGCGTGGTGG + Intergenic
1189460847 X:41241788-41241810 TGGATGTCAGCCGGGCGCGGTGG + Intergenic
1190235380 X:48611050-48611072 TGAAGGTCAGCCGGGCGTGGTGG - Intergenic
1190748317 X:53340061-53340083 TTGGCCCCGGCCGGGCGTGGTGG + Intergenic
1192279785 X:69672592-69672614 TAGGCTTTGGCCGGGCGTGGTGG + Intronic
1192348944 X:70338796-70338818 AGGAATTCAGCCGGGCGCGGTGG + Intronic
1192409208 X:70917931-70917953 TGGTATACAGCCAGGCGTGGTGG - Intergenic
1193955055 X:87849848-87849870 TGTGAATTAGCCGGGCGTGGTGG - Intergenic
1194414736 X:93597161-93597183 AGGCCTATAGCCGGGCGTGGAGG - Intergenic
1194694208 X:97025362-97025384 AGAGTTACAGCCGGGCGTGGTGG + Intronic
1194931735 X:99896609-99896631 AGGGCTTCAGCCGGGCGCGGTGG - Intergenic
1195219791 X:102735693-102735715 AGAGATTCAGCCGGGCGCGGTGG - Intronic
1195690472 X:107620165-107620187 TGGCCAACAGCCGGGCATGGTGG - Intergenic
1196324807 X:114390355-114390377 TGTTCTTCCGCCGGGCGCGGTGG - Intergenic
1196366684 X:114932085-114932107 TGGGTTTCAGACATGCGTGGGGG - Intergenic
1196386612 X:115161063-115161085 TGCTCTTTGGCCGGGCGTGGTGG + Intronic
1197215018 X:123859748-123859770 TCGGTTCCAGCCGGGCGGGGGGG + Intronic
1197812809 X:130463245-130463267 TGACCTTCAACCGGGGGTGGGGG - Intergenic
1198078900 X:133220026-133220048 TGGCTCACAGCCGGGCGTGGTGG - Intergenic
1198456420 X:136822195-136822217 AAAGCTTCAGCTGGGCGTGGTGG + Intergenic
1198563735 X:137881730-137881752 TGTGTTTCGGCCGGGCATGGTGG + Intergenic
1199768420 X:150957689-150957711 TGGGCATAGACCGGGCGTGGTGG + Intergenic
1200014189 X:153146754-153146776 TGGGATGCAGCTGGGCGTGTTGG + Intergenic
1200025411 X:153253198-153253220 TGGGATGCAGCTGGGCGTGTTGG - Intergenic
1200249543 X:154545545-154545567 CGTCCTGCAGCCGGGCGTGGTGG + Intronic
1200403386 Y:2782975-2782997 TTGAACTCAGCCGGGCGTGGTGG + Intergenic
1201010675 Y:9546702-9546724 TGGGCTTCAGGGGGGCATTGGGG - Intergenic
1201014642 Y:9588346-9588368 TTGGTCTCAGCTGGGCGTGGTGG + Intergenic
1201317014 Y:12657408-12657430 AGAACATCAGCCGGGCGTGGTGG - Intergenic
1201798942 Y:17933046-17933068 TGTGGTTCGGCCGGGCGCGGTGG + Intergenic
1201802611 Y:17972911-17972933 TGTGGTTCGGCCGGGCGCGGTGG - Intergenic
1202360244 Y:24101658-24101680 TGTGGTTCGGCCGGGCGCGGTGG + Intergenic
1202510533 Y:25568457-25568479 TGTGGTTCGGCCGGGCGCGGTGG - Intergenic