ID: 906365420

View in Genome Browser
Species Human (GRCh38)
Location 1:45205969-45205991
Sequence CGCCAGCAGCGCCGGCGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 226}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906365402_906365420 27 Left 906365402 1:45205919-45205941 CCCGGGGGGTGGCTGCGGCCCCT 0: 1
1: 0
2: 2
3: 34
4: 337
Right 906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 226
906365408_906365420 7 Left 906365408 1:45205939-45205961 CCTCCTCGGCCGGCGAAGCCCCC 0: 1
1: 0
2: 0
3: 15
4: 214
Right 906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 226
906365401_906365420 28 Left 906365401 1:45205918-45205940 CCCCGGGGGGTGGCTGCGGCCCC 0: 1
1: 0
2: 3
3: 20
4: 354
Right 906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 226
906365411_906365420 -2 Left 906365411 1:45205948-45205970 CCGGCGAAGCCCCCGCGGCGCCG 0: 1
1: 0
2: 0
3: 12
4: 186
Right 906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 226
906365406_906365420 9 Left 906365406 1:45205937-45205959 CCCCTCCTCGGCCGGCGAAGCCC 0: 1
1: 0
2: 1
3: 11
4: 120
Right 906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 226
906365409_906365420 4 Left 906365409 1:45205942-45205964 CCTCGGCCGGCGAAGCCCCCGCG 0: 1
1: 0
2: 1
3: 31
4: 157
Right 906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 226
906365407_906365420 8 Left 906365407 1:45205938-45205960 CCCTCCTCGGCCGGCGAAGCCCC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 226
906365403_906365420 26 Left 906365403 1:45205920-45205942 CCGGGGGGTGGCTGCGGCCCCTC 0: 1
1: 0
2: 3
3: 41
4: 411
Right 906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906365420 Original CRISPR CGCCAGCAGCGCCGGCGCCG GGG Exonic
900091831 1:924104-924126 GGCCACCAGCGCCCGCGCCCGGG - Intergenic
900593029 1:3468242-3468264 CGCCAACAGCGCCTGGGCCAAGG - Intronic
901050787 1:6424960-6424982 CGCCTGCAGCGCCTGCTCCAGGG - Exonic
901058446 1:6460529-6460551 CGCCAGCGACGCCGGTTCCGGGG - Exonic
902520326 1:17011977-17011999 CCCTCGCAGCGCCCGCGCCGGGG + Intergenic
902747308 1:18482428-18482450 ATCCTGCAGCGCCGGCTCCGGGG + Exonic
902856522 1:19210198-19210220 CGGCAGCGGCTCCGGCGCCGGGG - Exonic
903310606 1:22452185-22452207 CTACAGCAGAGCCGGCGCCAGGG - Intronic
903367188 1:22812279-22812301 CTCCAGCAGCTCAGGCCCCGCGG - Intronic
904500125 1:30908532-30908554 CGCCCACGGGGCCGGCGCCGGGG - Exonic
904641954 1:31937944-31937966 CGGCCCCCGCGCCGGCGCCGGGG - Intronic
906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG + Exonic
909585271 1:77282068-77282090 CGCCTGCAGCTCCGGCTCGGGGG + Exonic
913250707 1:116910217-116910239 CGCCAGCAGCAGCGGCCTCGAGG - Exonic
914902361 1:151717488-151717510 CGCCCGCGGCGCCGCCTCCGCGG - Intronic
917846730 1:179026133-179026155 CGCCCGCCGCGCCGGGGGCGGGG - Intronic
917906622 1:179591907-179591929 CACCAGCAGCGCTGGCGTCAGGG + Exonic
917962365 1:180155075-180155097 CTCCCGCAGCGCCTGGGCCGTGG + Exonic
918332401 1:183472531-183472553 CGCCAGCACCCGCGGTGCCGCGG + Exonic
921039535 1:211416660-211416682 AGGCAGCAGCGGCGGCGCCGGGG + Intergenic
921060212 1:211578851-211578873 CGTCCTCAGAGCCGGCGCCGAGG + Intergenic
921217736 1:212951476-212951498 CGGCAGCGGCGGCGGCGGCGGGG - Exonic
922440659 1:225653059-225653081 CGCTCGCCGCGCCGCCGCCGAGG + Exonic
1065712750 10:28533211-28533233 CGGCAGCAGCGGCGGCGGCGGGG + Intronic
1065841281 10:29703540-29703562 CGCCAGCAGCCCCTGTGGCGGGG + Intronic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1066094075 10:32056206-32056228 CGGCAGCGGCGGCGGCACCGGGG + Exonic
1070768310 10:79068814-79068836 CGCCGGCAGCGGCGGCGGCGCGG + Intergenic
1070973392 10:80586048-80586070 CCCCAGCAGTGCCGGCCCAGCGG + Intronic
1071563647 10:86660708-86660730 CGCCAGCAGCACAGGCTCCAAGG + Intronic
1072189135 10:93066351-93066373 CGCCTGCCGCGGCGGCGCCCAGG + Intronic
1073122655 10:101131892-101131914 CGGCAGCAGCGGCGGTGCCGGGG + Exonic
1075699763 10:124461804-124461826 CGACGCCGGCGCCGGCGCCGCGG - Intergenic
1076752145 10:132548651-132548673 CGCCAGTTTCGCCTGCGCCGAGG + Intronic
1077051447 11:568671-568693 CGCCAGCTGCGAGGGCGCGGCGG + Intergenic
1077922968 11:6655473-6655495 CGGCAGCGGCGGCGGAGCCGGGG - Intronic
1078190706 11:9091168-9091190 CGTCAGCAGCTCCGGGTCCGAGG + Intronic
1083800095 11:65041559-65041581 CGCCGACATCGCCCGCGCCGAGG + Exonic
1083965786 11:66042942-66042964 CGCCGCCCGCGCCAGCGCCGCGG + Exonic
1085205827 11:74731359-74731381 TCCCAGCAGCGGCGGCGGCGCGG + Intronic
1086064877 11:82733715-82733737 CGCCTGCACCGCCATCGCCGCGG + Exonic
1093652561 12:21661702-21661724 CCCCAGCAGCGCCGGCCCACTGG + Intronic
1094375371 12:29783650-29783672 GGCCAGCAGCGCCGCGGCCCCGG + Exonic
1094411168 12:30170068-30170090 TGCCAGCAGCGCCGCGGCCCCGG + Intergenic
1096622689 12:52874345-52874367 CGCCGGCCGCGCCCGCTCCGCGG + Intergenic
1097264420 12:57737514-57737536 CGCCACCGCCGCCGCCGCCGGGG - Exonic
1097264575 12:57737988-57738010 CACGAGCAGCGCGGGCACCGGGG - Exonic
1102310746 12:111842561-111842583 CCGAAGCAGAGCCGGCGCCGGGG + Intronic
1103828728 12:123762217-123762239 CGCCGACGGCGCCGGCGCTGGGG - Intergenic
1104891792 12:132143787-132143809 CAGCACCAGCGCCAGCGCCGAGG - Exonic
1104918264 12:132277654-132277676 TGCCAGCAGAGCCGGGGCCGCGG - Intronic
1104980281 12:132570487-132570509 GGCCGGCAGCGCCGGGGGCGGGG - Exonic
1105605147 13:21920853-21920875 CCCCAGCAGTGCCGGCCCAGCGG - Intergenic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1113378127 13:109782937-109782959 CGCCACCGCCGCCGGCCCCGGGG - Exonic
1115119854 14:29927120-29927142 CGCCAGCCTCGCCGGCGCTCTGG - Intronic
1115906691 14:38209476-38209498 CGTCCGCAGCGCCGGCCCCGGGG - Exonic
1116895514 14:50311969-50311991 GGGCAGCAGCGCAGGCGGCGGGG + Intronic
1121074973 14:91060398-91060420 TGGCAGCAGCGGCGGCGCCGCGG - Exonic
1121690832 14:95876357-95876379 CGTCATCAGCAGCGGCGCCGCGG + Intergenic
1122137897 14:99645218-99645240 CGCCAGCAGCGCCCCGGCCCTGG - Exonic
1124579360 15:30939317-30939339 CGCCAGCAGAGCCCGTGCTGAGG - Exonic
1125594065 15:40873346-40873368 CACCAGCAGCACAGGCGCCTGGG + Exonic
1128119232 15:65133547-65133569 CGCCAGCGCCGCCTCCGCCGCGG + Exonic
1130023642 15:80251951-80251973 CTCCAGCCCCGCAGGCGCCGCGG + Intergenic
1130115786 15:81002939-81002961 GGCCAGCAGCGCCGACGCGCTGG - Exonic
1131568168 15:93505560-93505582 GGCCAGCAGCGCCTCCGCCTGGG + Intergenic
1132128458 15:99251514-99251536 CGCCAGCAGAGCCAGCGCTCCGG - Exonic
1132326334 15:100973472-100973494 CGACAGCAGCGGAGGCGCAGGGG - Intronic
1132710882 16:1266710-1266732 AGCCAGCAGCGCCGGACACGAGG + Intergenic
1133127119 16:3654312-3654334 GGCCTGCAGCACCAGCGCCGTGG - Intronic
1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG + Intronic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG + Exonic
1136498814 16:30659609-30659631 CGGGAGCAGCGGCGCCGCCGAGG + Exonic
1136566464 16:31073524-31073546 CGCGAGCAGCGCGGGCGGGGCGG - Intronic
1137231275 16:46569698-46569720 CTCCAGCAGCGCGGGCCCCGGGG - Intergenic
1137655315 16:50153816-50153838 CACCGGCAGCCCCGGCGGCGCGG + Exonic
1138514563 16:57528983-57529005 GGCCAGCAGCGCGGGCGCGGGGG + Exonic
1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG + Intergenic
1139534452 16:67562810-67562832 CGGCGCCAGCGCCGCCGCCGGGG + Intronic
1139583425 16:67886195-67886217 CGCCAGCAGTGGGGGCGCAGGGG - Exonic
1141482009 16:84313084-84313106 TAGCAGCAGCGCCGGTGCCGCGG - Exonic
1141838077 16:86555671-86555693 CGTCCGCAGCGCAGTCGCCGGGG - Intergenic
1142136263 16:88453284-88453306 CGCCAGGAGCGCCCTCGCAGTGG + Intergenic
1142395346 16:89828562-89828584 GGGCAGCTGCGGCGGCGCCGCGG + Exonic
1142631305 17:1228538-1228560 CGGCGGCAGGGCCGGCGCCCGGG - Intronic
1142896577 17:2983043-2983065 GGGCAGCAGCGCCGTCGCTGGGG + Intronic
1142980556 17:3668748-3668770 CGCCCTCCGCGCCTGCGCCGTGG - Intronic
1143030318 17:3963996-3964018 GGCCACCTTCGCCGGCGCCGGGG - Intronic
1143078795 17:4366418-4366440 CGACCGGAGCGCCGGAGCCGAGG + Exonic
1143485367 17:7251305-7251327 CCCCGGCACCGCCGGCCCCGGGG + Exonic
1143540105 17:7563533-7563555 CGCCACCGGGGCCGGCGGCGGGG + Exonic
1143873497 17:9974819-9974841 CGCCAGCAGCTCCGCCACCCAGG + Intronic
1144519832 17:15945989-15946011 CGCCCGCAGCGGCGGTGCAGCGG + Intronic
1147393183 17:40122366-40122388 CGGCAGCAGAGGCGGCGGCGAGG + Intronic
1148178083 17:45584885-45584907 CGGCAGCGGCGGCGGGGCCGGGG + Intergenic
1148262236 17:46193547-46193569 CGCCCGCCGCGCCGCCCCCGCGG + Intronic
1151478545 17:74356881-74356903 GGCCAGCAGCGGCGGCGACGCGG - Exonic
1152545399 17:80997826-80997848 TGCCAGCTGCCCCGGCGCCCTGG + Intronic
1152609903 17:81310297-81310319 CTCCAGCTGCGCAGGGGCCGGGG + Intergenic
1152759048 17:82098743-82098765 CGCGGGCAGCGACGGCGGCGTGG - Intergenic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1154274696 18:12948501-12948523 CGCCCGCAGCCCCGGCAGCGCGG - Intronic
1155928971 18:31685640-31685662 CCCCAGCAGCGCGGTCACCGCGG - Intronic
1160024934 18:75209236-75209258 CGGGGGCTGCGCCGGCGCCGGGG - Exonic
1160701128 19:507918-507940 TACCCGCAGCGCCGGCGCAGGGG + Intronic
1160858683 19:1228560-1228582 CGGCAGCAGCGGTGGCGGCGCGG + Exonic
1161068768 19:2250397-2250419 CACCAGCAGCGCCAGCTCTGGGG - Exonic
1161072421 19:2269531-2269553 GGCGAGCAGCGGCGGCGGCGCGG + Exonic
1161400705 19:4065462-4065484 CGCCGCCACCGCCGCCGCCGGGG - Intronic
1161505089 19:4639524-4639546 TGGGAGCAGCGCCGGAGCCGGGG - Intronic
1162099997 19:8333740-8333762 CGGCAGCTGAGCCGGCCCCGCGG - Exonic
1162341853 19:10096144-10096166 CCCGAGCAGCGCCAGCGCCGCGG + Exonic
1162357461 19:10194923-10194945 CGGCGGCAGCGCAGGCGCCCCGG + Exonic
1162746611 19:12802082-12802104 CGCCAGCAGCAGCGCCCCCGGGG - Intronic
1163123495 19:15232039-15232061 CGCCCGCAGCAGCCGCGCCGGGG + Exonic
1163513076 19:17747711-17747733 CGGCAGCCGCGCCGCAGCCGCGG + Exonic
1165204513 19:34172431-34172453 CGGCGGCAGCGGCGGCGGCGCGG - Intergenic
1166539271 19:43594861-43594883 CGGCAGCAGCGACGGCTGCGAGG - Exonic
1166539337 19:43595126-43595148 CACCCGCAGCGCCGGGGCCCTGG - Exonic
1166721882 19:45001656-45001678 CGCCGGCTGCGCCGGAGCTGGGG + Exonic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168489405 19:56795517-56795539 AACCAGCAGCGCATGCGCCGTGG + Intronic
1168694452 19:58396691-58396713 CACCAGCACCGCCAGCGCCACGG - Exonic
1168719070 19:58544924-58544946 CTCCAGCAGCTCCAGCGCCTCGG - Exonic
926018293 2:9473784-9473806 GGCCAGGGGCGCCGGCGCAGAGG - Intronic
927256360 2:21043907-21043929 CGCCAGCAGCGCCAGCAGCGCGG + Exonic
927904684 2:26848178-26848200 CACCCGCAGCTCCGGCGCCGCGG + Exonic
928518325 2:32064136-32064158 CGGCACCGGCGCCGGGGCCGAGG - Exonic
931021218 2:58046912-58046934 CGCTTGCAGTGCCGGAGCCGCGG + Intronic
934566991 2:95346625-95346647 CTCCAGCCCCGCGGGCGCCGGGG - Intronic
935265180 2:101387488-101387510 CGCCAGCAGCGCTAGTGCCGGGG + Exonic
936278722 2:111120772-111120794 CGCCGGCGGCCGCGGCGCCGAGG + Intronic
938320090 2:130356552-130356574 CGCCAGAAGCGGCGGGGCCGGGG - Intronic
940774992 2:157876025-157876047 GGCCAGCCGCGCCGGCCCCAGGG - Intergenic
941580698 2:167293124-167293146 GACCGGCAGCGCCGGCGGCGCGG - Intergenic
944412292 2:199457105-199457127 CGCGAGCAGTGTCGGCGCCACGG + Intronic
945251258 2:207768203-207768225 CGCCAGGGGCGCCGGCCTCGGGG - Exonic
946248346 2:218399573-218399595 CGCCGGGAGCGCCCACGCCGGGG - Intronic
947418481 2:229921702-229921724 CGCCGGCGGCGGCGGGGCCGCGG - Intronic
947538537 2:230957546-230957568 GCCCAGCACCGCCGGCGCCGCGG - Intronic
948829988 2:240594007-240594029 TGCCAGCACCGCCGGCCCCAGGG - Exonic
1169557618 20:6767679-6767701 CGACGGCGGCGGCGGCGCCGTGG - Exonic
1171346723 20:24470848-24470870 CGTCAGATGCGCTGGCGCCGCGG + Intronic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1173576639 20:44116291-44116313 GGCCCGCTGCGCCGGCGCCCCGG + Exonic
1174358332 20:50012865-50012887 CTCCAGCAGAGCCGGGGCCTGGG + Intergenic
1174611663 20:51802286-51802308 CCCCAGCGGCGCCCGCGGCGGGG - Exonic
1175228716 20:57460361-57460383 CGCCAGGAGCGCAGGAGCCCAGG - Intergenic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1176189386 20:63800711-63800733 CGCCAGCAGTGCCGGCCCACCGG + Intronic
1179502056 21:41816088-41816110 CGCGAGCAACGCCGGGGCGGTGG + Intronic
1179538876 21:42071327-42071349 AGCCAGCAGTGCCAGCCCCGAGG - Exonic
1179563950 21:42234867-42234889 CGCCGCCACCGCCCGCGCCGGGG + Intronic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1181235901 22:21447481-21447503 CCCCTGCAGCGCCAGAGCCGGGG - Exonic
1181465637 22:23109283-23109305 TGCCAGCAGGGCTGGCTCCGTGG - Intronic
1181745423 22:24952606-24952628 CGCCGGCCGCGCCTGCGCGGAGG - Intergenic
1183649360 22:39145371-39145393 CGCCACTAGCGTGGGCGCCGCGG + Intronic
1184265142 22:43342698-43342720 GGACAGAAGAGCCGGCGCCGAGG - Intronic
1184423413 22:44395143-44395165 CACCATCCGCGCCGCCGCCGTGG - Intergenic
1184769156 22:46587854-46587876 CGCCAGAAGCCCGGGCGTCGGGG + Intronic
1185229117 22:49670389-49670411 CCCCAGCAGTGCCGGCCCCCCGG - Intergenic
1185417972 22:50720419-50720441 GGCCGGCAGCGCCCGCGCCCAGG - Intergenic
950487736 3:13282893-13282915 CGCCAGCAGCTCCTGCTGCGCGG + Intergenic
950729770 3:14947544-14947566 CGCCAGCCTCGCCGCCGCGGCGG - Intergenic
951485287 3:23203240-23203262 CGGCGGCAGCGGCGGCGCTGAGG + Intronic
956675022 3:71725289-71725311 CGGCGGCAGCGGCGGCGGCGCGG + Exonic
961666531 3:128496470-128496492 CGCCACCACCGCCCGCGCCTTGG - Intergenic
962318795 3:134374632-134374654 GGCCAGCAGCGCCGCCTCCCCGG - Intronic
966911478 3:184562461-184562483 CGCCACCGGCGCCCGCTCCGGGG + Intronic
967930451 3:194686864-194686886 CGCCTGCCGCGGCGGCGCCTCGG - Exonic
968230784 3:197003435-197003457 CCCCAGCGGCCCCGGCGCCCGGG - Exonic
969436591 4:7192612-7192634 CGGCAGCGGAGCCGGCGGCGGGG - Exonic
970202862 4:13627461-13627483 CGCCCGCCCCGCCCGCGCCGGGG + Exonic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
973759064 4:54100575-54100597 CGCCGGCAGCGGGGGCGCAGGGG + Exonic
975779072 4:77819969-77819991 CCCCCGCAGGGCCGGAGCCGCGG + Intergenic
975986265 4:80203279-80203301 CGGCAGCAGCGTGAGCGCCGAGG - Exonic
976690598 4:87863855-87863877 CCCCAGCAGTGCCGGCCCCCCGG - Intergenic
981128405 4:141132625-141132647 CGCCCGCCGCCCCGGCCCCGGGG + Exonic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
983369761 4:166843012-166843034 CCCCAGCAGCGCCGGCCCACTGG - Intronic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
994043622 5:95284664-95284686 CGCCGCCACCGCCAGCGCCGCGG - Intergenic
997201314 5:132011640-132011662 CGGCAGCGGCGGCGGCGGCGCGG - Exonic
997587236 5:135050648-135050670 TGCCAGCAGAGCTGGCGCAGGGG + Intronic
998166656 5:139848230-139848252 CGCGAGCGGCGCCAGCGCCGGGG + Exonic
999140462 5:149358110-149358132 CGCCAGCAGCGGCGGCGGCGAGG - Exonic
1000319027 5:160119161-160119183 CGCCGCCACCGCCGCCGCCGGGG - Exonic
1001683110 5:173573201-173573223 CGCCCGCAGCTCAGGCTCCGTGG + Intergenic
1002047271 5:176549172-176549194 CGCCAGGAGCTCTGGCGCCTTGG + Intronic
1004179028 6:13365079-13365101 CACCAGCAGCTCCTGCTCCGGGG + Exonic
1004200276 6:13541715-13541737 CCCCAGCAGTGCCGGCCCAGCGG + Intergenic
1004501903 6:16216994-16217016 CCCCAGCAGCGCCGGCCCACTGG + Intergenic
1005722462 6:28616502-28616524 CTCCAGCAGAGCCGGGGCCTCGG - Intergenic
1005832390 6:29681137-29681159 CACCCGCAGTCCCGGCGCCGCGG + Intergenic
1007363220 6:41373206-41373228 CACCCGCAGCTCCGGCGCGGGGG - Intergenic
1008030399 6:46688139-46688161 CGCCCGGAATGCCGGCGCCGGGG + Exonic
1008629348 6:53348635-53348657 CTCCAGCTCCGCCGGCTCCGGGG - Intronic
1010703266 6:79077625-79077647 CGGCGGCAGCGGCGGCGCAGCGG + Intronic
1014205518 6:118651602-118651624 CGCCGGCAGAGCCAGAGCCGGGG + Intronic
1015461036 6:133491662-133491684 CCCCAGCAGGCCCGGCGCAGTGG + Intronic
1017672053 6:156777974-156777996 CGCCAAGAGCGGCGGCTCCGAGG + Exonic
1018400326 6:163414600-163414622 CGGCAGCAGCGGCGGCGGCGGGG - Intronic
1018613024 6:165662091-165662113 CGCCGCCTGGGCCGGCGCCGGGG + Intronic
1019343058 7:517554-517576 CGCCAGGAGCGCCGCCGCCCCGG + Intronic
1019711480 7:2520016-2520038 CGCCCCCAGCCCGGGCGCCGGGG - Exonic
1019989555 7:4682253-4682275 CGGCTGCAGCGGCGGCGCGGGGG - Intergenic
1020046706 7:5046058-5046080 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1020210611 7:6155219-6155241 TGACAGCAGCGCCAGCGCCTCGG - Intronic
1021600219 7:22356980-22357002 CGCCACCACCGCCGCCGCGGCGG + Intronic
1021827988 7:24573553-24573575 CGGCGGCAGCGGCGGCGCGGAGG + Exonic
1024579949 7:50793340-50793362 TGGCGGCAGCGCCGGCGGCGCGG - Intronic
1026840431 7:73667773-73667795 CACCCCCAGCCCCGGCGCCGCGG + Intergenic
1026858375 7:73769522-73769544 CCCCAGCAGCTGCAGCGCCGCGG + Exonic
1027116569 7:75486080-75486102 CCCCAGCGCCGCCGGCTCCGGGG + Exonic
1027275232 7:76549530-76549552 CCCCAGCGCCGCCGGCTCCGGGG - Intergenic
1029720941 7:102364080-102364102 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1030597989 7:111562315-111562337 CGCCCGCCCCGCCGGGGCCGGGG + Intronic
1030820727 7:114087628-114087650 CGGCGGCGGCGCCGGCGGCGCGG + Intronic
1033390643 7:140924601-140924623 CGGCGCCGGCGCCGGCGCCGCGG - Exonic
1034463266 7:151210275-151210297 CGGCAGCAGCCCGGGGGCCGTGG - Intronic
1034911761 7:155003233-155003255 CGCCAGCTACCCCGGAGCCGTGG - Intergenic
1034979524 7:155467221-155467243 CGCCCGGAGGCCCGGCGCCGGGG - Intergenic
1035259194 7:157650730-157650752 CGCCACCAGTGCCGGGGCCTTGG - Intronic
1035265172 7:157686052-157686074 CGCGGGCAGCGCCGGGGCTGAGG + Intronic
1035429306 7:158806046-158806068 TAGCAGCAGAGCCGGCGCCGGGG + Intronic
1036988649 8:13566745-13566767 CGCAAGCAGCGCAAGCGCAGTGG + Intergenic
1037065030 8:14567013-14567035 CCCCAGCAGTGCCGGCTCCCCGG + Intronic
1040723132 8:50350089-50350111 CCCCAGCAGCGCCGGCTCACGGG + Intronic
1041109403 8:54470521-54470543 CGTCAGCTGCCCCGGCGCGGCGG - Intergenic
1041919833 8:63168978-63169000 GGCCGGCAGCGGCGGCGACGGGG - Intronic
1043844958 8:85152940-85152962 CGCCGGCAGCCCCTGCTCCGCGG + Intergenic
1045115236 8:98973853-98973875 CCCCAGGACCGCCGGTGCCGGGG + Intergenic
1045306432 8:100960570-100960592 CACCAGCACCGCCGGCACGGTGG - Intergenic
1053723762 9:40975454-40975476 CCCCAGCAGGGCCAGCGCAGGGG - Intergenic
1054342198 9:63876545-63876567 CCCCAGCAGGGCCGGCGCAGGGG + Intergenic
1055354589 9:75424833-75424855 CAGCAGCAGCGCCGGCACAGGGG + Intergenic
1055757759 9:79573179-79573201 GCCCAGCAGCGCCGCTGCCGAGG - Intronic
1057361126 9:94374677-94374699 CGGCGCCAGCGGCGGCGCCGAGG - Exonic
1060358343 9:122931472-122931494 CGCCAGGAGCTCCGGCCCCTCGG + Exonic
1061130850 9:128706890-128706912 CGCCAGCAGCTCAGGCCCTGTGG - Exonic
1062596594 9:137302462-137302484 CGCCGGCAGCGCCTGGGCGGGGG + Intergenic
1185487956 X:497536-497558 CACCAGCAGGCCCGGCCCCGGGG - Intergenic
1187181459 X:16946987-16947009 CGCGCGCTGTGCCGGCGCCGCGG + Exonic
1187950418 X:24465316-24465338 CGGCTGCACCGGCGGCGCCGAGG + Intronic
1187974805 X:24694120-24694142 CGCCAGAAGGGCCCCCGCCGGGG - Intronic
1192925002 X:75747086-75747108 CGCCACCGCCGCCGCCGCCGCGG + Intergenic
1197215210 X:123860379-123860401 CCCCAGCAGCGCCGGCCCGAGGG - Intronic
1200292487 X:154886331-154886353 CGCCAGCTGCGGCGGCGCGTCGG + Exonic
1200339331 X:155382071-155382093 CGCCAGCTGCGGCGGCGCGTCGG + Intergenic
1200347139 X:155458622-155458644 CGCCAGCTGCGGCGGCGCGTCGG - Exonic