ID: 906369418

View in Genome Browser
Species Human (GRCh38)
Location 1:45240079-45240101
Sequence GAACCATTCTATTCCCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906369418 Original CRISPR GAACCATTCTATTCCCTGTA AGG (reversed) Intronic
903340910 1:22653642-22653664 GAAAGATTCTGTTCTCTGTAGGG - Intronic
906369418 1:45240079-45240101 GAACCATTCTATTCCCTGTAAGG - Intronic
907596312 1:55723401-55723423 GAACCATTCTCCTTCCTTTATGG + Intergenic
907741522 1:57170757-57170779 GGATCATTCTCTTCCCTGAAAGG + Intronic
907869004 1:58426011-58426033 GACCCTTTCCACTCCCTGTAAGG - Intronic
911379917 1:97100534-97100556 GAACCATTATTTTCCCTGTTGGG + Intronic
913222983 1:116674046-116674068 GGCCCATGCTCTTCCCTGTATGG + Intergenic
916751884 1:167730660-167730682 GAACCATTCTGAGCCCAGTATGG - Intronic
921401413 1:214727639-214727661 GAACCATTCACTCCCCTGGAAGG - Intergenic
1066765116 10:38795689-38795711 GCTCCATTCTATTCCATTTAAGG + Intergenic
1068473546 10:57495831-57495853 GAGCCATTATATTCCAGGTAAGG + Intergenic
1070990940 10:80731547-80731569 GAATCAATATATTCCCTGGAGGG + Intergenic
1071692856 10:87840668-87840690 GAAATATTCTGTTCCCTGAAGGG - Intronic
1074637552 10:115338087-115338109 GTACCAGTCTATTTCCTGTCAGG - Intronic
1080851008 11:36070159-36070181 TAAGCATTCTATTACCTGTCTGG - Intronic
1083037008 11:59647855-59647877 CAACCATTCTCTTCCCTTTTCGG + Exonic
1087307619 11:96504031-96504053 GAACCATTTTAATTCCTGAATGG - Intronic
1087667763 11:101070473-101070495 GAACCATTCACTCCCCTGGAAGG + Intronic
1088540379 11:110907619-110907641 GCACTATGCTATGCCCTGTAGGG - Intergenic
1090554346 11:127857942-127857964 ATCCCATTATATTCCCTGTAGGG + Intergenic
1093504623 12:19850661-19850683 GAACCAGACTATTCCTTGTTAGG + Intergenic
1094754034 12:33445263-33445285 AAACCATTCTATTCCCAGGAAGG + Intergenic
1100586230 12:95982487-95982509 GTACCAGTCTTTTCACTGTAGGG - Intronic
1105303580 13:19154727-19154749 GACCCATCCTATTCCCTGCAGGG - Intergenic
1111362717 13:87196376-87196398 GAACCATTTTATTCAGTTTAAGG - Intergenic
1114887604 14:26873203-26873225 GCACCTTTCTCTTCCCTGAAGGG - Intergenic
1120534775 14:85680861-85680883 GAACCATTTTATACCCACTAAGG - Intergenic
1126731499 15:51687846-51687868 CAAACTATCTATTCCCTGTATGG + Intronic
1127976774 15:64003438-64003460 GAAGCATTGGATGCCCTGTAAGG - Intronic
1128831157 15:70770117-70770139 GAACCATTCCCTTCCCTTTCTGG + Intergenic
1128855604 15:71011251-71011273 TAACCATTCTATTTCCAGTCTGG - Intronic
1141032159 16:80598487-80598509 GACCCATTCTAATTCCTGTTAGG - Exonic
1143803870 17:9409027-9409049 GAACCTCTCTATTCCAAGTATGG + Intronic
1144011702 17:11154726-11154748 GATACACTTTATTCCCTGTAAGG - Intergenic
1152826142 17:82466071-82466093 AAGCCATTCTGTTCCCTGAAAGG - Intronic
1155338244 18:24786921-24786943 AATCCATTCTCTTCCCTGTGGGG - Intergenic
1160090827 18:75825213-75825235 GCCCCTTTCTATTCACTGTATGG - Intergenic
1165923191 19:39311297-39311319 GGACTCTTCTCTTCCCTGTAGGG - Intronic
1167945897 19:52988574-52988596 GAGCCATTCTATTACCATTATGG + Intergenic
926823574 2:16880144-16880166 GAACCATTCCATGGCCTGTTAGG - Intergenic
928232550 2:29511651-29511673 CAGCCATTCTACTCCCTGTCTGG - Intronic
943105675 2:183543693-183543715 GAACCATTCACTCCCCTGGAAGG + Intergenic
943917700 2:193658041-193658063 GAACCATTTTTTGCTCTGTAGGG - Intergenic
944437733 2:199708762-199708784 AAACCATTCAGTTCCCTGTTTGG + Intergenic
945978105 2:216286167-216286189 GAACCATTCATTTTCCTTTAGGG + Intronic
947129683 2:226908616-226908638 CACACATTCTTTTCCCTGTAGGG + Intronic
948245969 2:236486187-236486209 GCAGGATTCTGTTCCCTGTAGGG - Intronic
948407852 2:237736023-237736045 AAACCTTTCTATTTCCTGGAGGG - Intronic
1169240510 20:3974985-3975007 GAATCAGTCTATTCAATGTAAGG + Intronic
1173208624 20:41014392-41014414 GAACCATGTTATTCACTATAAGG + Intergenic
1177474506 21:21602352-21602374 CAACCCTTAGATTCCCTGTAAGG + Intergenic
1179158682 21:38874264-38874286 GCACCATTGTATTCTCTGTATGG + Intergenic
1181687273 22:24538060-24538082 GAACCAGTCTCTTGCCTGCAAGG - Intergenic
1185144111 22:49120338-49120360 AAGCCTTTGTATTCCCTGTAAGG + Intergenic
951600390 3:24367964-24367986 GAGCTATTCTAGTCCCTTTAAGG - Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
963633285 3:147760911-147760933 GAACCATACAATTCCCTGTCTGG + Intergenic
968588416 4:1445663-1445685 GAACCATTCTTTCTTCTGTAAGG + Intergenic
973059031 4:45696163-45696185 TAACCATGCTATTACCTCTATGG + Intergenic
973753557 4:54048441-54048463 TAACCATTTTATTTCTTGTATGG + Intronic
975456060 4:74591421-74591443 GAGCCTTTCTCTTCCCTGAATGG - Intergenic
975576689 4:75870090-75870112 GAAACACACTATTCACTGTAGGG + Intronic
976050456 4:81006118-81006140 GAACCATTCATGACCCTGTAGGG + Intergenic
988502646 5:31796451-31796473 GAACGATTCTATCTCCTGTGGGG - Intronic
989266159 5:39476420-39476442 GAACCATTCTTTTACATTTAAGG - Intergenic
989482538 5:41948764-41948786 GAAGCATTCTTTTCACTGAAGGG - Intergenic
989998491 5:50863883-50863905 GAAGCATTCTATTCTCTAGAAGG + Intergenic
993769157 5:91903298-91903320 GAAACATTCTATTCTGTGAAGGG + Intergenic
1007059543 6:38925141-38925163 GACATAATCTATTCCCTGTAAGG - Intronic
1008584415 6:52935963-52935985 AAAAAATTCTATTCCTTGTAAGG + Intergenic
1008717261 6:54304080-54304102 TAACCATTCTAATACATGTAAGG - Intergenic
1013964182 6:115935497-115935519 GAACCATTCACTCCCCTGGAAGG + Exonic
1016141139 6:140612505-140612527 GTAACATTTTATTCCCTATAGGG + Intergenic
1016671745 6:146717385-146717407 GAATCATTCTTGTCCCTTTAGGG + Intronic
1016772521 6:147867884-147867906 AAACAATTCTATTCCCTCTGGGG + Intergenic
1019898892 7:4004209-4004231 GATCTATTTTATTCCCTGTTTGG - Intronic
1020914208 7:14171567-14171589 TAATCCTTCTATTTCCTGTATGG - Intronic
1021058920 7:16085407-16085429 GAACCTTTCTTTCTCCTGTAAGG + Intergenic
1023634703 7:42198026-42198048 GGAGCATTTTATTCCCTGAAGGG + Intronic
1024345734 7:48311045-48311067 GTACCATTGTTTTCCCTTTAGGG + Intronic
1026712036 7:72750448-72750470 GAAACAATCTATTACCTATAAGG - Intronic
1029484413 7:100830533-100830555 AAAACATTCTATTCCATGTCAGG + Intronic
1031493728 7:122421563-122421585 CAAACATTTTATTCCATGTAAGG + Intronic
1034925794 7:155120587-155120609 GAACCAATCGTTTGCCTGTAGGG + Intergenic
1035696563 8:1602446-1602468 GAATCAGTATATTCCCTGTGTGG - Intronic
1036467867 8:9018521-9018543 GAAAAATACTATTCCCTGTGGGG - Intronic
1038108336 8:24463907-24463929 GAAACATTCTACTCCATGAAAGG + Exonic
1041209881 8:55538443-55538465 GAACCATTGTATTCTCTGCTTGG - Exonic
1044681464 8:94782510-94782532 TAACCAGTCTATTCCATGGATGG + Intronic
1051512582 9:17895076-17895098 GAACCCTTCTATTCTCTTTTGGG + Intergenic
1189284984 X:39845681-39845703 CAACCCTTGAATTCCCTGTAGGG + Intergenic
1190781770 X:53603353-53603375 GAGCCATTCTCTTACCTGTTTGG + Exonic
1193512438 X:82420219-82420241 TAACCAATCTATAACCTGTATGG + Intergenic
1194545120 X:95225116-95225138 GAACCATTCACTCCCCTGAAAGG + Intergenic
1196227807 X:113187611-113187633 GAATCATTGTAATCCCTGAAAGG + Intergenic