ID: 906369949

View in Genome Browser
Species Human (GRCh38)
Location 1:45245045-45245067
Sequence GCTCATCTTTAGAAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 274}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906369949_906369955 14 Left 906369949 1:45245045-45245067 CCCTCTCCCTTCTAAAGATGAGC 0: 1
1: 0
2: 1
3: 31
4: 274
Right 906369955 1:45245082-45245104 CTCTATAAAAGGATAAAGCAGGG 0: 1
1: 0
2: 2
3: 24
4: 290
906369949_906369953 3 Left 906369949 1:45245045-45245067 CCCTCTCCCTTCTAAAGATGAGC 0: 1
1: 0
2: 1
3: 31
4: 274
Right 906369953 1:45245071-45245093 GCAGAGTAACTCTCTATAAAAGG 0: 1
1: 0
2: 1
3: 6
4: 108
906369949_906369954 13 Left 906369949 1:45245045-45245067 CCCTCTCCCTTCTAAAGATGAGC 0: 1
1: 0
2: 1
3: 31
4: 274
Right 906369954 1:45245081-45245103 TCTCTATAAAAGGATAAAGCAGG 0: 1
1: 0
2: 4
3: 31
4: 318
906369949_906369957 20 Left 906369949 1:45245045-45245067 CCCTCTCCCTTCTAAAGATGAGC 0: 1
1: 0
2: 1
3: 31
4: 274
Right 906369957 1:45245088-45245110 AAAAGGATAAAGCAGGGAAAGGG 0: 1
1: 0
2: 9
3: 116
4: 1318
906369949_906369956 19 Left 906369949 1:45245045-45245067 CCCTCTCCCTTCTAAAGATGAGC 0: 1
1: 0
2: 1
3: 31
4: 274
Right 906369956 1:45245087-45245109 TAAAAGGATAAAGCAGGGAAAGG 0: 1
1: 0
2: 4
3: 91
4: 915

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906369949 Original CRISPR GCTCATCTTTAGAAGGGAGA GGG (reversed) Intronic
901123036 1:6910492-6910514 GCTCATTTTTTGAGGGGAGCAGG + Intronic
902765163 1:18609496-18609518 TCTCATCTTTAAAAAGGAAATGG - Intergenic
903003603 1:20283847-20283869 TCTTATCTTTAGAGTGGAGATGG - Intergenic
904557811 1:31376672-31376694 GTACATACTTAGAAGGGAGAAGG - Intronic
904861451 1:33541040-33541062 GCATCTCTCTAGAAGGGAGAGGG - Intronic
905582060 1:39089826-39089848 CCTTATCTATAAAAGGGAGATGG + Intronic
905900482 1:41578790-41578812 CCTAAGCTATAGAAGGGAGATGG + Intronic
906071762 1:43021906-43021928 GCTCATGTCAAGAAGGGAGGTGG - Intergenic
906369949 1:45245045-45245067 GCTCATCTTTAGAAGGGAGAGGG - Intronic
907257350 1:53190045-53190067 CCTTATCTGTAAAAGGGAGATGG - Intergenic
907740669 1:57162741-57162763 ACTCTTGTTTAGAAGGCAGATGG - Intronic
907800603 1:57761620-57761642 GCTCGTATTTAGAGGGGAGGGGG - Intronic
908057789 1:60309359-60309381 GCTTATCTTCAGAATAGAGATGG + Intergenic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908921315 1:69196697-69196719 GCTCATCTTTAAATTGAAGATGG + Intergenic
910782160 1:90950913-90950935 GGTGATCTTTAAAAGGGAGATGG - Intronic
912181465 1:107223871-107223893 GGTTATCCTTAGAATGGAGAAGG + Intronic
913030408 1:114897117-114897139 GTACTTCTTTAGAATGGAGAAGG - Intronic
913701886 1:121382199-121382221 GCTCAACTCTAGATGGGAGAAGG - Intronic
914042445 1:144062668-144062690 GCTCAACTCTAGATGGGAGAAGG - Intergenic
914135643 1:144897820-144897842 GCTCAACTCTAGATGGGAGAAGG + Intronic
915471549 1:156128732-156128754 CCTCATCTATAAAAGGGAGAGGG + Intronic
915848945 1:159300230-159300252 GCTCCTACTTAGATGGGAGATGG - Intronic
916585543 1:166146684-166146706 GCTCAAATTCAGAAGGCAGAGGG + Intronic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
916796959 1:168176472-168176494 CCTAAACTTTAAAAGGGAGAAGG - Intergenic
917643488 1:177006914-177006936 GATCAGCTGTAGATGGGAGATGG - Intronic
917719694 1:177775676-177775698 GCTCCTCTTTGGGAGGGTGAGGG - Intergenic
919220158 1:194617767-194617789 TCTCATCTTTAGCAGAGACAGGG - Intergenic
920489309 1:206400919-206400941 GCTCAACTCTAGATGGGAGAAGG - Intronic
924158641 1:241207269-241207291 CTTGATCTTTAGAAGGGAAAGGG - Intronic
1063384826 10:5609593-5609615 GTTCATATCTAGGAGGGAGATGG - Intergenic
1063551190 10:7035229-7035251 GCACCTCTTTAGAAGGCAGCAGG + Intergenic
1063639465 10:7815997-7816019 AGTCATCTTTAGGAGGGGGATGG + Intergenic
1066084168 10:31960623-31960645 GGTCATATTTAAAAGGGAGTCGG - Intergenic
1067960099 10:50838578-50838600 CCTCAGCTTTTGAAAGGAGATGG - Intronic
1070361693 10:75696651-75696673 CCTCATCTGTAAAAGTGAGAGGG - Intronic
1071389113 10:85152650-85152672 GCCTATCTTTAGATGGGAAAAGG - Intergenic
1071978382 10:90978065-90978087 GTTCTTCTTTAGAAGGCAGTGGG - Intergenic
1072202525 10:93173778-93173800 TCTCATCTATAAAATGGAGATGG + Intergenic
1072855783 10:98944625-98944647 ACTAAGCTTTAGAGGGGAGAAGG + Intronic
1074899818 10:117806338-117806360 CCTTATCTTTAGAATGGATATGG + Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1075082805 10:119395258-119395280 GCTCTCCATTAGAAGAGAGAGGG + Intronic
1075112994 10:119603042-119603064 GCTCTTCTTTAGAAGGGTGCTGG + Intergenic
1078209595 11:9259708-9259730 TGTCACCTTTAGAAGAGAGAGGG - Intronic
1078349489 11:10580933-10580955 TCTCATCTGTAAAAGAGAGAGGG + Intronic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1079944803 11:26728675-26728697 ACTCATCTTTAAAATGGAAATGG + Intergenic
1080568656 11:33535890-33535912 GCTGATGTTTATTAGGGAGAAGG - Intergenic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1081008674 11:37780898-37780920 ACTCATTTTAAGAAGGAAGAAGG + Intergenic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081913470 11:46716009-46716031 ACTCATTTTAAGAAGGGACAAGG - Intergenic
1082205080 11:49423449-49423471 GCTCATTTATAGAAAGGGGATGG + Intergenic
1083168674 11:60908648-60908670 GCAAATCTTTAGAGGGCAGAGGG - Intergenic
1083600261 11:63942942-63942964 GCTCATGCTTAGAAGTGAGATGG + Intronic
1086207679 11:84279644-84279666 TCTCATCTTTTGCAGGGACATGG + Intronic
1086483296 11:87268416-87268438 GACCATCTTTAGAAAGGAGCAGG - Intronic
1088408384 11:109505973-109505995 GCTTACCTATAGAAGGGTGAGGG + Intergenic
1089214684 11:116828634-116828656 GCACAGCGTTAGGAGGGAGAGGG + Intergenic
1090007458 11:123015728-123015750 TCCCATCTTTAAAATGGAGATGG + Intergenic
1090038106 11:123265975-123265997 GGTAAGCTTTGGAAGGGAGATGG + Intergenic
1090177957 11:124668251-124668273 GCTCATCTTGAGAGGTGAGCAGG - Intronic
1090981411 11:131725722-131725744 GCTCTTCGTTAGGAGTGAGATGG + Intronic
1090993380 11:131840936-131840958 GTTCATCTTGAGGAGTGAGATGG + Intronic
1093227908 12:16507679-16507701 GCACATCTTTACATGGGAGCAGG + Intronic
1094277772 12:28698018-28698040 TCACATGTTTTGAAGGGAGAGGG + Intergenic
1095366320 12:41410727-41410749 CCTCATCTTTAAAAGTGAAAGGG + Intronic
1096011095 12:48215993-48216015 GCTCAGCTGGAGAAGGGATAGGG + Intergenic
1096536547 12:52278773-52278795 CCTCCTCTTGAGAAGGCAGAAGG + Intronic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1099314203 12:81064530-81064552 GCTATATTTTAGAAGGGAGAAGG - Intronic
1100333569 12:93608716-93608738 GGTGATTTTTAGAAGGTAGAAGG - Intergenic
1101013277 12:100473212-100473234 CCTCATCTGTAGAATGGATATGG - Intergenic
1101330766 12:103755922-103755944 CCTCATCTATAAAATGGAGATGG + Intronic
1101988458 12:109465581-109465603 GCTTACCTTTGGAAGGGAGAGGG + Intronic
1102187911 12:110964327-110964349 CCACATCTGTAGAATGGAGATGG - Intergenic
1103913722 12:124365421-124365443 GCTCATCTGCAGGAAGGAGATGG - Intronic
1105562384 13:21506186-21506208 CCTCATCTTTACAAAAGAGATGG - Intronic
1106282516 13:28288462-28288484 GCTAATCTTTAGTAGCGACAAGG + Intronic
1106606449 13:31233750-31233772 TCTAATCTTTAGAAGGGAAAGGG + Intronic
1108630475 13:52276660-52276682 GTTCATATTTATAAGGTAGAGGG + Intergenic
1108656217 13:52535862-52535884 GTTCATATTTATAAGGTAGAGGG - Intergenic
1109352098 13:61195840-61195862 TCTAATGTTTAGAAAGGAGAAGG + Intergenic
1111897161 13:94155967-94155989 CCTCATCCTTCGAATGGAGATGG - Intronic
1112121302 13:96414954-96414976 TCTCATTTTTTGAAGGGAGGGGG - Intronic
1112329605 13:98467060-98467082 TCTCATCTGTAGAATGGAGGTGG + Intronic
1112616203 13:101008274-101008296 GCTCATATTTAAAACGAAGAAGG - Intergenic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1115223465 14:31080326-31080348 ATTCATCTTTAGAAAGCAGAGGG - Intronic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118668776 14:68100178-68100200 CCTCAACTATAGAAGGTAGAAGG + Intronic
1119931554 14:78552386-78552408 GCACATCTTAGAAAGGGAGAAGG + Intronic
1119995833 14:79252803-79252825 GCTCATCTTTACAAAACAGAGGG - Intronic
1120841602 14:89090326-89090348 GCTCATCTGTAAAATGGAGTTGG - Intergenic
1121275284 14:92663320-92663342 GCTCATTTTGAGTAGGGAGGAGG + Intronic
1121989754 14:98544635-98544657 CCTCATCTATAGAAGGGAGCTGG - Intergenic
1122825931 14:104370464-104370486 GCTCATCTTTAGCAGAGAAATGG + Intergenic
1122831087 14:104396237-104396259 GCTCATCTTCAGAAATGAGGAGG + Intergenic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1127865890 15:63032312-63032334 TCTCAGCTTGAGAAGAGAGAAGG - Intergenic
1128345534 15:66850386-66850408 GCCTATCTTCAGAAGGGGGATGG + Intergenic
1128878897 15:71224965-71224987 GGACATCTTTGGAAGGGAGGGGG + Intronic
1129208263 15:74050228-74050250 GCTCCTCTGTAGGAGGAAGATGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130603613 15:85295434-85295456 GCTGATCTGCAGCAGGGAGAGGG - Intergenic
1130755854 15:86762390-86762412 GCTCATCTTTTGCAGGGGGCAGG - Intronic
1131739169 15:95368422-95368444 TCTCTTGTTGAGAAGGGAGATGG + Intergenic
1133681355 16:8123131-8123153 GCACAACTTTAAAAGGGAGCTGG - Intergenic
1134389804 16:13808872-13808894 GCTCATTGTTGGAAGGCAGAGGG - Intergenic
1138139107 16:54551623-54551645 ACAAATCTATAGAAGGGAGAAGG - Intergenic
1138336192 16:56255009-56255031 TCTCATCTTAAGTAGGGACAGGG - Intronic
1138624858 16:58243276-58243298 GCTCGTCTTCAGAAGTGAGGAGG - Intronic
1140440497 16:74984350-74984372 TCTCACCTGTAGAAGGGAGATGG - Intronic
1141393093 16:83680948-83680970 GCACATCTGTAGAGGGAAGAGGG + Intronic
1141645317 16:85364350-85364372 GCTGACCTTGAGATGGGAGATGG - Intergenic
1141760838 16:86027441-86027463 GCTCATCTGTAGTACGGGGAGGG - Intergenic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1142189220 16:88709995-88710017 GCTCATCTTTCCAGGCGAGAAGG + Exonic
1143148058 17:4789397-4789419 GCTCAGCTTCCGACGGGAGAGGG - Intronic
1144219383 17:13086223-13086245 GCTCATTGTTGGAAGGGTGAAGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1145066713 17:19766399-19766421 GCTTCCCTTAAGAAGGGAGATGG + Intergenic
1145218002 17:21066634-21066656 GCTGATCTCCAGAATGGAGATGG + Intergenic
1148197160 17:45722284-45722306 GCTCATCTTTAGAAGGACAGTGG + Intergenic
1148917702 17:50996611-50996633 GCACATGTTCAGAAGGAAGACGG - Exonic
1157699802 18:49754750-49754772 GAATATCTTCAGAAGGGAGATGG + Intergenic
1157836656 18:50910055-50910077 GCTCAGATTTAGAAGGGCCAGGG + Intronic
1158035194 18:53020145-53020167 GCTTTTCTTTAAAAGGTAGAAGG - Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159856639 18:73597443-73597465 GCTCATCATGATAAGGGAGAAGG - Intergenic
1162954929 19:14092251-14092273 ACTCCTCTTTGGCAGGGAGAGGG + Exonic
1163762199 19:19143581-19143603 CCTCATCCTTAGAAGGAAGTTGG - Intergenic
1164573110 19:29388158-29388180 GCTCATCTTGCAAAGGGAGGAGG - Intergenic
1164594376 19:29524390-29524412 CCTCAGCTTCTGAAGGGAGAGGG - Intergenic
1164809131 19:31142191-31142213 CCTCATCTTTGGAAAGGAGGCGG - Intergenic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
927458576 2:23278165-23278187 GTTCATCTTTCCCAGGGAGATGG - Intergenic
927894688 2:26774234-26774256 GCCCATCTGTAGGAGAGAGAGGG - Exonic
928307291 2:30180651-30180673 TTCCATCTTTAGATGGGAGAAGG + Intergenic
929065305 2:37967060-37967082 GCTCATTTTAAGAAGGGATGAGG + Intronic
930953785 2:57178254-57178276 GCACATTTTTAAAAGGGGGAAGG - Intergenic
932298372 2:70645356-70645378 CCTCATCTGTAGAATGGAGGAGG + Intronic
932800821 2:74741033-74741055 GTTCATCTTTGGAATGGAAATGG + Intergenic
932855275 2:75227325-75227347 ATTCTTGTTTAGAAGGGAGAAGG + Intergenic
935627344 2:105182045-105182067 TCTAATCTTTACAAGGCAGATGG - Intergenic
936607520 2:113973121-113973143 GATCAACTTAAGAAGGGAAATGG + Intergenic
937399948 2:121573808-121573830 CCTCAACTTTAAAAGGGAGAAGG + Intronic
937635449 2:124150890-124150912 GCTACTCTTCAGAAGGGACAGGG - Intronic
940120278 2:150256693-150256715 TCTCATATTTCAAAGGGAGAGGG - Intergenic
940372128 2:152915200-152915222 CCTCATCTATAGAAGGGCAAAGG - Intergenic
941930877 2:170937371-170937393 GCTGATTTTTTGAAGGGACAAGG + Intronic
942667402 2:178334692-178334714 GCTCATTTTTAGTAGAGACAGGG + Intronic
943590247 2:189787136-189787158 GATGATATTTAGAAGGTAGATGG + Intronic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
945488727 2:210429162-210429184 CCACAGCTTTAGAAGGAAGAGGG + Intergenic
946302221 2:218830894-218830916 GCTCATCTCTGGAAGGGGAATGG + Exonic
946413039 2:219525000-219525022 GCTCATCTGTAAAAGGGGAATGG - Intronic
948025119 2:234770547-234770569 GCTTATATTCAGAATGGAGATGG - Intergenic
1169258078 20:4113883-4113905 GCCCTTCCTGAGAAGGGAGAAGG + Intergenic
1169939255 20:10919365-10919387 AAGCATCCTTAGAAGGGAGAGGG + Intergenic
1171090514 20:22281710-22281732 GCTTATTTTTGGAAGAGAGATGG + Intergenic
1171194627 20:23187444-23187466 GCTCTTCTTTAGGGGAGAGAGGG + Intergenic
1172131563 20:32659495-32659517 GCTCATCTGTACAATGAAGATGG - Intergenic
1173763849 20:45588248-45588270 GCTGTTCTCTAGAAGAGAGAAGG + Intergenic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1175359796 20:58400036-58400058 TCTCATCTCTAAAATGGAGATGG - Intronic
1176342913 21:5714782-5714804 GCTCATCCTGAGAGGGAAGATGG - Intergenic
1176475167 21:7146933-7146955 GCTCATCCTGAGAGGGAAGATGG - Intergenic
1176501914 21:7609674-7609696 GCTCATCCTGAGAGGGAAGATGG + Intergenic
1176537234 21:8112851-8112873 GCTCATCCTGAGAGGGAAGATGG - Intergenic
1180015536 21:45080408-45080430 GCTCAGCTCTAGAAGGGAGGCGG + Intronic
1180094074 21:45546588-45546610 GCCCATCTTTACTAGGGAAAGGG + Intergenic
1182044779 22:27265741-27265763 ACTCATCTTTAAAATGGAGATGG - Intergenic
1182746952 22:32613396-32613418 GGTCATTTTCAGAAGGGAGGAGG - Intronic
1183069198 22:35384471-35384493 CCTCATCTTTTTAAGGGAGAGGG - Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184590698 22:45480947-45480969 GCACATCTTCACAAGGGAGCAGG - Intergenic
1184599473 22:45534026-45534048 GCTCATCTGCAGGAGGGAGGTGG + Intronic
1184714589 22:46273617-46273639 GCTCATCCATTGAAGGGGGAAGG + Intronic
1184757889 22:46527102-46527124 GCTCATCTCTAGGATGGAGGTGG + Intronic
949703525 3:6787307-6787329 GCTCATTTCTAGAGTGGAGAAGG - Intronic
950320966 3:12052931-12052953 GGTCATCTTCAGAAGAGATATGG - Intronic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
954336110 3:49918712-49918734 GCTCATCTTTAGTAAGAAGAGGG - Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955314139 3:57921215-57921237 TCTCACCTTTAAAAGGCAGATGG + Intronic
955708531 3:61754264-61754286 GCTCAGCTGTAAAATGGAGATGG + Intronic
955800899 3:62685437-62685459 GTTAATGTTTAGAAGAGAGAGGG + Intronic
960335207 3:116409417-116409439 TTTCATCTTTAAAAGGGAAATGG - Intronic
961167891 3:124776205-124776227 GCTCATCCCTGGAAGGGAGAGGG + Intronic
962290331 3:134130934-134130956 GCTCATCATTAGACTGGACATGG + Intronic
963596887 3:147339389-147339411 GCCCATTTTTAGGAGAGAGAAGG + Intergenic
964159253 3:153626805-153626827 GCACATTTGTAGAAGGGGGATGG + Intergenic
966009634 3:175058694-175058716 GCTCATTTTTAGAAAAGAGGTGG + Intronic
967288671 3:187898288-187898310 CCTCACCTTTCGATGGGAGAAGG - Intergenic
967588978 3:191249606-191249628 GCTCATCTAAAGAAGGATGATGG - Intronic
969853608 4:9981490-9981512 ACTAATCTTTAGAAGAGAAATGG - Intronic
970069736 4:12144132-12144154 TCTCAGCTTTTGAAGGCAGAGGG - Intergenic
971586933 4:28416204-28416226 GCAAAACTTTAGAAGGAAGAGGG + Intergenic
972281956 4:37610839-37610861 CCTCATCCTTAGAAAGGAGGAGG + Intronic
975804630 4:78099127-78099149 TCTCAGCTTTAGAGAGGAGAGGG + Intronic
979400185 4:120239649-120239671 GTTCATATTCATAAGGGAGAGGG + Intergenic
979802523 4:124928027-124928049 GCTCATTTTTTGGAGGGAGATGG - Intergenic
980732372 4:136839496-136839518 GCTCATGTGTAGATAGGAGAGGG + Intergenic
988674776 5:33420859-33420881 GTTCATCTTTAGATCAGAGAAGG - Intergenic
988796080 5:34655134-34655156 GCTCTTCCCTAGTAGGGAGAGGG + Intergenic
990898429 5:60724716-60724738 GTGAATCTTTGGAAGGGAGAAGG + Intergenic
991384546 5:66070674-66070696 GCACATCTCAAAAAGGGAGAAGG + Intronic
991509911 5:67365015-67365037 GCCCATCTACAGAAGAGAGATGG - Intergenic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
992764455 5:79984206-79984228 GCTCATCTGTACAACAGAGAAGG - Intronic
994702169 5:103148767-103148789 GAACATCTTTAAAAGGGTGAGGG - Intronic
994829509 5:104760912-104760934 GCTCATCTGTAGATTGGACATGG + Intergenic
995744799 5:115392434-115392456 CCTTATCTTTAAAAGGGAGGAGG - Intergenic
996525192 5:124472255-124472277 GCTTTTATTTAGAAGGGAGTTGG + Intergenic
996823776 5:127658760-127658782 GCTCTTCTTGAAATGGGAGAGGG - Intergenic
996901508 5:128547124-128547146 GGTCCCTTTTAGAAGGGAGAGGG - Intronic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997812472 5:136985071-136985093 GCTGATCATTACAAGGGACATGG + Intronic
999648917 5:153746610-153746632 GCTCATTTTCAGAGGTGAGATGG - Intronic
1000023711 5:157340869-157340891 TCCCATCTATAGAAAGGAGACGG + Intronic
1000098015 5:157987834-157987856 GTTCATCTTTATGAGGGATATGG + Intergenic
1000101114 5:158017513-158017535 GATCATGTGTAGAAGGGAAATGG + Intergenic
1000279321 5:159768549-159768571 GGGCCTCCTTAGAAGGGAGAAGG + Intergenic
1000677152 5:164135513-164135535 GCTCATCTTTAGAAGGACATAGG - Intergenic
1000958581 5:167571984-167572006 GCTCAGATGTAGAAGGGAAAAGG - Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1004149087 6:13097951-13097973 GCTAATCTTTAAAAAGCAGAGGG - Intronic
1004339387 6:14794918-14794940 TCTCATCTTTAAAAGCGAGGAGG + Intergenic
1005522486 6:26613194-26613216 GCTAATCTGTGGAAGGGAGTGGG + Intergenic
1006005146 6:30996084-30996106 GCTCATCTATGGAATGGAGATGG + Intergenic
1007053443 6:38857022-38857044 ACTTATCTATAGAAGAGAGAGGG - Intronic
1008416661 6:51248480-51248502 TCTCATCATTCAAAGGGAGAAGG - Intergenic
1010262276 6:73830697-73830719 GCTCATCTTTGGCACAGAGATGG - Intergenic
1012339803 6:98105904-98105926 ACTCATTTTAAGAAGGGATAGGG - Intergenic
1012464960 6:99506772-99506794 GGTCATTTTCTGAAGGGAGAGGG - Intronic
1013298523 6:108781314-108781336 GCACATCTTAGGAAGGAAGAGGG + Intergenic
1013428195 6:110033892-110033914 GCTCAGCTTTAGGAGAGAGGGGG - Intergenic
1014057685 6:117035403-117035425 CCTCATCTATAAAAAGGAGATGG - Intergenic
1015306535 6:131715293-131715315 GCTTATGTGTAGAATGGAGAAGG - Intronic
1016135829 6:140541256-140541278 GCTCAACTTTAGAAGGAAATAGG - Intergenic
1016301934 6:142642238-142642260 GCTTATTTTAAGAAGGGACAAGG + Intergenic
1017277642 6:152588701-152588723 GGTGAACATTAGAAGGGAGAAGG + Intronic
1018787301 6:167118042-167118064 GCTCATGTTTACAAAGCAGAAGG - Intergenic
1019515231 7:1436943-1436965 GCTCCTCTTTTGGAGGAAGAAGG + Intronic
1019822665 7:3257123-3257145 ACTCACCTTGAGAGGGGAGAGGG - Intergenic
1020692685 7:11376384-11376406 GCTCATCTTTAGAAACGAAATGG + Intronic
1020705502 7:11538822-11538844 CCTCCTCCTTAGAAGGGAAATGG + Intronic
1021507054 7:21397468-21397490 GCAAATCTTTAGAGGGCAGAGGG - Intergenic
1021610016 7:22447894-22447916 GCTCATCTGTAAAAAGGAGATGG - Intronic
1022318609 7:29266940-29266962 TCTCACCTTGAGGAGGGAGAAGG - Intronic
1023016101 7:35969661-35969683 TCTCATCTATAAAGGGGAGATGG - Intergenic
1024273897 7:47661961-47661983 GCTCATATCTGGGAGGGAGAGGG - Intergenic
1026450609 7:70525926-70525948 GCTCATCTTCTGGCGGGAGAGGG + Intronic
1026958446 7:74393198-74393220 GCTAATTTTTAGTAGGGACAGGG + Intronic
1026963944 7:74427362-74427384 GCTAATTTTTAGGAGGGACAGGG - Intergenic
1028032028 7:85928104-85928126 GCTCATCTTTTGGGGAGAGATGG - Intergenic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029242950 7:99177408-99177430 GCTAATCTTTAGTAGAGACAGGG - Intronic
1031214361 7:118871084-118871106 GCTGCTGTTTAGAAGGAAGAGGG - Intergenic
1032342805 7:131091508-131091530 GCTCTAGTTGAGAAGGGAGAAGG - Intergenic
1032597153 7:133253236-133253258 CCTCCGCTTTGGAAGGGAGAAGG + Intronic
1033170745 7:139081628-139081650 GCTCATTTTTAGAAGAATGAAGG - Intronic
1033679792 7:143583234-143583256 GCTTATATGTAGAATGGAGAAGG - Intergenic
1033692043 7:143746209-143746231 GCTTATATGTAGAATGGAGAAGG + Intergenic
1033731014 7:144179207-144179229 GCTTATGTGTAGAATGGAGAAGG + Intergenic
1034220644 7:149442945-149442967 TCTCATGCTTAGAAGGGTGAAGG + Intronic
1035905851 8:3509497-3509519 CCTCATCTTTAAAATGAAGAAGG + Intronic
1037648026 8:20811396-20811418 ACTCATCTTTAGAGAGGAAAAGG - Intergenic
1039870086 8:41538867-41538889 GCTGATTTTTAGAAGAGACAGGG + Intronic
1041480506 8:58315079-58315101 GGTCATCTTGGGAAGGGAGGAGG - Intergenic
1041525310 8:58799097-58799119 GCTCTACATTAGAAAGGAGAAGG + Intergenic
1042082488 8:65070809-65070831 TCTCACCTTTGGAAAGGAGAAGG - Intergenic
1043373537 8:79621532-79621554 GCTCTTCTTTAGGAGGAAGAAGG - Intronic
1043933664 8:86118862-86118884 CCTCATCCTTAGAATGGTGATGG - Intronic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1046738518 8:117803854-117803876 GCTCATCTTTAACATGGAAATGG - Intronic
1047002484 8:120586814-120586836 GCCCATTTTTAGAAGAGACAAGG - Intronic
1047644596 8:126856806-126856828 GCTGATCTTTAGAGAGGAGAAGG - Intergenic
1047952528 8:129946928-129946950 GTTCACCTTTGGAAGGGTGATGG - Intronic
1047952537 8:129946954-129946976 GTTCACCTTTGGAAGGGTGATGG - Intronic
1049183706 8:141237526-141237548 GCTTACCTTTAGAAGCGAGCAGG + Intronic
1049392284 8:142378209-142378231 GCTCAGCATCACAAGGGAGAAGG + Intronic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1049733324 8:144190353-144190375 GCTAATTTTTAGAAGAGACAGGG - Intronic
1050739392 9:8802748-8802770 CCTCATCTTTAAAATGGAGATGG + Intronic
1057716538 9:97500525-97500547 GATCATCTTTAGAAGGGAGTTGG + Intergenic
1058270159 9:102962244-102962266 GCACATCTTTTGCAGGGACATGG - Intergenic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059820191 9:117963947-117963969 TCTCATCATTAGAAAGGAAATGG + Intergenic
1061889566 9:133610699-133610721 GCCCATCTGTAAAAGGGAAATGG - Intergenic
1061894559 9:133640438-133640460 GCCCATCTGTAAAATGGAGATGG + Intronic
1189095590 X:38135143-38135165 GCTCTTCTTTAAAAGGAATAAGG + Intronic
1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG + Intronic
1192714028 X:73620012-73620034 GCTCATCCTTTGTAGGGACATGG - Intronic
1194371569 X:93079445-93079467 GCTCATTTTTAGTAGAGACAGGG - Intergenic
1195402973 X:104481479-104481501 GAGCATCCTTTGAAGGGAGAAGG + Intergenic
1196900252 X:120375543-120375565 GTTCATCTTTAGAAGGATGCAGG - Exonic
1197766888 X:130065263-130065285 GCTCGTTTAAAGAAGGGAGAGGG + Exonic
1199798878 X:151230043-151230065 ACTCACCTTCAGAAGTGAGAAGG - Intergenic
1199902520 X:152190427-152190449 GCTCATCTTCAGAATGAACATGG + Intronic
1200679361 Y:6191337-6191359 GCTCATTTTTAGTAGAGACAGGG - Intergenic