ID: 906371633

View in Genome Browser
Species Human (GRCh38)
Location 1:45258757-45258779
Sequence TGCAAGGGAAGGGGCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 369}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906371633_906371642 13 Left 906371633 1:45258757-45258779 CCTTGGGAGCCCCTTCCCTTGCA 0: 1
1: 0
2: 3
3: 41
4: 369
Right 906371642 1:45258793-45258815 GATGTGAGACATGAATTCGAAGG 0: 1
1: 3
2: 182
3: 1703
4: 2165
906371633_906371637 -9 Left 906371633 1:45258757-45258779 CCTTGGGAGCCCCTTCCCTTGCA 0: 1
1: 0
2: 3
3: 41
4: 369
Right 906371637 1:45258771-45258793 TCCCTTGCATCAGAGTGCCCTGG 0: 2
1: 6
2: 62
3: 424
4: 1535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906371633 Original CRISPR TGCAAGGGAAGGGGCTCCCA AGG (reversed) Intronic