ID: 906371633 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:45258757-45258779 |
| Sequence | TGCAAGGGAAGGGGCTCCCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 414 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 41, 4: 369} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 906371633_906371642 | 13 | Left | 906371633 | 1:45258757-45258779 | CCTTGGGAGCCCCTTCCCTTGCA | 0: 1 1: 0 2: 3 3: 41 4: 369 |
||
| Right | 906371642 | 1:45258793-45258815 | GATGTGAGACATGAATTCGAAGG | 0: 1 1: 3 2: 182 3: 1703 4: 2165 |
||||
| 906371633_906371637 | -9 | Left | 906371633 | 1:45258757-45258779 | CCTTGGGAGCCCCTTCCCTTGCA | 0: 1 1: 0 2: 3 3: 41 4: 369 |
||
| Right | 906371637 | 1:45258771-45258793 | TCCCTTGCATCAGAGTGCCCTGG | 0: 2 1: 6 2: 62 3: 424 4: 1535 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 906371633 | Original CRISPR | TGCAAGGGAAGGGGCTCCCA AGG (reversed) | Intronic | ||