ID: 906375340

View in Genome Browser
Species Human (GRCh38)
Location 1:45292189-45292211
Sequence GAGTAGCCCAGAGCCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906375340_906375342 -2 Left 906375340 1:45292189-45292211 CCTTCCAGGGCTCTGGGCTACTC 0: 1
1: 0
2: 2
3: 31
4: 305
Right 906375342 1:45292210-45292232 TCAGAGATTTGACAGAAATGTGG 0: 1
1: 0
2: 2
3: 39
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906375340 Original CRISPR GAGTAGCCCAGAGCCCTGGA AGG (reversed) Intronic
900294561 1:1942509-1942531 GAGGCGGGCAGAGCCCTGGAGGG - Intronic
901204657 1:7487195-7487217 GAGTAGCCGATAACCGTGGAGGG - Intronic
901453037 1:9347756-9347778 TGGTAGACAAGAGCCCTGGAAGG + Intronic
902359728 1:15935862-15935884 GAGCAGCCCAGGGCCGCGGATGG + Exonic
902731695 1:18374036-18374058 GAGAAGGCTAGAGCCCTGGAGGG - Intronic
902989163 1:20174141-20174163 GAGGACCTCAGAGCCTTGGAAGG - Intronic
903658782 1:24964483-24964505 CAATAGCCCAGGGCCCTGGGTGG - Intronic
904360439 1:29967768-29967790 CAGGAGCCCAGGCCCCTGGAAGG - Intergenic
906375340 1:45292189-45292211 GAGTAGCCCAGAGCCCTGGAAGG - Intronic
909431315 1:75590560-75590582 GAGGAGCCCAGTGCCCTGAGGGG + Intronic
909794071 1:79711463-79711485 GAGTAGCTCAGAGGCCAGCAGGG + Intergenic
910547372 1:88433258-88433280 GAGGAGCCCACTGCCCTGAAGGG + Intergenic
911491051 1:98566529-98566551 GAGTGGCCCAGAGCTCAGGAGGG - Intergenic
912085448 1:105996897-105996919 GGGTTGCCCACAGCCATGGAAGG - Intergenic
913190695 1:116410590-116410612 GAGAAGCCCAGAGTCCTTGCAGG + Intergenic
915005389 1:152630395-152630417 GAGGAGCCCATTGCCCTGGAGGG + Intergenic
916370921 1:164093168-164093190 GACAAGCCCAGAGGCCTGGGAGG - Intergenic
917191393 1:172422744-172422766 GAGGAGCCCACTGCCCTGAAGGG + Intronic
917634739 1:176924170-176924192 GAGAAGCCTAGATCCCTGGATGG - Intronic
918038452 1:180897485-180897507 GAGCAGAGCAGAGCCCTGGGGGG - Intergenic
918187942 1:182144208-182144230 GTGTAGCCCAGAGGCTTGCACGG + Intergenic
920374102 1:205497738-205497760 GAGTAGGGCAGAGGCCTGAATGG - Intergenic
923097333 1:230785893-230785915 GAAGAGCCCAGAGCCTGGGAAGG - Intronic
923476382 1:234335424-234335446 GAGAACCCCAAAGCTCTGGAAGG - Intergenic
1065838566 10:29681040-29681062 GAGAAGCTCAGAGCACTGCAGGG + Intronic
1066706061 10:38179139-38179161 GAGAAGCCCATAGCTCTGGAAGG - Intergenic
1066983917 10:42446980-42447002 GAGAAGCCCATAGCTCTGGAAGG + Intergenic
1067204583 10:44201973-44201995 GAGCAGCCCAAAGCCATGGCTGG + Intergenic
1067445608 10:46341779-46341801 GAGAAGCCCATGGCTCTGGAAGG - Intergenic
1067502824 10:46821047-46821069 GAGAAGCCCATGGCTCTGGAAGG - Intergenic
1067591766 10:47518964-47518986 GAGAAGCCCATGGCTCTGGAAGG + Intronic
1067638881 10:48027038-48027060 GAGAAGCCCATGGCTCTGGAAGG + Intergenic
1067659562 10:48224235-48224257 GAGTGGCCCAGGGCACTGGAGGG - Intronic
1068962406 10:62879047-62879069 GAGCAGGCTGGAGCCCTGGAAGG + Intronic
1069147864 10:64917949-64917971 GAGGAGCCCACTGCCCTGAAGGG + Intergenic
1069933550 10:71899944-71899966 GAGGAGCCCACTGCCCTGAAGGG - Intergenic
1070040807 10:72777616-72777638 GCCTAGACCAGTGCCCTGGAGGG - Intronic
1070587789 10:77779824-77779846 GGGTAGCCCAGGGCCGGGGAAGG + Intergenic
1070952593 10:80443084-80443106 GGGCAGCCCAGAGCTCTGCATGG - Intergenic
1071567117 10:86677050-86677072 GAGAAGCCCAGAGGACTGGCTGG + Intronic
1072662735 10:97372682-97372704 GAGCAGCCCAGGGAGCTGGAGGG - Intronic
1072877705 10:99190884-99190906 GGGGAGCCCATAGCCCTGAAGGG + Intronic
1073185731 10:101614066-101614088 GGGCAGGCCAGAGCCCTGTAGGG + Intronic
1073545895 10:104348574-104348596 GAATAGCAGAGAGCCTTGGAAGG - Intergenic
1075238663 10:120757109-120757131 GAGAAGCCCAGGGCCATAGATGG - Intergenic
1076189436 10:128472580-128472602 GGGAAGACCACAGCCCTGGACGG - Intergenic
1076469689 10:130709888-130709910 CCATAGCCCAGAGCCCAGGAGGG - Intergenic
1076778531 10:132711202-132711224 GAGCAGCCCGGAGCACTGGGGGG - Intronic
1077216665 11:1397942-1397964 CTGGAGCCCAGGGCCCTGGAGGG + Intronic
1077217132 11:1399614-1399636 CACCAGCCCAGAGCCCTGGGGGG - Intronic
1077400250 11:2352107-2352129 GAGGAACCCAGGGCTCTGGAGGG - Intergenic
1077400277 11:2352225-2352247 GAGGAACCCAGGGCTCTGGACGG - Intergenic
1078551089 11:12281078-12281100 GAGGAGCCCAGAGCTGTGCACGG + Intronic
1078564096 11:12398583-12398605 GCCTAGCCCAGTGTCCTGGAGGG + Intronic
1079429921 11:20379658-20379680 GTGGAGCCCAGAGTACTGGATGG + Intronic
1080351146 11:31386855-31386877 GAGGAGCCCACTGCCCTGAAGGG + Intronic
1081876227 11:46410173-46410195 GAGGGACCCAGAGCCCTAGAGGG + Intronic
1083113186 11:60432149-60432171 GAGTAAACCAAAGCCCTGTACGG + Intronic
1083276357 11:61599245-61599267 GGGTGGCACAGAGCCCTGGCTGG - Intergenic
1083302627 11:61746758-61746780 GAGTCGCCCAGGCCCCTGGGAGG - Exonic
1083322633 11:61856830-61856852 GGGGAGCCCAGAGGGCTGGAGGG + Intronic
1083786822 11:64954424-64954446 AGGTTTCCCAGAGCCCTGGAAGG + Intronic
1083945585 11:65920975-65920997 GAGCAGCCCAGAGGCATGGGAGG + Intronic
1084090411 11:66875768-66875790 GAGGAGCCCAGAGTCCAGCAAGG - Intronic
1084671793 11:70611401-70611423 GAGCAGCCCAGGGCTCTGGCTGG - Intronic
1085044823 11:73346735-73346757 GAACAGCCCGGAGCCCTGGGCGG + Intronic
1085260719 11:75203212-75203234 CAGTAACCCAGAGCCCCTGAGGG + Intronic
1085508564 11:77073866-77073888 CAGGAGCCCAGAGCTCTGGGTGG + Intronic
1085722571 11:78925690-78925712 GGGTAGCACGGAGCCATGGAAGG - Intronic
1088765141 11:112967987-112968009 CAGTCCCCCAGAGCCTTGGAAGG + Intronic
1090026171 11:123169271-123169293 GAGGAGCCAAGAGCCCTGCTGGG + Intronic
1091703224 12:2677625-2677647 GAGGATGCCAGGGCCCTGGAGGG + Intronic
1092380323 12:7990842-7990864 GAGTACCCCAGAGAGCTGGTAGG + Intergenic
1096491010 12:52013030-52013052 GGGTAGCCCAGGGTCCTGGGTGG + Intronic
1097008855 12:55938384-55938406 GAGAAGCCTAGAGCCTGGGATGG - Intronic
1098333955 12:69382583-69382605 GAGGAGCCCACTGCCCTGAAGGG - Intronic
1098736483 12:74112079-74112101 GAGGTGCCCAGAGCTCTGGGAGG + Intergenic
1099421215 12:82463237-82463259 GAGGATCCCAGAGGCTTGGAAGG - Intronic
1101065107 12:101012850-101012872 GAGGAGCCCAGAGACCTTGATGG + Intronic
1101638005 12:106562498-106562520 TAGAAGCCCAGAGCCCAGCATGG + Intronic
1101791862 12:107934911-107934933 GTACAGCCCGGAGCCCTGGAAGG - Intergenic
1101879154 12:108614677-108614699 GAGGAGCCCAGAGACATGGCTGG + Intergenic
1101957434 12:109223364-109223386 GAGGAGCCCAGCGCGCTGCAGGG + Intronic
1103004231 12:117408691-117408713 TCACAGCCCAGAGCCCTGGAAGG - Intronic
1107083933 13:36405499-36405521 GGGTAGCCCATTGCCCTGAAGGG - Intergenic
1107807842 13:44171800-44171822 GGGGAGCCCACAGCCCTGAAGGG - Intergenic
1107808209 13:44174615-44174637 GAGGAGCCCACTGCCCTGAAGGG - Intergenic
1112433667 13:99375214-99375236 GAGCAGCCCAGAACGCTGGCAGG + Intronic
1121042523 14:90760658-90760680 CACTAGCCCAGAGCCCTGGGGGG + Intronic
1121102583 14:91260222-91260244 GTGTAGCCAAGAGGCCAGGAAGG + Intergenic
1121717783 14:96088617-96088639 GAGAAGCCCAGAGCCATGGCGGG + Exonic
1122375761 14:101255904-101255926 CAGTCGCCCAGACCTCTGGAAGG + Intergenic
1122623822 14:103074189-103074211 GAGAAGCCCAGAGCCAAGGGAGG - Intergenic
1122788703 14:104175515-104175537 GGGTACCCCTGAGCCCTGCAAGG + Exonic
1122811895 14:104293347-104293369 GAGTAGGCCAGGGGCCTGGAGGG + Intergenic
1122871139 14:104639609-104639631 GATTAGCACAGAGCACAGGAAGG - Intergenic
1124621226 15:31275198-31275220 GAGGATCCCAGAGGCCTGGTTGG + Intergenic
1125429172 15:39579241-39579263 GAGGAGCCCAGAGCCATGAGCGG + Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1126702973 15:51384162-51384184 CAGGAGCCCACAGCCCTGGGAGG + Intronic
1127641433 15:60919322-60919344 GAGAAGCCCAGGGCCCAGCAGGG + Intronic
1128213213 15:65916611-65916633 GACAAGCCCAAAGTCCTGGAAGG - Intronic
1128607326 15:69046814-69046836 AAGTATCTCAGAGCCCTGCAGGG - Exonic
1128672107 15:69581411-69581433 GAGTAGGACAGAGCCCAGCAAGG - Intergenic
1128730370 15:70016622-70016644 CTGAAGCCCAGAGCCCTTGAAGG - Intergenic
1132252655 15:100345836-100345858 GAGGAGCCCAGAGCCCAGGGTGG - Intergenic
1132677459 16:1126611-1126633 GAGGGGCCCGGAGCCCTGAAGGG - Intergenic
1132842805 16:1986451-1986473 GAGCAGCACAGAGCCATGGGGGG - Exonic
1133267603 16:4594290-4594312 CTGTACCCCAGAGCCCAGGACGG - Intronic
1134683345 16:16141830-16141852 CAGTGTCCCAGGGCCCTGGATGG + Exonic
1135120721 16:19764207-19764229 GACTGGCCCAGAGTCCTGGATGG - Intronic
1135762402 16:25147815-25147837 GAGTAGCTGAGACCCCAGGAAGG + Intronic
1137839682 16:51628759-51628781 GAGTAGCTCTGATCCCAGGAAGG - Intergenic
1138081253 16:54093428-54093450 GAGAAGCCCAGCTCCCTGGCAGG + Intronic
1138309167 16:56008588-56008610 GAGCCCCCCAGAGCCCGGGAGGG + Intergenic
1138638272 16:58361665-58361687 GAGAAGCCCACTGCCCTGAAGGG - Intronic
1139922478 16:70468841-70468863 GACAACCCCAGAGACCTGGAAGG - Exonic
1140146844 16:72319630-72319652 GAGTTGCCCAAAGCCATGGGAGG - Intergenic
1141010886 16:80397407-80397429 GAGGAGCCCACTGCCCTGAAGGG + Intergenic
1141479662 16:84297976-84297998 GACGAGCCCATAGCCCTTGAGGG - Intronic
1141485174 16:84334088-84334110 GGGGAGCCCAGTGCCCTGAAGGG + Intergenic
1141625268 16:85258261-85258283 GAGCAGCCCAGTTCCCTTGAGGG + Intergenic
1141842852 16:86585253-86585275 GAGAAGCCAAGAGCTCTGGGTGG - Intergenic
1142995161 17:3755726-3755748 AGGTAGGGCAGAGCCCTGGATGG + Intronic
1144785173 17:17827436-17827458 GTGCAGCCCAGCTCCCTGGAGGG - Intronic
1145385724 17:22410365-22410387 GAGGAGGCCAGAGCCCAGGTAGG - Intergenic
1148027660 17:44599821-44599843 GAAGAGCCCAGGGCTCTGGAAGG + Intergenic
1148185662 17:45641695-45641717 GAGGTGCCCAGGGCCCAGGAAGG + Intergenic
1148469533 17:47884632-47884654 GACAAGCCCAGGGGCCTGGAAGG + Intergenic
1149007921 17:51824723-51824745 CAGTTGCCCAAAGGCCTGGAGGG - Intronic
1149979974 17:61302947-61302969 GAATATCCTAGAGCCATGGATGG - Intronic
1150300044 17:64040231-64040253 GAGAAGCCCAGCGCCCTGGAAGG - Exonic
1150704888 17:67477757-67477779 GGGAAGCCCAGGGCCCTCGATGG - Intronic
1151433434 17:74080164-74080186 GAGTTACCCAGGGCCCTGGGTGG - Intergenic
1152654755 17:81514459-81514481 GAGGAGACCAGAGACCCGGAGGG - Intronic
1152854968 17:82659483-82659505 GGGTACCCATGAGCCCTGGAGGG + Intronic
1153715789 18:7846677-7846699 GGGAAGCGCACAGCCCTGGAGGG + Intronic
1154930944 18:20995549-20995571 GAGGAGCCCACTGCCCTGAAGGG + Intronic
1155259041 18:24023591-24023613 GGGTACCCCAGAGCCCTGCAAGG - Intronic
1155533823 18:26795105-26795127 GAGGAGCCCACTGCCCTGAAGGG + Intergenic
1157197843 18:45634116-45634138 TAGTAGCACAGAGCCCAGGGTGG - Intronic
1157489361 18:48111560-48111582 GAGAAGACCAGAGCCCTGGCTGG + Intronic
1158481259 18:57823809-57823831 GAGAAGCCCACTGCCCTGAAGGG - Intergenic
1160721021 19:596943-596965 GGGGACCCCAGAGCCCTGCAGGG - Intronic
1160848982 19:1180638-1180660 GAGGAGCCCGGCGCCCAGGAGGG - Intronic
1162174513 19:8821441-8821463 GAGGAGCTCAGAACCCTGGGAGG - Intronic
1162367330 19:10257404-10257426 GTGTGGCCCAGAACCCTGAAAGG - Intronic
1162399455 19:10435990-10436012 CAGGAGCCCAGAGGCCTGGATGG - Intronic
1162764640 19:12911382-12911404 GTGGAGGCCAGGGCCCTGGAAGG - Intronic
1163768352 19:19176156-19176178 GAGTGACTCAGAGCCCTAGAAGG + Intronic
1164406930 19:27957482-27957504 GAGAAGCCCATGGCTCTGGAAGG - Intergenic
1164751015 19:30654727-30654749 CAGGAACCCAGTGCCCTGGAAGG + Intronic
1166270279 19:41709299-41709321 GTGTTGACAAGAGCCCTGGAGGG + Intronic
1166276223 19:41756213-41756235 GTGTTGACAAGAGCCCTGGAAGG + Intronic
1166281484 19:41797235-41797257 GTGTTGACAAGAGCCCTGGAGGG + Intronic
1166406870 19:42527761-42527783 GTGTTGACAAGAGCCCTGGAGGG - Intronic
1167149164 19:47699075-47699097 GAGGAGCCCAGAGGCGAGGAAGG - Intronic
1167639520 19:50673086-50673108 GAGCAGCCCACAGCCCACGATGG + Intronic
1168078287 19:53992151-53992173 GAGAAGAACAGAGCCCTGGCTGG - Intergenic
925232393 2:2245341-2245363 GAGTAGGCTAGAGCTCGGGATGG - Intronic
926144131 2:10386521-10386543 AAGTGGCCCAGGGCCCTGGGAGG + Intronic
926695727 2:15769164-15769186 GGCCAGCCCAGAGGCCTGGAGGG - Intergenic
927236572 2:20880476-20880498 GGGATGCCCAGAGCCCTGGCTGG + Intergenic
927454321 2:23236547-23236569 GAGGGGGCCAGAGACCTGGAAGG - Intergenic
928239083 2:29571059-29571081 GAAGAGCCCACAGTCCTGGAGGG + Intronic
929525016 2:42693636-42693658 GGGGAGCCCAGTGCCCTGAAGGG - Intronic
931620598 2:64206039-64206061 GAGAAGACCAAGGCCCTGGAAGG + Intergenic
932394350 2:71430479-71430501 GAGTAGCCCAGATGTATGGAGGG + Intronic
935618507 2:105109270-105109292 GAATGGCCCAGAGCCCTGGAGGG - Intergenic
935697536 2:105783102-105783124 CAGAAGGCCAGAGCCCTGGGAGG + Intronic
935868448 2:107417910-107417932 GAGTTGGCCAGAAACCTGGAAGG - Intergenic
937552202 2:123108030-123108052 GAGTAGGACATAGCCCTGGCAGG - Intergenic
937863311 2:126730232-126730254 TAGTACCCCAGAACCCTGCATGG + Intergenic
938242796 2:129756272-129756294 GAGGAACCCAGAGCCCAGAAGGG + Intergenic
939273619 2:139971232-139971254 GAGGAGCCCATTGCCCTGAAGGG + Intergenic
941012425 2:160316330-160316352 GTGAAGCAGAGAGCCCTGGAAGG + Intronic
944581534 2:201137015-201137037 GGGTAGCCCAGAGCTGGGGAAGG + Intronic
944616373 2:201464980-201465002 GGGTAGCCCACTGCCCTGAAGGG - Intronic
946365335 2:219245546-219245568 TAGGAGCCCAGAGCCCGGGATGG - Intronic
947009220 2:225547223-225547245 GGGTAGCCCACTGCCCTGAAGGG + Intronic
947518962 2:230829282-230829304 GAGTCGCCCAGTGAACTGGAAGG - Intergenic
947893246 2:233644691-233644713 GAGAATCCCTGAGCCCTGGTGGG - Intronic
948304261 2:236935097-236935119 GAGAATCCCAGAGCCCGAGAGGG + Intergenic
948586240 2:239021533-239021555 GACACGCCCAGAGTCCTGGAGGG + Intergenic
948682580 2:239645975-239645997 GAGATGCCCAGCGCCCTGCAAGG - Intergenic
948759713 2:240183105-240183127 TAGAAGCCCAGAGTCCTGCAGGG - Intergenic
1168794760 20:604143-604165 GGGCTGCCCTGAGCCCTGGAAGG - Exonic
1169049126 20:2561674-2561696 CTGTAGCCCAGGGCCCTGGAGGG - Intronic
1169950295 20:11035995-11036017 GACTAGCCCAGGCCTCTGGAAGG - Intergenic
1170702242 20:18713918-18713940 GAGCTGCCCAGAGCCCAGCACGG + Intronic
1172028549 20:31966339-31966361 GAAGTGCACAGAGCCCTGGATGG - Intergenic
1172599077 20:36171280-36171302 GGGGAGCCCACAGCCTTGGAAGG - Intronic
1173482709 20:43416050-43416072 GAGAATCCCAGAGTCCTCGAGGG + Intergenic
1173502485 20:43564236-43564258 GACTGGGCCAGAGCCCTTGAGGG + Intronic
1174277672 20:49415557-49415579 GAGTTGCCCGGAGCCAAGGAAGG - Intronic
1175055107 20:56190894-56190916 GGGAAGACCAGAGCCCTGCATGG + Intergenic
1175166575 20:57048473-57048495 GGGCAGCCCAGAGGCCAGGAGGG + Intergenic
1175789855 20:61734504-61734526 GAGGTGCCCAGAGCCCCAGACGG + Intronic
1176160645 20:63646146-63646168 GAGCAGCACAGAGCCCAAGAGGG + Intronic
1176179115 20:63741316-63741338 GAGGGGCCCAGAGCTCTGGCTGG + Intronic
1179006960 21:37523557-37523579 GAACAGCCGATAGCCCTGGAAGG - Intergenic
1179296561 21:40068052-40068074 GAGGAGCCCAGAGCCAAGGATGG - Intronic
1179556093 21:42177402-42177424 GGGCAGAACAGAGCCCTGGATGG + Intergenic
1179720262 21:43312503-43312525 GACGGGCCCAGAGCCCTTGAGGG + Intergenic
1180221766 21:46363849-46363871 GAGCCGCCCACAGCCCAGGACGG + Exonic
1181022643 22:20111800-20111822 GCACAGCCCAGTGCCCTGGATGG - Exonic
1181035894 22:20169592-20169614 TAGTGGCCCACAGCCCTGGGGGG + Intergenic
1181552595 22:23649279-23649301 GAGCAGTACAGTGCCCTGGATGG - Intergenic
1182018276 22:27059621-27059643 GCTAAGCCCACAGCCCTGGAAGG + Intergenic
1182075774 22:27494562-27494584 GAACATGCCAGAGCCCTGGAAGG - Intergenic
1184421402 22:44384756-44384778 GGGTGGCCTGGAGCCCTGGAAGG + Intergenic
949763618 3:7500539-7500561 TGGTTGCCCAGAGGCCTGGAGGG + Intronic
950801051 3:15552127-15552149 GGGGAGCCCAGTGACCTGGAGGG - Intergenic
950831616 3:15880044-15880066 GGGTAGCCCAGGGCCAGGGAAGG - Intergenic
952993645 3:38855636-38855658 GAATAGCCCTGATCCCAGGAAGG + Intronic
953362384 3:42309383-42309405 GAGGAGCCCACTGCCCTGAAGGG - Intergenic
956223003 3:66923806-66923828 GAGGAGCCCACTGCCCTGGAGGG + Intergenic
957388710 3:79533095-79533117 TAGTAGGCTTGAGCCCTGGAGGG + Intronic
958085269 3:88798157-88798179 GAGGAGCCCACTGCCCTGAAGGG - Intergenic
958876707 3:99624960-99624982 GAGGAGCCCACTGCCCTGAAGGG + Intergenic
959441280 3:106378540-106378562 CAGAAGCCCAGAGCACTGCAAGG + Intergenic
959944825 3:112115350-112115372 GAGAGGCCCAGGGCCCTGGGAGG + Intronic
961213644 3:125143666-125143688 GAGCAGCCTAGAGCCCTGCCTGG + Intronic
961964402 3:130887714-130887736 GGGAAGCCCAGTGCCCTGAAGGG - Intronic
963443620 3:145373983-145374005 ATTTAGCCCACAGCCCTGGAGGG + Intergenic
964686790 3:159404394-159404416 GAGGAGCCCACTGCCCTGAAGGG + Intronic
964846936 3:161054450-161054472 GATTACCCCACAGCTCTGGACGG + Intronic
967627908 3:191707958-191707980 GAGCAGGGCAGAGCCCTGGGTGG - Intergenic
967892653 3:194374048-194374070 GCGGAGACGAGAGCCCTGGATGG - Intergenic
967938768 3:194750035-194750057 CAGCAGACCAGCGCCCTGGACGG + Intergenic
968450193 4:672120-672142 CAGCAGCCCAGACCCCTGGATGG - Intergenic
968605460 4:1533087-1533109 GACGAGCCCTGAGCCCTGGGTGG + Intergenic
969348622 4:6584963-6584985 GAGGAGCCAGGAGCTCTGGAGGG - Intronic
969360174 4:6658393-6658415 GAGTGGCCAAGAGCCATGCAGGG - Intergenic
969477313 4:7428890-7428912 GGGGAGCCCAGACCCCAGGAAGG + Intronic
969533407 4:7741567-7741589 GAGAACGCCAGAGCCCTGGCTGG + Exonic
969533425 4:7741639-7741661 GAGAACGCCAGAGCCCTGGATGG + Exonic
969533443 4:7741711-7741733 GAGAACGCCAGAGCCCTGGCTGG + Exonic
969701992 4:8772836-8772858 GACTTGCCCACAGCCCTAGAGGG - Intergenic
969708068 4:8823555-8823577 GTATAGCCCATAGCCCTGGCTGG - Intergenic
970963377 4:21898905-21898927 GGGAAGCCCAGTGCCCTGAATGG + Intronic
971017593 4:22504781-22504803 TAGTAGCCCAGCGACCTGAAGGG - Intronic
972560786 4:40226658-40226680 ATGCAGCCCAGAGCACTGGAAGG - Intronic
973699910 4:53526561-53526583 GAGTAGCACAGGGGTCTGGAAGG - Intronic
977812521 4:101373825-101373847 GAGTTTCCCCAAGCCCTGGATGG + Intergenic
979158581 4:117429599-117429621 GAGTTGCCCTGAGCCCAGGCGGG + Intergenic
980347244 4:131636582-131636604 GAGTATCCCACTGCCCTGAAAGG + Intergenic
981203798 4:142015354-142015376 GAGGAGCCCACTGCCCTGAAAGG - Intergenic
982440899 4:155434548-155434570 GAGTGGACAAGAGCCCAGGAAGG - Intergenic
984112693 4:175639426-175639448 GAGTAGTCTAGAGCCCTAGAAGG - Intronic
985702504 5:1382168-1382190 GAGTAGCCGGGAGGCCTGGGAGG + Intergenic
985863448 5:2492894-2492916 GACCAGCTCACAGCCCTGGAAGG + Intergenic
986336644 5:6760307-6760329 GGGGTGCGCAGAGCCCTGGAAGG + Intergenic
986657557 5:10030470-10030492 GGGAAGCCCAGTGCCCTGAAAGG - Intergenic
988608471 5:32703209-32703231 GGGGAGCCCAGTGCCCTGAAGGG - Intronic
988779831 5:34510205-34510227 GAGTAGCCTAGAGAACAGGAAGG + Intergenic
988898695 5:35707736-35707758 GGTTAGCCCAGATGCCTGGAGGG - Intronic
990609965 5:57447103-57447125 GAGTATCCCATAGTCCAGGATGG + Intergenic
991414659 5:66379730-66379752 GAGTAGCCCTGCGCCCAGAAAGG + Intergenic
992291402 5:75283521-75283543 GGGTAGTCCACAGCCCTGAAGGG + Intergenic
994124614 5:96155299-96155321 CTGTTTCCCAGAGCCCTGGATGG + Intergenic
995146881 5:108796758-108796780 GAGGAGCCCACTGCCCTGCAGGG - Intronic
996029830 5:118692844-118692866 GTGCAGCCCAGAGCCCTGGCAGG + Intergenic
998126817 5:139629665-139629687 GAGTAGTACAGAGACTTGGAAGG + Intergenic
1001893897 5:175362465-175362487 GCACAGCCCAGAGCCCTGGGTGG - Intergenic
1002171206 5:177375568-177375590 GACTAGCCCAGGAACCTGGAAGG + Intergenic
1002841985 6:914079-914101 CAGGAGCCCAGAGGCCAGGATGG - Intergenic
1003320618 6:5047880-5047902 GAGTAGCTCTGTGCCCTGGGTGG + Intergenic
1003676256 6:8207190-8207212 GAGAAGCCAGAAGCCCTGGAAGG + Intergenic
1004731755 6:18366236-18366258 GGGTAGCCCAGTGCCAGGGAAGG + Intergenic
1006385556 6:33728848-33728870 GGGGAGCCCTGAGCCCTGGAAGG - Intronic
1007334284 6:41140901-41140923 GAGTAGACGGGAGGCCTGGAAGG + Intergenic
1007590478 6:43017783-43017805 GAGTACCCCAGAGCTGAGGAGGG + Intronic
1007946280 6:45829971-45829993 GAGAAGCCCAAAGCCTTGCAAGG + Intergenic
1012190799 6:96277309-96277331 GAGGAGCCCACTGCCCTGAAAGG + Intergenic
1014754659 6:125289636-125289658 AAGGACCCCAGAACCCTGGAGGG - Intronic
1016031674 6:139344428-139344450 GAATAACACAGAGCCCAGGAAGG + Intergenic
1017538072 6:155369977-155369999 GTGTAGCCAGGAGCCATGGAGGG + Intergenic
1018063560 6:160109315-160109337 GTGGAGCACAGAGCCCTGGAAGG + Intronic
1019093809 6:169562907-169562929 GAGGAGGCCACAGCCCGGGAAGG + Intronic
1019375413 7:688725-688747 GAGGACCGCAGAGCTCTGGAGGG - Intronic
1019604333 7:1901020-1901042 GACAAACCCAGGGCCCTGGAGGG + Intronic
1020136018 7:5588480-5588502 GTGTGGCTCAGGGCCCTGGAGGG + Intergenic
1021123763 7:16826525-16826547 GAGGAGCCCACAGCCCTGAAGGG + Intronic
1022441660 7:30438010-30438032 GAGGTGCGCAGAGTCCTGGAGGG + Intronic
1023983181 7:45081322-45081344 GAGCAGCACAGTGCCCAGGAAGG + Intronic
1025712538 7:63926200-63926222 GAGTGGTACAGATCCCTGGAGGG + Intergenic
1025809672 7:64867819-64867841 TAGTTCACCAGAGCCCTGGAGGG - Intergenic
1026970284 7:74463612-74463634 GATTACCACAGAGCCCTGGAGGG + Intronic
1026978461 7:74512974-74512996 GAGTACCCCAGGGCTCCGGAGGG + Intronic
1027405566 7:77856277-77856299 GTGGAGCCCACAGACCTGGAGGG - Intronic
1030096946 7:105909036-105909058 GAGGAGCCCAGAAGACTGGATGG - Intronic
1031231595 7:119114370-119114392 GAGTAGCCCAATGCCCTGACGGG - Intergenic
1032018095 7:128392507-128392529 GGGTAGCCCAGGGCCGGGGAAGG + Exonic
1032101233 7:128979902-128979924 GAGTTACCCAAAGCCCTGTAAGG + Intronic
1032453811 7:132056740-132056762 GAAGAGCCCAGAGCAGTGGAGGG + Intergenic
1034969237 7:155408884-155408906 AAGAAGCAGAGAGCCCTGGAGGG - Intergenic
1035024986 7:155819352-155819374 CTGGAGCCCAGAGCCCTGCACGG - Intergenic
1035106003 7:156441892-156441914 CCGAAGGCCAGAGCCCTGGAGGG + Intergenic
1035236214 7:157499209-157499231 GAGGAGCCGGGAGCCCTGGTTGG + Intergenic
1035522609 8:287242-287264 CAGTGGCCCACAGCCCTGCATGG - Intergenic
1041693743 8:60714559-60714581 GAGAAGCCCAGGGGCCAGGAGGG - Intronic
1044066265 8:87703750-87703772 GAGAAGCCCATTGCCCTGCAGGG + Intergenic
1045754614 8:105528125-105528147 GAGAAGCCCTGAGCCCAGGTGGG + Intronic
1047275618 8:123402569-123402591 GGGTAGCCCAGGGCCGGGGAAGG - Intronic
1047982762 8:130200051-130200073 CAGTAGCCCAAGGCCCTGGTAGG - Intronic
1049180309 8:141218819-141218841 GAGGAGCCCGGCGCCCTGGATGG - Exonic
1049198092 8:141326328-141326350 AGGAAGCCCTGAGCCCTGGAAGG - Intergenic
1049412791 8:142480915-142480937 AACCAACCCAGAGCCCTGGAGGG - Intronic
1049427740 8:142544847-142544869 GAGGGGCCTAGGGCCCTGGAAGG - Exonic
1049847375 8:144809577-144809599 GACTGGCCGAGAGCCCTGGGAGG - Intronic
1051592247 9:18788206-18788228 CAGTAGCCCAGAGGCTTGCAAGG - Intronic
1061290755 9:129649225-129649247 GGGCAGCCCAGAGCCTGGGACGG + Intergenic
1061353508 9:130085251-130085273 GACTAGAGCAGAGCCTTGGATGG + Intronic
1062087291 9:134655338-134655360 GAGAAGCACAGAGCCCCGGGAGG + Intronic
1185680777 X:1886913-1886935 GAGAAGGACAGAGCCCTGGGAGG - Intergenic
1186523959 X:10230558-10230580 GAGGAGACCAGAGCCCTTGTTGG + Intronic
1187612894 X:20961542-20961564 GGGTAGCCCACTGCCCTGAAGGG + Intergenic
1189476842 X:41362712-41362734 GACTAGCCCAGAGCCCTGTCAGG - Intronic
1189640797 X:43068365-43068387 GAGGAGCCCAATGCCCTGAAGGG + Intergenic
1189858421 X:45247635-45247657 GAGGAGCCCACTGCCCTGAAGGG - Intergenic
1190808320 X:53860745-53860767 GGGGAGCCCACTGCCCTGGAGGG - Intergenic
1192557955 X:72105346-72105368 GACTTGCCCAGAGGCCTGCAGGG - Intergenic
1192679980 X:73242135-73242157 GGGGAGCCCAGAGCCTTGAAGGG + Intergenic
1193289254 X:79752808-79752830 GAGGAACCCACAGCCCTGAAGGG - Intergenic
1193386932 X:80883538-80883560 GAATAGCACTGAGCCCAGGAAGG + Intergenic
1193424634 X:81327559-81327581 CACAAGCCCAGAGGCCTGGAAGG + Intergenic
1193528790 X:82627612-82627634 GAGTACCCCAAGGCCCTGGGTGG - Intergenic
1195322249 X:103729308-103729330 TAGTGGCCCTCAGCCCTGGATGG + Intergenic
1196375756 X:115030858-115030880 GAGTAGCCCAAGGCCCTTGTTGG + Intergenic
1196888762 X:120272256-120272278 GAGGTGCCCAGAGCCCTCCATGG - Intronic
1197052539 X:122077289-122077311 GTGGAGCCCACTGCCCTGGAGGG - Intergenic
1198138115 X:133774871-133774893 GCCTAGCCCAGAGCCCAAGAAGG + Intronic
1198486546 X:137092997-137093019 GAATAGCTCAGAGACCAGGAGGG - Intergenic
1199882025 X:151981508-151981530 GAGTAGTCGAGAGGCCTGCAGGG + Intergenic
1199927362 X:152481062-152481084 GACTTGCCCAGAGCCCGGGAGGG + Intergenic
1200010153 X:153114534-153114556 GTTTATCCAAGAGCCCTGGAAGG + Intergenic
1200029447 X:153285388-153285410 GTTTATCCAAGAGCCCTGGAAGG - Intergenic
1201065033 Y:10089176-10089198 GGGGAGTCCAGAGCCCTGGCAGG - Intergenic