ID: 906376164

View in Genome Browser
Species Human (GRCh38)
Location 1:45298609-45298631
Sequence AACTGTGACTAAAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906376164_906376171 14 Left 906376164 1:45298609-45298631 CCCTCTTCCCTTTAGTCACAGTT 0: 1
1: 1
2: 2
3: 22
4: 272
Right 906376171 1:45298646-45298668 GTTTTCAGAATGAAGGACACAGG 0: 1
1: 0
2: 1
3: 29
4: 276
906376164_906376172 30 Left 906376164 1:45298609-45298631 CCCTCTTCCCTTTAGTCACAGTT 0: 1
1: 1
2: 2
3: 22
4: 272
Right 906376172 1:45298662-45298684 ACACAGGAGTCCCGAGTACAAGG 0: 1
1: 0
2: 0
3: 10
4: 100
906376164_906376170 7 Left 906376164 1:45298609-45298631 CCCTCTTCCCTTTAGTCACAGTT 0: 1
1: 1
2: 2
3: 22
4: 272
Right 906376170 1:45298639-45298661 ACTAGGTGTTTTCAGAATGAAGG 0: 1
1: 0
2: 1
3: 11
4: 217
906376164_906376169 -10 Left 906376164 1:45298609-45298631 CCCTCTTCCCTTTAGTCACAGTT 0: 1
1: 1
2: 2
3: 22
4: 272
Right 906376169 1:45298622-45298644 AGTCACAGTTGGAACACACTAGG 0: 1
1: 0
2: 1
3: 18
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906376164 Original CRISPR AACTGTGACTAAAGGGAAGA GGG (reversed) Intronic
901744765 1:11364934-11364956 AATTGTGACTGAAGTGAAGGGGG - Intergenic
903248787 1:22036888-22036910 AACTGTTAATAATGAGAAGAGGG - Intergenic
903429901 1:23287478-23287500 ATCTCTACCTAAAGGGAAGATGG - Intergenic
904628181 1:31820545-31820567 AACTGGGACTACAGGGAGTATGG - Intergenic
906376164 1:45298609-45298631 AACTGTGACTAAAGGGAAGAGGG - Intronic
906690498 1:47789731-47789753 ACCTGTAACTGAAGGGAAGGAGG - Intronic
907112731 1:51941022-51941044 AACTGGGACTATATGGTAGAAGG + Intronic
908674261 1:66584763-66584785 AAATTTGGCTACAGGGAAGAAGG - Intronic
910262259 1:85304044-85304066 ACCTATTACTAAAAGGAAGAAGG + Intergenic
910901839 1:92129672-92129694 AAATGGCCCTAAAGGGAAGAGGG - Exonic
911410261 1:97495378-97495400 AACTTTCAATGAAGGGAAGAGGG - Intronic
913276502 1:117143543-117143565 AAAAGTGAGTGAAGGGAAGATGG - Intergenic
915045451 1:153010149-153010171 AAGAATGACTAAAGGGAGGAAGG - Intergenic
915144515 1:153787985-153788007 GACTTCTACTAAAGGGAAGATGG + Intergenic
919361818 1:196606152-196606174 AACTGTGACAAGAGGAAGGATGG - Intronic
920601872 1:207333924-207333946 AAGTGAGACAAAAAGGAAGAGGG + Intronic
921315443 1:213886145-213886167 AATTGTGAATAATGGCAAGAGGG - Intergenic
921576175 1:216837504-216837526 AGCTGTGACTATGGGGAAGACGG + Intronic
922993205 1:229932956-229932978 AACACTGATTAAAGGAAAGATGG + Intergenic
924712095 1:246537905-246537927 CATGGTGACAAAAGGGAAGATGG - Intergenic
1064592359 10:16907400-16907422 AAGTATCACTAAAGGGAAAATGG + Intronic
1064618423 10:17188718-17188740 AACTCTGACTGAAGGAAAGTTGG - Intronic
1068639546 10:59387961-59387983 AATTGAGACAAAAAGGAAGAGGG - Intergenic
1069052151 10:63806723-63806745 AACTATCAACAAAGGGAAGAGGG - Intergenic
1069168323 10:65192343-65192365 AATTTTGACTAATGGGAAGTAGG + Intergenic
1069652883 10:70063882-70063904 AACTGAGAGTAAAAGCAAGAGGG + Intronic
1070398665 10:76033956-76033978 AACAGTGAATAAAAGGAGGAAGG + Intronic
1071703130 10:87964155-87964177 AACTTTACCTAAAGGGAGGAAGG - Intronic
1071735542 10:88294957-88294979 AAGTGTGACAAAAGAGAAGGTGG - Intronic
1072429724 10:95360139-95360161 AAATGCAACCAAAGGGAAGAGGG - Intronic
1072821637 10:98564061-98564083 AGCTCTCACTAAAGGGAGGAGGG - Intronic
1073637782 10:105217143-105217165 AACTGGGAACAAAGGGAAAACGG - Intronic
1074324627 10:112437608-112437630 ATCTTTGACTTAAGAGAAGATGG - Intronic
1075219365 10:120571374-120571396 GACTGTGCTTAAAGGGAGGATGG + Intronic
1076515166 10:131041464-131041486 AATTGTGGCTAACAGGAAGAGGG + Intergenic
1077559649 11:3251353-3251375 AACTGAAACTAGAGGCAAGAGGG - Intergenic
1077565542 11:3297156-3297178 AACTGAAACTAGAGGCAAGAGGG - Intergenic
1077634464 11:3832782-3832804 AACTGTGCCAAACAGGAAGAAGG + Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078327190 11:10390173-10390195 AACTCTGGCCAAAGTGAAGAAGG + Intronic
1078665147 11:13318239-13318261 AACTGTGACCATAGGTAGGAAGG + Intronic
1078912927 11:15750104-15750126 AAATATGTCTAAAGGGGAGAAGG + Intergenic
1079722548 11:23836503-23836525 AACTGTTACTAATGGGTGGAAGG - Intergenic
1079794625 11:24785066-24785088 TAGTGTAACTACAGGGAAGAAGG - Intronic
1081227701 11:40544949-40544971 GACTGTCACTAAAGGGAACATGG - Intronic
1082004938 11:47414270-47414292 AGCAGTGACTAAAGGGGACAAGG - Intronic
1086879715 11:92138995-92139017 AACTGTGTATAAAGGGAACATGG + Intergenic
1088613464 11:111601513-111601535 AAATGTGACTCAAGGAAACAGGG - Intergenic
1089256791 11:117198429-117198451 GACTGTTCCTAAAGGGAGGAAGG + Intergenic
1090673962 11:128972039-128972061 AACTGTGAATAATTGGCAGAGGG + Intronic
1092335013 12:7624673-7624695 AACTGTGACTCACAGGGAGAGGG + Intergenic
1092958260 12:13570276-13570298 AACTGTGTCTGAAAGGAAGAAGG + Intronic
1093859114 12:24141805-24141827 AAATGTGACCAAAGGCAAGTTGG + Intergenic
1094491671 12:30964520-30964542 AACTCTGGGTGAAGGGAAGATGG - Intronic
1098539480 12:71638159-71638181 ATCTGAGAGTAAAGTGAAGAAGG + Intronic
1099148495 12:79078122-79078144 ACCAGTGAGTAAAGGGAAAAAGG - Intronic
1099340204 12:81422002-81422024 AACTGTCTCTAGAGGCAAGAAGG + Intronic
1100224077 12:92538809-92538831 AACAGTGAATACAGGGTAGAGGG - Intergenic
1100575549 12:95888939-95888961 CACGGTGAGTAAAGGAAAGAAGG + Intronic
1102409212 12:112702640-112702662 AAGAGTGACTGAAGAGAAGAGGG + Intronic
1103701304 12:122850088-122850110 AACTATGACTAAAGGGGAGACGG + Intronic
1104331423 12:127850131-127850153 AACTGTGACAAAAGCAAAAATGG - Intergenic
1105213615 13:18272159-18272181 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1106224357 13:27773944-27773966 TACTGTGACTAAATGGAGGAGGG + Intergenic
1106319061 13:28621668-28621690 AACTGGGAAAAAAGGGAAGGAGG - Intergenic
1109400593 13:61822866-61822888 AACTGTGGCTCAAGGGAAGATGG + Intergenic
1109682517 13:65771679-65771701 AACAGTGATTTTAGGGAAGAAGG + Intergenic
1110953634 13:81524878-81524900 AACAGTGATTTTAGGGAAGAAGG + Intergenic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1112718174 13:102211043-102211065 AAATGAGAATAAAGGGAGGAGGG - Intronic
1116721531 14:48502623-48502645 AAATGTCAATGAAGGGAAGAGGG + Intergenic
1116815654 14:49581258-49581280 AAGTGTGACAGAAGGGAAGCTGG - Intronic
1117802704 14:59461731-59461753 AGTTGTGAATAAAGGGCAGAGGG - Exonic
1117932340 14:60856327-60856349 GACTTTGACTTAAGGGAATATGG - Intronic
1117976351 14:61300821-61300843 AAGGTTGACAAAAGGGAAGATGG - Intronic
1118091542 14:62485798-62485820 AAGTGTAACTAAAGGGGAGATGG - Intergenic
1118523895 14:66618829-66618851 AATTGTAACTACATGGAAGATGG + Intronic
1118975128 14:70670248-70670270 CACTGTGACAAAATGGAATAGGG - Intronic
1118984228 14:70739820-70739842 ATATGTGACTAAAAGGTAGAGGG + Intronic
1118991537 14:70801361-70801383 TATTGTCACTAAAGGGAATATGG + Intronic
1119754323 14:77104037-77104059 AACTGAGGCTAAAGTGGAGAAGG - Intronic
1120189225 14:81424903-81424925 AACTGTCTCTAAATGGGAGAGGG - Intronic
1120280239 14:82429869-82429891 AGCTGTGACTACAGGGAAGTGGG - Intergenic
1120434750 14:84466951-84466973 AATTGTGATTATAGAGAAGATGG + Intergenic
1121364668 14:93297968-93297990 AAGTGTTTCTAAAGGTAAGACGG + Intronic
1122680382 14:103456411-103456433 AAGTGTGAATGAGGGGAAGAGGG - Intronic
1124350016 15:28948340-28948362 ACCAGTGGCCAAAGGGAAGAAGG - Intronic
1125665862 15:41429634-41429656 AACTGTGACTAAAGTTTAGCAGG - Intronic
1126720736 15:51576396-51576418 AACTGTTACTAATAGGAAAAGGG + Intronic
1127582777 15:60352803-60352825 AAATGTGCCCAAAGGGAGGAGGG - Intronic
1127758085 15:62112449-62112471 GACTGAGAAGAAAGGGAAGAGGG + Intergenic
1127866187 15:63035177-63035199 AACTGTGAGCCAAGGGTAGATGG + Intergenic
1128784356 15:70383856-70383878 AACTTTCACTTAAGGGAAGCTGG - Intergenic
1129596205 15:76966416-76966438 AACTGTGAATGGAGGGAAGGGGG + Intergenic
1130304095 15:82701193-82701215 AACTCTGCCCAGAGGGAAGAGGG - Intronic
1130643990 15:85707377-85707399 AACTGTGACTTAAGAGAAAATGG - Intronic
1130796356 15:87214018-87214040 AACAGTGGCTAAAGTTAAGATGG - Intergenic
1131698359 15:94904554-94904576 AGCTGGGACTACAGGCAAGAAGG + Intergenic
1132304741 15:100802840-100802862 GCCTGTGACTGAAGGGAAGTGGG - Intergenic
1134439468 16:14289585-14289607 AACTGTGAATAACAGGAAGGTGG - Intergenic
1138533161 16:57646037-57646059 CACTGTGTGTAAAGGGAAGAAGG + Intronic
1138833648 16:60407084-60407106 ATTTGTTACTAAACGGAAGAAGG + Intergenic
1141339183 16:83187297-83187319 AACAGTCACTCAAAGGAAGAAGG + Intronic
1143344269 17:6238545-6238567 AACTGTGGCCCAAGGGATGATGG - Intergenic
1143383724 17:6512399-6512421 CTCAGTGACTGAAGGGAAGAGGG + Intronic
1144223927 17:13126335-13126357 ATATATGACAAAAGGGAAGATGG - Intergenic
1145414802 17:22705713-22705735 AACTGTGACAAAAGGGAGCTAGG + Intergenic
1145868307 17:28254859-28254881 GGCTGTGACTAATGGGAATAAGG - Intergenic
1146508111 17:33422889-33422911 AACTGAGACTAAAGGCAGGAAGG + Intronic
1147004202 17:37388655-37388677 ATCTGTGTCTAAAGGAGAGAGGG - Exonic
1148521454 17:48279860-48279882 AACTGTGAGCACAGGAAAGAAGG - Intronic
1148530528 17:48386008-48386030 AACTGTGACAAAAGGTTACAGGG - Intronic
1150909023 17:69369037-69369059 AACTGTGAACAGTGGGAAGATGG - Intergenic
1152447535 17:80354578-80354600 TACTGTGACTAAAGGAAGCAAGG + Intronic
1153568560 18:6445448-6445470 AACAGTAACTAAAGCTAAGAGGG + Intergenic
1153983839 18:10335685-10335707 AAATGTCACTAAAGGAAGGAAGG + Intergenic
1154504712 18:15024292-15024314 ATCTGTGGCTGAAAGGAAGAAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155820173 18:30365176-30365198 ACTTGTGACTTAGGGGAAGAAGG - Intergenic
1156999204 18:43504080-43504102 ATCTGTGGCTACTGGGAAGAGGG - Intergenic
1157792833 18:50548183-50548205 AACAGTGACTGAAGTGAACAAGG + Intergenic
1159063468 18:63541764-63541786 AACAGAGACAGAAGGGAAGAGGG + Intergenic
1161558280 19:4956694-4956716 AACTGGAACTAGAGGGAAGCGGG - Exonic
1163799728 19:19357086-19357108 GTCTGTGACTAAAGGGACGCTGG + Exonic
1164517372 19:28947911-28947933 ATCTGCGCCTAAAAGGAAGAGGG + Intergenic
1164868774 19:31626142-31626164 AACTGGGAATAAAGAGGAGAAGG - Intergenic
1164870573 19:31640113-31640135 AGCTGTGGCTAGAGGAAAGAAGG + Intergenic
1165874391 19:38995628-38995650 CACTACAACTAAAGGGAAGAAGG + Intronic
1166881534 19:45933481-45933503 AACTGTGATTGAAGAGAAGCAGG - Intergenic
925223855 2:2164907-2164929 CACTGTGACAGAAGGAAAGAAGG + Intronic
926075003 2:9935424-9935446 CACTGTGGATAAAGGGGAGAGGG + Intergenic
927269900 2:21195433-21195455 AAATCTGAAGAAAGGGAAGAAGG - Intergenic
929489300 2:42382285-42382307 AACAGAGAGAAAAGGGAAGAGGG + Intronic
932108096 2:68967457-68967479 AACAGCCACTGAAGGGAAGAGGG + Intergenic
932133457 2:69208078-69208100 AATTGTGTCAAAAAGGAAGAGGG + Intronic
932368213 2:71166619-71166641 AACTGGGCCTAGAGGGAAGGGGG - Intergenic
932529616 2:72515011-72515033 AAATGTGAGAAAAGTGAAGATGG + Intronic
934300713 2:91774587-91774609 AGGTGTGACAACAGGGAAGAGGG - Intergenic
934981012 2:98841107-98841129 AACACTGGGTAAAGGGAAGATGG - Intronic
935173616 2:100629346-100629368 GACTTTGGCTAAAGGGAAAAAGG + Intergenic
935373507 2:102371872-102371894 ACTGGTTACTAAAGGGAAGATGG + Intronic
936837952 2:116730915-116730937 AACTGGGGCTAAAGGGAAATGGG - Intergenic
938170484 2:129071222-129071244 AACAGTGACTATAGACAAGAGGG - Intergenic
938503902 2:131854500-131854522 ATCTGTGGCTGAAAGGAAGAAGG + Intergenic
938760411 2:134420560-134420582 AACAGTGGCTAAGGGAAAGACGG + Intronic
941357691 2:164513146-164513168 AAAAGAGACTGAAGGGAAGAAGG - Intronic
943906621 2:193507193-193507215 AACTGAGACTAAAGTTAAAAAGG + Intergenic
944299923 2:198112130-198112152 AAATGTGACTACTGGGCAGATGG - Intronic
944395584 2:199262799-199262821 AACAGTGATTTTAGGGAAGAAGG + Intergenic
944673318 2:202014653-202014675 ATTAGTGACTAAAGGGGAGAAGG + Intergenic
945228383 2:207557282-207557304 AACTGTGAGAAAATGGAAGTAGG - Intronic
945929814 2:215843564-215843586 AACTGAGACTAAAGACAAGTAGG - Intergenic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
948391860 2:237617502-237617524 AACTGTGATTAACTGGCAGAGGG + Intergenic
1169400332 20:5274205-5274227 ACCTGAGACTGAAGGGCAGATGG + Intergenic
1171852970 20:30321664-30321686 AAAGGTGACTCAAGGGAAGTGGG + Intergenic
1172921022 20:38482393-38482415 AGCTGTGACTAAAGATTAGAAGG - Intronic
1173929775 20:46809086-46809108 ATCTGTGGCTAAAAGGCAGAGGG - Intergenic
1175365147 20:58448463-58448485 AACTGTGACTGGGGGGTAGATGG + Exonic
1176926125 21:14751323-14751345 AACAGTGAATAAAAGGAAAAAGG - Intergenic
1177295634 21:19170951-19170973 AACTCTTACGAAAGTGAAGAGGG - Intergenic
1178421134 21:32444308-32444330 GACTGTGACTGCTGGGAAGAAGG - Intronic
1179071886 21:38079135-38079157 CACTGAGACTAAAGGGAATGGGG + Intronic
1180816449 22:18792550-18792572 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1181202636 22:21226882-21226904 AGGTGTGACAACAGGGAAGAGGG + Intronic
1181562810 22:23715478-23715500 ACCTGTGACTAAGAGGCAGATGG + Intergenic
1181699067 22:24609723-24609745 AGGTGTGACAACAGGGAAGAGGG - Intronic
1183245928 22:36693367-36693389 AACAGAGAGTAAAGGGGAGAAGG - Intronic
1203224277 22_KI270731v1_random:68531-68553 AGGTGTGACAACAGGGAAGAGGG - Intergenic
1203266549 22_KI270734v1_random:18261-18283 AGGTGTGACAACAGGGAAGAGGG + Intergenic
949243169 3:1894910-1894932 CACTGGGAATAAAGGGAAGTTGG + Intergenic
950327865 3:12129710-12129732 ACCTGGGACTTAAGGGAACAAGG - Intronic
951391204 3:22106356-22106378 AACAGTGACCAAAGGGCAGATGG - Intronic
955390727 3:58520595-58520617 AACTGCAACTTGAGGGAAGAGGG - Intronic
956693108 3:71895832-71895854 AACTGAGAGTAGAGAGAAGATGG + Intergenic
956770142 3:72518686-72518708 AACTGTGAATAAAGGGTAGTGGG - Intergenic
957050258 3:75406229-75406251 GACTGTGACTGCTGGGAAGAAGG + Intergenic
958813760 3:98893072-98893094 AATTGGGGATAAAGGGAAGAGGG + Intronic
960410510 3:117317808-117317830 AAATGTTAGTGAAGGGAAGAAGG + Intergenic
960594890 3:119399341-119399363 GACTGTGACTATAGAGAAGCAGG - Intronic
961453517 3:127013297-127013319 AGCTGTGTTTAAAGGGAAGCGGG + Intronic
962360822 3:134741363-134741385 AACTGTGACTGAAGCTAGGAGGG - Intronic
964444570 3:156745172-156745194 AACTGTGCTTAAGGGGAAAAAGG + Intergenic
964829252 3:160864809-160864831 AACAGTAAATAAAGGGAAGATGG + Intronic
969348407 4:6583422-6583444 TTCTGTTACTAAAAGGAAGAAGG + Intronic
970646369 4:18125766-18125788 ATCTGTAACTAAAGGAGAGAAGG + Intergenic
970907615 4:21235400-21235422 ATGTTTGACAAAAGGGAAGAAGG - Intronic
971319701 4:25595497-25595519 AACTGGAATTAAAGGAAAGAGGG - Intergenic
972340092 4:38145007-38145029 CACAGTGACCAAATGGAAGATGG + Intergenic
974456414 4:62134168-62134190 ACATGTGACTAGAGGGAAGGAGG + Intergenic
975257546 4:72255572-72255594 AGCTGTGACTAAAGGGGTCAAGG + Intergenic
975657397 4:76655304-76655326 CACTGTGTCTAAAGAGAACATGG - Intronic
977411235 4:96667972-96667994 AACCCTGACAAAAGGGAAAAAGG - Intergenic
977448761 4:97166764-97166786 AAAGGTGACTGAAGGGCAGAAGG + Intergenic
977888577 4:102280206-102280228 ACCTATGACCAAAGGGAAAAGGG - Intronic
978549755 4:109912813-109912835 AAGTGTCACTAAAGGAAAGGAGG + Intergenic
979453975 4:120905520-120905542 GGCTGTGACTAAATGGATGAGGG - Intronic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
979971787 4:127144621-127144643 TACTGTGTCTGAAAGGAAGATGG - Intergenic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
983299748 4:165909851-165909873 AACTGAGACTAGAGGTGAGAGGG + Intronic
983630480 4:169844560-169844582 AAATCTGAGTAAAGGCAAGAGGG - Intergenic
984201839 4:176731776-176731798 AACTGTTAAGAAAGGGATGATGG + Intronic
985179920 4:187248566-187248588 AACTGTCACTAAAGGATGGAAGG + Intergenic
985341230 4:188956767-188956789 AATCATGACTAAAGGGAAAAAGG + Intergenic
985948632 5:3205621-3205643 AACATTGACTAAAGGGGAAATGG - Intergenic
986417350 5:7542550-7542572 AACTGTGTAAAAAAGGAAGATGG + Intronic
986446709 5:7827610-7827632 AACTGTGTCAAAAGGGAGAATGG - Exonic
986517818 5:8581749-8581771 AACAGTGACTACAGAAAAGATGG - Intergenic
986924099 5:12724869-12724891 AACAGAGACTATTGGGAAGAAGG + Intergenic
986935971 5:12887068-12887090 AACTTGGACTAAAGGGATAATGG - Intergenic
989727280 5:44601607-44601629 AACAGTTTCTAAAGGGAACAGGG - Intergenic
990241451 5:53820199-53820221 AACTGTGGCTGAGGGGAGGAAGG + Intergenic
991054254 5:62305469-62305491 AACTGTGACTCAAGGGAAGAAGG - Intergenic
993801938 5:92352531-92352553 AACTATGATGAAAGGCAAGAAGG - Intergenic
994213115 5:97108207-97108229 AACTGTTACTAGAAGGAAGGTGG - Intronic
994383031 5:99094327-99094349 AACTGTGTCAGAAGAGAAGAAGG + Intergenic
994724017 5:103413662-103413684 AACTCTGACTCAAGGGAAAAAGG - Intergenic
995120200 5:108527944-108527966 AACTGTGACTTTAGGAAAAATGG - Intergenic
995670223 5:114594587-114594609 AACTGGGACTATATAGAAGAAGG - Intergenic
995964714 5:117890816-117890838 AACTGTGACTCCAAAGAAGAGGG + Intergenic
996580879 5:125030711-125030733 AACTGAGACTACAGAGGAGAGGG + Intergenic
998175665 5:139900615-139900637 GACTGTTACTATATGGAAGAGGG - Intronic
998490506 5:142542363-142542385 AACTGTGACGAGAGGGAGGAAGG - Intergenic
999079469 5:148829215-148829237 AACAGGGACCAAAGGAAAGAAGG - Intergenic
1000228044 5:159288604-159288626 AACTGGGAATAAAAGTAAGAGGG - Intergenic
1000510442 5:162174796-162174818 AGCTGTGACTAATTGGAGGAGGG - Intergenic
1000535604 5:162474315-162474337 AGCCTTGACTAAAGGGAAGATGG + Intergenic
1000716983 5:164656401-164656423 AACAATGAGTAAAGAGAAGAGGG + Intergenic
1001048207 5:168391983-168392005 AAGTAAGACTGAAGGGAAGAGGG + Intronic
1001866533 5:175110884-175110906 AACTGTGACAGAGGGGAAGTTGG + Intergenic
1003258027 6:4490793-4490815 AGTTGTGAAGAAAGGGAAGAAGG + Intergenic
1004509847 6:16276622-16276644 AGATGTGACTAAAGAGAATAAGG + Intronic
1006414272 6:33894079-33894101 ATCTGTCAGCAAAGGGAAGAGGG + Intergenic
1006656361 6:35596912-35596934 AACTTAGAGAAAAGGGAAGAGGG + Intronic
1007759565 6:44125890-44125912 AACTGTGAAAGAAAGGAAGATGG - Intronic
1009561517 6:65251544-65251566 AACTCTGATTCCAGGGAAGATGG + Intronic
1009882546 6:69586331-69586353 AACTGTTGCGAATGGGAAGATGG + Intergenic
1012003055 6:93678764-93678786 AGCTGTGACTAAAGGAAATTAGG + Intergenic
1014287841 6:119521766-119521788 AACTGTTTCTTAAGGAAAGAAGG - Intergenic
1015403809 6:132815135-132815157 AACTGCCACCCAAGGGAAGAAGG + Intronic
1015941534 6:138457626-138457648 AGCAGTGACTATATGGAAGAAGG - Intronic
1016737709 6:147497969-147497991 AAATGTGAACAAAGGGAAAAAGG + Intergenic
1019085603 6:169473307-169473329 AAGAGTGACAAAAGGGAAGGAGG + Intronic
1023241383 7:38151348-38151370 AACTGTGACTGACTGGAGGAGGG + Intergenic
1023690172 7:42778244-42778266 AACTGTGACAGAAGGGCAGAGGG - Intergenic
1025803053 7:64805596-64805618 GGCTGTGTCTCAAGGGAAGATGG + Intronic
1025929092 7:65980692-65980714 ACCTGTGACTAAGAGGCAGATGG + Intronic
1026536484 7:71242667-71242689 AACTTGGACTACAAGGAAGAGGG + Intronic
1029002081 7:97164889-97164911 AACTGAAACTATAGGAAAGATGG + Intronic
1029338389 7:99922081-99922103 AACTGTGATTAATGTGATGAAGG + Intergenic
1030321739 7:108176421-108176443 AACTGTGGATGAAGGTAAGATGG - Exonic
1031033014 7:116755196-116755218 AATTTTCACTAAAGGGAAAAGGG - Intronic
1031645780 7:124223192-124223214 AACTGTGACAAAGCAGAAGAAGG + Intergenic
1031649143 7:124264365-124264387 AATTGTCACTAAAGAGAATAGGG + Intergenic
1032007770 7:128317526-128317548 AACTGGGAGTAAAGGGAACTAGG + Intronic
1038453292 8:27653651-27653673 AACTGTGACCAAAGTCCAGAGGG + Intronic
1038770203 8:30471603-30471625 AAATCTGAATAAATGGAAGATGG + Intronic
1039980583 8:42406723-42406745 ACATGTGACAAAAAGGAAGAGGG + Intergenic
1041037500 8:53809452-53809474 GAGAGTCACTAAAGGGAAGAAGG + Intronic
1041410194 8:57545166-57545188 AACTGTGACCAAATAAAAGATGG + Intergenic
1041553186 8:59122706-59122728 AACTATAATTAAAGTGAAGATGG - Intergenic
1041946984 8:63455979-63456001 AAGTAGGACAAAAGGGAAGAAGG - Intergenic
1042034101 8:64511419-64511441 AACTGTGACTAAAAGAAAGCTGG - Intergenic
1042038775 8:64568773-64568795 ATCTCAGACTAAAGTGAAGAGGG - Intergenic
1043110488 8:76173847-76173869 AAATGTAACTAAAGAGAATATGG + Intergenic
1044283473 8:90383830-90383852 GACAGAGACTAAAGGAAAGAAGG - Intergenic
1045128929 8:99126276-99126298 AGCTTTGAGGAAAGGGAAGAAGG + Intronic
1045844427 8:106616991-106617013 AAATGTGATGACAGGGAAGAAGG + Intronic
1046200524 8:110921846-110921868 ATCTGAGTCTATAGGGAAGAAGG + Intergenic
1047670274 8:127138665-127138687 AAAAGTGACTAAATGGAAGTAGG - Intergenic
1048534775 8:135283120-135283142 TACTGTGAGTAAGGGGAAAATGG + Intergenic
1049119487 8:140721834-140721856 AACTTAGCCTAAAGGGAGGAGGG - Intronic
1050191255 9:3029007-3029029 AACTGTGAACCAAAGGAAGAAGG + Intergenic
1051347223 9:16162987-16163009 ATCTGTGACTTAAGGGAGAAAGG + Intergenic
1051874444 9:21776596-21776618 GTCTGTGACCAAAGAGAAGATGG + Intergenic
1052348291 9:27432105-27432127 AAGTTTAATTAAAGGGAAGAAGG + Intronic
1055734027 9:79308741-79308763 AACTGTGCCTAACGGGTAGTAGG + Intergenic
1056460403 9:86804464-86804486 AAATGTGACTGAAGGGAAGTTGG - Intergenic
1058483793 9:105423030-105423052 AACTGGGACGGAAGGAAAGAGGG + Intronic
1059614229 9:115931431-115931453 AACTGTTAATAATGGGAAGCAGG - Intergenic
1059648125 9:116287371-116287393 AACTGTGAATAAAGGACAAATGG + Intronic
1060302682 9:122384455-122384477 AACAGTCATTAGAGGGAAGAGGG + Intronic
1060383887 9:123204578-123204600 AATTCTGACTAAAAGGAAAAAGG + Intronic
1185889045 X:3808206-3808228 CACGGTGACAAAAGGGAAGATGG + Intergenic
1186399333 X:9242240-9242262 AACTGTGACTAGAAGGAATGAGG - Intergenic
1186813555 X:13213584-13213606 AAAAATGAATAAAGGGAAGAGGG + Intergenic
1186937517 X:14466800-14466822 TACTGGGACTAATGGGAAGAGGG - Intergenic
1187683177 X:21788815-21788837 AACAGTGACTAAAAGGAGGTTGG - Intergenic
1191786924 X:64925958-64925980 GACCCTGACTAAAGGGCAGAAGG + Intronic
1195062414 X:101209287-101209309 AACTGTGATTAAATTGAAGTGGG - Intergenic
1196950069 X:120868232-120868254 CACTGTGAGAAAAGGGAGGAAGG - Intergenic
1197072248 X:122313644-122313666 AGCTGTGACTAAAAGGAACCAGG + Intergenic
1197094408 X:122575702-122575724 AACTGTGACCAAAAGCAAAAGGG + Intergenic
1197724031 X:129764095-129764117 AACTCTGACTAAATAGAAAATGG + Intronic
1197744414 X:129921591-129921613 AGCTGTGATCAAATGGAAGAGGG + Intronic
1199286103 X:146056042-146056064 ATCTGTGAGTAATGGGAAGAGGG + Intergenic
1200867353 Y:8059118-8059140 AACTATGTCTACAGGGAACATGG + Intergenic