ID: 906377833

View in Genome Browser
Species Human (GRCh38)
Location 1:45310354-45310376
Sequence CTTATGGAAGCTCTATCTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906377829_906377833 26 Left 906377829 1:45310305-45310327 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 906377833 1:45310354-45310376 CTTATGGAAGCTCTATCTTACGG No data
906377831_906377833 -3 Left 906377831 1:45310334-45310356 CCTATAAAGTTTATAAAAGGCTT No data
Right 906377833 1:45310354-45310376 CTTATGGAAGCTCTATCTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906377833 Original CRISPR CTTATGGAAGCTCTATCTTA CGG Intergenic
No off target data available for this crispr