ID: 906379926

View in Genome Browser
Species Human (GRCh38)
Location 1:45326348-45326370
Sequence GCCTCAGTGCACAAATAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 1, 2: 3, 3: 53, 4: 528}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906379926_906379930 3 Left 906379926 1:45326348-45326370 CCCAGCTATTTGTGCACTGAGGC 0: 1
1: 1
2: 3
3: 53
4: 528
Right 906379930 1:45326374-45326396 GAAAATCGCCTGAACCCAGGAGG 0: 14
1: 1300
2: 30555
3: 113048
4: 189544
906379926_906379931 6 Left 906379926 1:45326348-45326370 CCCAGCTATTTGTGCACTGAGGC 0: 1
1: 1
2: 3
3: 53
4: 528
Right 906379931 1:45326377-45326399 AATCGCCTGAACCCAGGAGGTGG 0: 337
1: 16822
2: 69517
3: 122102
4: 120690
906379926_906379932 9 Left 906379926 1:45326348-45326370 CCCAGCTATTTGTGCACTGAGGC 0: 1
1: 1
2: 3
3: 53
4: 528
Right 906379932 1:45326380-45326402 CGCCTGAACCCAGGAGGTGGAGG 0: 137
1: 7095
2: 35434
3: 86234
4: 142340
906379926_906379929 0 Left 906379926 1:45326348-45326370 CCCAGCTATTTGTGCACTGAGGC 0: 1
1: 1
2: 3
3: 53
4: 528
Right 906379929 1:45326371-45326393 AAGGAAAATCGCCTGAACCCAGG 0: 2
1: 73
2: 3081
3: 56523
4: 206881

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906379926 Original CRISPR GCCTCAGTGCACAAATAGCT GGG (reversed) Intergenic
900151750 1:1181974-1181996 CCCCCAGTGCACACAGAGCTGGG + Intronic
900996817 1:6127369-6127391 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
901276314 1:7993877-7993899 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
901312245 1:8278315-8278337 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
901486068 1:9562736-9562758 GCCTCAGTCTCCAAGTAGCTGGG - Intronic
901829699 1:11884658-11884680 GCCTCAGTCTCCTAATAGCTGGG - Intergenic
902450534 1:16494112-16494134 GCCTCAAAGCACAAATGCCTCGG - Intergenic
902464948 1:16611362-16611384 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
902591540 1:17478495-17478517 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
902592125 1:17482630-17482652 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
903099269 1:21014052-21014074 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
903155854 1:21442328-21442350 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
903587857 1:24430363-24430385 GCCTCAGCCTCCAAATAGCTAGG + Intronic
903886733 1:26545282-26545304 GCCTCAGCTCCCGAATAGCTGGG + Intronic
903891067 1:26571005-26571027 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
904006979 1:27368199-27368221 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
904136162 1:28314202-28314224 GCCTCAATGCACAGACAGGTTGG - Intergenic
904639878 1:31917856-31917878 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
906068489 1:42999896-42999918 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
906231969 1:44171849-44171871 GCATCATTGCACCAATAGCGGGG + Intergenic
906308295 1:44735310-44735332 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
906379926 1:45326348-45326370 GCCTCAGTGCACAAATAGCTGGG - Intergenic
907464633 1:54626970-54626992 GCCTCAGTCTCCAAGTAGCTGGG + Intronic
907686462 1:56616558-56616580 GCCTCAGCCAACAAGTAGCTGGG - Intronic
907978506 1:59457358-59457380 GCCTCAGTTCCCAAAGTGCTGGG - Intronic
908540427 1:65116916-65116938 GTCTCAGTGCCCATATACCTAGG - Intergenic
908696978 1:66854684-66854706 GCCTCAGCTCCCGAATAGCTGGG - Intronic
908738443 1:67301996-67302018 GCCTCAGCTCTCAAGTAGCTGGG - Intergenic
908816804 1:68043360-68043382 GCTTCAGGCCACAAACAGCTGGG - Intergenic
909216202 1:72893309-72893331 GCCTCAGTCTCCAAGTAGCTGGG + Intergenic
910938869 1:92511331-92511353 GCCTCAGCTCCCAAGTAGCTGGG - Exonic
912359684 1:109084949-109084971 ACCTCAGTGCCCAAAGTGCTGGG + Intergenic
912719757 1:112010089-112010111 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
913208857 1:116567023-116567045 ACCTCAGTTTCCAAATAGCTGGG - Intronic
913586077 1:120277157-120277179 GCCTCAGAGCTCAAAAAGCTTGG + Intergenic
913622109 1:120621212-120621234 GCCTCAGAGCTCAAAAAGCTTGG - Intergenic
914086546 1:144459374-144459396 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
914311784 1:146472994-146473016 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
914361674 1:146941197-146941219 GCCTCAGTCCCCAAGTAGCTGGG + Intronic
914489950 1:148145762-148145784 GCCTCAGTCCCCAAGTAGCTGGG - Intronic
914568086 1:148889015-148889037 GCCTCAGAGCTCAAAAAGCTTGG + Intronic
914590351 1:149101270-149101292 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
914604738 1:149241233-149241255 GCCTCAGAGCTCAAAAAGCTTGG - Intergenic
915909687 1:159906580-159906602 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
916094139 1:161333517-161333539 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
918100416 1:181368113-181368135 GCCTTAGCTCACCAATAGCTGGG - Intergenic
918970945 1:191418604-191418626 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
919084083 1:192900199-192900221 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
919192681 1:194244221-194244243 GACCAAGTGCACAGATAGCTAGG + Intergenic
919735190 1:200944964-200944986 GCCTCAGCCCTCAAGTAGCTAGG + Intergenic
920090760 1:203451273-203451295 GCCTCAGTCTCCCAATAGCTGGG - Intergenic
921674010 1:217956981-217957003 GCCTCAGTCTCCAAGTAGCTGGG - Intergenic
922394436 1:225182081-225182103 ACCTCAGCTCTCAAATAGCTGGG - Intronic
922645511 1:227282071-227282093 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
923149754 1:231222241-231222263 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
923566291 1:235079143-235079165 GGCTCATTTCACAAATATCTGGG + Intergenic
924129732 1:240894523-240894545 ACCTCAGTGCACAAGTAAATTGG - Intronic
1062837151 10:643086-643108 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1064053507 10:12078494-12078516 GCCTCAGTCTCCAAGTAGCTGGG - Intronic
1064421329 10:15193415-15193437 GCCTCAGTCTCCCAATAGCTGGG + Intergenic
1064467954 10:15603992-15604014 GCCACAGTGCAAAGATAGATTGG - Intronic
1065585796 10:27216253-27216275 GCCTCAGTCTCCAAGTAGCTGGG + Intronic
1065847724 10:29760035-29760057 GCCTCAGCTCCCCAATAGCTGGG - Intergenic
1066089570 10:32004303-32004325 GCCTCAGCTCACACATAGCCTGG - Intergenic
1067777276 10:49172703-49172725 GCCTCATTGCACACAGAGCATGG + Intronic
1068234385 10:54214704-54214726 GCCTCAGCCCCCAAATAGCTGGG + Intronic
1068730529 10:60353096-60353118 ACCTCGGACCACAAATAGCTGGG + Intronic
1069524393 10:69154748-69154770 GCCTCAGCCTCCAAATAGCTGGG - Intronic
1069682900 10:70297914-70297936 GCCTCAGTCCCCTAGTAGCTGGG - Intergenic
1070726392 10:78794408-78794430 TCCTCAGGGCACCAAGAGCTGGG - Intergenic
1071572365 10:86704692-86704714 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1072376407 10:94820966-94820988 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1072526919 10:96280123-96280145 ACCTCAGTGCCCGAGTAGCTGGG + Intergenic
1072967602 10:99987616-99987638 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1073155155 10:101340601-101340623 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1073601518 10:104850467-104850489 GCCTCAGTCCCCCAGTAGCTGGG - Intronic
1074394390 10:113085553-113085575 GCCCCACTCCACAACTAGCTGGG - Intronic
1074453440 10:113577783-113577805 GCCTAAGTGCATAAGTAGATGGG - Intronic
1074575510 10:114665000-114665022 GCCTCAGCTCCCGAATAGCTGGG - Intronic
1074824233 10:117202989-117203011 GTCTCAGTCCCCAAGTAGCTGGG + Intronic
1075072173 10:119326663-119326685 GCCTTAATGCACAAACGGCTTGG - Intronic
1075072179 10:119326700-119326722 GCCTCACTGCACAGACAGCTTGG - Intronic
1075152714 10:119948863-119948885 GCCTCAGCTCCCAAGTAGCTAGG - Intergenic
1075506690 10:123029229-123029251 GCCTCAGTCTCCAAGTAGCTGGG - Intronic
1077645014 11:3915941-3915963 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1077724787 11:4663235-4663257 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1078179260 11:8996961-8996983 ACCTCAGCTCCCAAATAGCTGGG - Intronic
1078186329 11:9054848-9054870 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1078257343 11:9670010-9670032 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1078375297 11:10788377-10788399 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1079409144 11:20170760-20170782 GCCTCAGTTACCAAGTAGCTGGG + Intergenic
1080100739 11:28456554-28456576 GCCTCAGTCCCCGAGTAGCTGGG + Intergenic
1081106441 11:39075865-39075887 GCCTCAGTCCACAAGTAGCTGGG + Intergenic
1081293680 11:41358865-41358887 ACTTCTGTGCACAAATAGCAAGG - Intronic
1082285027 11:50308872-50308894 GCCTCAGTCTCCAAGTAGCTGGG + Intergenic
1082716944 11:56625602-56625624 GCCTCAGCCCCCGAATAGCTGGG - Intergenic
1082831082 11:57617811-57617833 GCCTCAGCCCGCAAGTAGCTGGG - Intergenic
1083402228 11:62431529-62431551 ACCTCAGGGCACAAAGTGCTGGG - Intergenic
1083432915 11:62623974-62623996 GCCTCAGCCCCCAAGTAGCTAGG - Intergenic
1083434853 11:62635297-62635319 GCCTCAGCCTCCAAATAGCTGGG + Intronic
1083576434 11:63795253-63795275 GCCTCGCTCCACAAGTAGCTGGG + Intergenic
1083702911 11:64491628-64491650 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
1085354077 11:75819851-75819873 GCCTCAGCCTCCAAATAGCTGGG - Intronic
1086996151 11:93358696-93358718 GCCTCAGCCTCCAAATAGCTGGG + Intronic
1089308799 11:117544389-117544411 GCCCCACAGCACAAATAGCTTGG - Intronic
1089509095 11:118984597-118984619 GCCTCAGTCCCCGAGTAGCTGGG - Intergenic
1089516720 11:119037339-119037361 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1089568679 11:119387688-119387710 GCCTCAGTCTCCAAGTAGCTGGG + Intergenic
1089576916 11:119451358-119451380 GCCTCAGTCCCCAAGTAGATAGG + Intergenic
1089768409 11:120785182-120785204 GGCTCACTGCACAAACAGCCAGG - Intronic
1090379555 11:126316768-126316790 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1090626259 11:128611462-128611484 GCATCAGTGCAAAAACTGCTGGG + Intergenic
1091565980 12:1648265-1648287 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1091922134 12:4313525-4313547 GCCTCAGCTCCCACATAGCTGGG - Intergenic
1092609334 12:10154844-10154866 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1093170149 12:15851144-15851166 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1093655052 12:21684951-21684973 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1094235509 12:28161314-28161336 GCCTCAGTCCCCGAGTAGCTGGG - Intronic
1094434717 12:30408642-30408664 GCCTCAGTCCTCTAGTAGCTGGG - Intergenic
1094624940 12:32114494-32114516 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1095430993 12:42134424-42134446 GCCTCAGTCCCCAAGTATCTAGG + Intronic
1096548771 12:52358890-52358912 CCCTCAGGGCCCAAACAGCTGGG + Intergenic
1096681946 12:53261686-53261708 GCCTCAGTCTCCAAAGAGCTGGG + Intergenic
1096705239 12:53416991-53417013 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
1097856063 12:64463582-64463604 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1097947226 12:65383773-65383795 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1098036439 12:66307844-66307866 GCCTCAGCTCCCGAATAGCTGGG + Intronic
1098072047 12:66686270-66686292 ACTTCAGTGAACAACTAGCTGGG - Intronic
1098103829 12:67048573-67048595 ACCTCAGCTCCCAAATAGCTGGG + Intergenic
1098545316 12:71705404-71705426 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1099210720 12:79784750-79784772 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1100320374 12:93485919-93485941 GCCTCAGACCCCAAGTAGCTGGG + Intronic
1100399455 12:94216013-94216035 GCCTCAGTCCCCAAACTGCTGGG - Intronic
1101139318 12:101778789-101778811 GCCTCAGCCTCCAAATAGCTGGG - Intronic
1101327213 12:103726374-103726396 GCCTCAGTTTCCAAGTAGCTGGG - Intronic
1101975424 12:109353904-109353926 GCCTCAGCCCCCAAATTGCTGGG + Intronic
1102180831 12:110911251-110911273 GCCTGAGTGGACGGATAGCTGGG + Intronic
1102193518 12:111007469-111007491 GTCTCAGTGCACAAAGAGCTTGG - Intergenic
1102239396 12:111314523-111314545 GCCTCAGCCTCCAAATAGCTGGG - Intronic
1102382621 12:112480479-112480501 GCCTCAGTGCCTGAGTAGCTGGG + Intronic
1103291972 12:119854140-119854162 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1103317819 12:120071255-120071277 GCCTCATTCCCCAAGTAGCTGGG + Intronic
1103383694 12:120514906-120514928 GCCTCAGCCTTCAAATAGCTGGG + Intronic
1103739639 12:123082550-123082572 GCCTCAGCCTCCAAATAGCTGGG + Intronic
1103757876 12:123224247-123224269 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1103800916 12:123536600-123536622 GCCTCAGCCCCCAAGTAGCTAGG + Intergenic
1103983034 12:124749116-124749138 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1105429820 13:20326447-20326469 GCCTCACTGCACAAACCTCTAGG - Intergenic
1106216680 13:27707949-27707971 GCCTCAGCTCCCGAATAGCTGGG - Intergenic
1106270115 13:28144833-28144855 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1107687290 13:42915415-42915437 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1107719255 13:43230683-43230705 GCCTCAATCCACAAATATTTAGG + Intronic
1107858440 13:44638031-44638053 GCCTCAGTTCCCAAGTAGCTGGG + Intergenic
1108035471 13:46285950-46285972 GCCTCAGCCCACAAATATCTGGG - Intergenic
1108698880 13:52926812-52926834 GCCTCAGTCCCTAAGTAGCTGGG - Intergenic
1109448061 13:62471206-62471228 GCCTCAGATCCCCAATAGCTGGG - Intergenic
1109454449 13:62566170-62566192 GCCTCAGTCCCCCAGTAGCTGGG + Intergenic
1110213313 13:72998358-72998380 GCCTCAGTGCCTGAGTAGCTGGG - Intronic
1110373100 13:74761619-74761641 GCCTCAGACCCCAAATAACTAGG - Intergenic
1110856663 13:80304212-80304234 GCCTCAGTCTCCAAGTAGCTGGG - Intergenic
1110967235 13:81714269-81714291 GCATCAGCCCACAAGTAGCTGGG + Intergenic
1112083829 13:96006507-96006529 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1112350281 13:98627392-98627414 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
1112860511 13:103824745-103824767 ACCTCAGTTCCCAAGTAGCTGGG + Intergenic
1114189784 14:20431610-20431632 GCCTCAGTCTCCAAGTAGCTGGG - Intronic
1114201639 14:20526340-20526362 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
1115087456 14:29534823-29534845 GCCTCAGTCTCCAAGTAGCTGGG + Intergenic
1115267298 14:31513872-31513894 GCCTCAATTCCCAAGTAGCTGGG + Intronic
1115562226 14:34593512-34593534 GCCTCAGCGTCCCAATAGCTGGG + Intronic
1115628194 14:35216422-35216444 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1115636992 14:35299435-35299457 GCCTCAGCACCCCAATAGCTGGG + Intronic
1115683148 14:35764658-35764680 GCCTCAGCCCCCAGATAGCTGGG + Intronic
1116024062 14:39495197-39495219 GCCTCAGTCCCCAAGTAACTGGG + Intergenic
1116834502 14:49757286-49757308 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1116888723 14:50246331-50246353 GCCTCAGCCCCCAAGTAGCTGGG + Exonic
1116956518 14:50929163-50929185 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1117403565 14:55379835-55379857 GCCTCAGCCTCCAAATAGCTGGG + Intronic
1120185550 14:81390093-81390115 GCTTCAGCCCCCAAATAGCTGGG - Intronic
1120473519 14:84957512-84957534 GCCCCAGTACACAAACACCTCGG + Intergenic
1120930314 14:89841660-89841682 GCCTCAGTGCTCACATAGTCTGG + Intronic
1121712254 14:96047431-96047453 ACCTCAGTGTAGAAAGAGCTGGG - Intronic
1122222276 14:100247494-100247516 GCCTCAGTGCCCCAAGAGCTGGG + Intronic
1122710876 14:103656887-103656909 GCATAAGAGCACAAACAGCTAGG - Intronic
1123013978 14:105364809-105364831 ACCTCAGTCCTCAAGTAGCTGGG + Intronic
1123200043 14:106654134-106654156 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1124225580 15:27890908-27890930 GCCTCAGCTTCCAAATAGCTGGG - Intronic
1125677171 15:41508440-41508462 GCCTCAGTGCTGGAGTAGCTGGG - Intronic
1126013150 15:44322250-44322272 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1126685765 15:51247585-51247607 GCCTCAGTTCCCAAGTAGCTAGG + Intronic
1126745341 15:51820321-51820343 ACCTCAATGCAATAATAGCTGGG + Intergenic
1127075181 15:55318584-55318606 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1127799046 15:62462117-62462139 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1128468040 15:67929151-67929173 GCCTCAGACCCCAAGTAGCTGGG + Intergenic
1129239025 15:74240902-74240924 GCCTCAGGGCAAAAAGACCTAGG - Intronic
1129885858 15:79036502-79036524 GCCTCAGAGCACAAACTGCTGGG - Intronic
1129926647 15:79370203-79370225 GCCTCAGCTCTCAAGTAGCTGGG + Intronic
1130865369 15:87929287-87929309 GTCTCGGTGCACAAAGTGCTGGG + Exonic
1131436621 15:92427866-92427888 GCCTCAGCCTCCAAATAGCTGGG - Intronic
1132524871 16:409284-409306 GCCTCAGTCCCCCAGTAGCTGGG + Intronic
1133189237 16:4121314-4121336 GCCTCAGTCTCCAAGTAGCTGGG + Intergenic
1133291397 16:4723943-4723965 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1134141219 16:11721187-11721209 GCCTCAGTTCCCAAAGTGCTGGG - Intronic
1134200352 16:12192815-12192837 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1134200425 16:12193352-12193374 GCCTCAGATCCCAAGTAGCTGGG - Intronic
1134289793 16:12894848-12894870 GCCTCTATGCAAAAAAAGCTGGG + Intergenic
1134447553 16:14342518-14342540 GCCTTAGGTCCCAAATAGCTGGG + Intergenic
1134672583 16:16066786-16066808 GCCTCAGTCTCCAAGTAGCTGGG - Intronic
1134790404 16:16984439-16984461 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
1134883324 16:17767358-17767380 GCCTCAGTCACCAAGTAGCTGGG + Intergenic
1135018703 16:18945881-18945903 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
1135252568 16:20913425-20913447 GCCTCAGCCTCCAAATAGCTGGG + Intronic
1135888740 16:26337891-26337913 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
1136241848 16:28949510-28949532 GCCTCAGTCTCCAAGTAGCTGGG - Intergenic
1136345974 16:29676292-29676314 GCCTCAGTGCAGAGGAAGCTGGG + Intronic
1136445996 16:30319396-30319418 GCCTCAGCCCCCAAATAGCTGGG + Intergenic
1137829016 16:51526123-51526145 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
1138127859 16:54453538-54453560 GCCTCAGTCTCCAAGTAGCTGGG - Intergenic
1138424259 16:56920116-56920138 ACCTCAGCCCCCAAATAGCTGGG - Intergenic
1139280471 16:65766099-65766121 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
1140441013 16:74987761-74987783 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1140520823 16:75579964-75579986 GCCTCAGCTCACAAAGTGCTGGG + Intergenic
1141887009 16:86899126-86899148 GCCTCTGTGCAAACATGGCTGGG - Intergenic
1142512595 17:406450-406472 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1143384455 17:6519402-6519424 GCCTCAGTCCCCCAGTAGCTGGG - Intronic
1143746414 17:8997654-8997676 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1143817840 17:9533350-9533372 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1143911636 17:10255104-10255126 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
1144103723 17:11967219-11967241 GCCTCAGTTCCCAAGTAGCTGGG + Intronic
1144823113 17:18089251-18089273 GCCTCAGCCTCCAAATAGCTGGG + Intronic
1145779941 17:27556327-27556349 GCCTCACTTCCCAAGTAGCTGGG + Intronic
1146060458 17:29602964-29602986 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1146219109 17:31002995-31003017 GCCTCAGCCTCCAAATAGCTGGG - Intergenic
1146640619 17:34538178-34538200 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
1147048372 17:37771781-37771803 GTCTCAGCCCCCAAATAGCTGGG + Intergenic
1147059710 17:37865425-37865447 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1147297413 17:39495191-39495213 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1147587670 17:41661735-41661757 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1147709459 17:42451953-42451975 GCCTCAGTCCCCAAGTAGCTTGG - Intergenic
1147875894 17:43620162-43620184 GCCTCAGTTCCCAAGTAGCTGGG + Intergenic
1147893787 17:43736973-43736995 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
1148036904 17:44670652-44670674 GCCTAAGCCCCCAAATAGCTGGG + Intronic
1148224292 17:45887702-45887724 GCCTCAGTCCACCAGTAGCTGGG + Intergenic
1148620196 17:49028920-49028942 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1149770605 17:59317951-59317973 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1149893556 17:60411207-60411229 GCCTCAGCCCCCAAATAGCTGGG - Intronic
1149971541 17:61223270-61223292 GCCTCAGCCCCCCAATAGCTGGG + Intronic
1150053465 17:61989124-61989146 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1152438559 17:80290922-80290944 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1155325771 18:24663386-24663408 GCCTCAGTCTCCCAATAGCTGGG - Intergenic
1155728531 18:29121427-29121449 ACCTCAGCCCACAAGTAGCTAGG + Intergenic
1155800715 18:30099641-30099663 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1156846026 18:41666018-41666040 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
1157860311 18:51135160-51135182 GCCTCAGCTCCCAAGTAGCTAGG - Intergenic
1158057230 18:53296126-53296148 GGGTCAGTGCACAAATAAGTAGG + Intronic
1158239850 18:55364908-55364930 GCCTCAGTTCCCAAAGTGCTGGG - Intronic
1158582068 18:58692233-58692255 GCCTCAGTGCTCATCTAGCCTGG + Intronic
1158970166 18:62658815-62658837 GCCTCAGCTCCCAAATAGCTGGG - Intergenic
1159244427 18:65786936-65786958 GCCTCAGCCCCCCAATAGCTGGG + Intronic
1159642980 18:70885588-70885610 GCCTTAGTGCCCAAGTAGCTGGG + Intergenic
1160419992 18:78737425-78737447 ACCTCAGTGCACACAGAGCTGGG + Intergenic
1161559877 19:4967016-4967038 GCCTCAGCCCCCGAATAGCTGGG + Intergenic
1162009102 19:7800788-7800810 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
1162443187 19:10705968-10705990 GCCTCAGTTCCCGAGTAGCTGGG + Intronic
1162646815 19:12056135-12056157 GCCTCAGAGAACAAATTGTTTGG - Intergenic
1163614165 19:18317002-18317024 GCCTCAGCACCCAAGTAGCTGGG - Intronic
1163653905 19:18534431-18534453 CCATCAGTGCACACTTAGCTTGG + Intronic
1164177662 19:22790564-22790586 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1164689954 19:30203410-30203432 GCCTCAGCTCTCAAGTAGCTGGG + Intergenic
1165450738 19:35880697-35880719 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1165791092 19:38492952-38492974 GCCTCAGTCTCCAAGTAGCTGGG - Intronic
1166566012 19:43766025-43766047 GCCTTAGTCCCCAAGTAGCTGGG - Intergenic
1166894227 19:46013749-46013771 GCCTCAGCCCCCAAGTAGCTAGG - Intronic
1167059881 19:47137610-47137632 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1167296273 19:48652014-48652036 GCCTCACTGCACACAGAGCCTGG + Intergenic
1167934549 19:52895693-52895715 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1168359856 19:55730337-55730359 ACCTCAGCTCCCAAATAGCTGGG - Intronic
1168725603 19:58580104-58580126 GCCTCAGCTCCCAAGTAGCTAGG + Intergenic
925153816 2:1635223-1635245 TCCTCTGTGCACAGAGAGCTGGG + Intronic
925653542 2:6118687-6118709 GCCTCAGTCCCCAAATGGCTGGG - Intergenic
926901962 2:17761114-17761136 GCCTCAGTCCCCAAGCAGCTGGG - Intronic
927776713 2:25909507-25909529 GCCTCAGTCCCCAAGTAGCTGGG - Intergenic
928122370 2:28592279-28592301 GCCTGAGTGCACAACTAGACGGG - Intronic
929680492 2:43988988-43989010 GCCTCAGCTCCCAAGTAGCTAGG + Intronic
929850668 2:45586658-45586680 GCCTCAGCCTCCAAATAGCTGGG + Intronic
929932196 2:46266853-46266875 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
930032700 2:47068261-47068283 GGCTCAGTGCACAAACAGCAGGG + Intronic
930142172 2:47963925-47963947 GCCTCAGCCCCCGAATAGCTGGG + Intergenic
930168534 2:48228487-48228509 GCCTCAGCCCGCAAGTAGCTGGG + Intergenic
930442558 2:51427387-51427409 GCCTCAGCCCCCAAATAGCTGGG + Intergenic
931244040 2:60478075-60478097 GCCTCAGCTCTCAAGTAGCTAGG + Intronic
931453677 2:62389670-62389692 GCCTCAGTCCCCCAGTAGCTAGG - Intergenic
931470381 2:62533342-62533364 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
931562872 2:63581891-63581913 TCCTCAGCTCTCAAATAGCTGGG - Intronic
931770030 2:65489391-65489413 CCCTCAGTGCTGAAAGAGCTTGG - Intergenic
931775571 2:65537460-65537482 ACCTCAGCTCCCAAATAGCTGGG - Intergenic
931953831 2:67396368-67396390 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
932346614 2:70999847-70999869 GCTTCAGTGCCCAAATTGCTGGG - Intergenic
934064086 2:88323555-88323577 GCCTCAGTCCCCAAAGTGCTGGG + Intergenic
934535297 2:95128439-95128461 GCCTCAGCTCTCAAGTAGCTGGG - Intronic
935012164 2:99145441-99145463 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
935044075 2:99463737-99463759 GCCTCAGTTCCCAAGTAGCTGGG + Intronic
935045598 2:99479210-99479232 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
935416368 2:102823445-102823467 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
936021949 2:109001843-109001865 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
936590920 2:113803357-113803379 GCCTCCGTGCACATAAACCTAGG + Intergenic
937943594 2:127310534-127310556 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
938054598 2:128204724-128204746 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
938396126 2:130949762-130949784 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
938404515 2:131022989-131023011 ACCTCAGTTCCCAAGTAGCTGGG - Intronic
940358463 2:152770806-152770828 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
940589020 2:155697182-155697204 GCCTCAGTCCCCCAGTAGCTGGG + Intergenic
940671153 2:156669805-156669827 GCATCAGCCCCCAAATAGCTGGG + Intergenic
941146301 2:161850274-161850296 GCCTCACATCACAAGTAGCTGGG - Intronic
941242317 2:163054825-163054847 GCCTCAGCTCCCAAGTAGCTAGG + Intergenic
941971535 2:171356253-171356275 GCCTCAGCTCCCGAATAGCTAGG + Intronic
943138319 2:183944323-183944345 GCCTCAGATCCCAAGTAGCTGGG + Intergenic
943900388 2:193426386-193426408 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
944089437 2:195889428-195889450 GCCTCAGCTCCCAACTAGCTAGG + Intronic
944092090 2:195922975-195922997 ACCTCAGTCCTCAAGTAGCTGGG + Intronic
944142920 2:196476326-196476348 GCCTCAGCGACCTAATAGCTGGG - Intronic
944625955 2:201569085-201569107 TCCCCAGTGCACAAATACCACGG + Intronic
944683310 2:202096437-202096459 GCCTCAGTTCACATCTAGCATGG + Intronic
944958230 2:204837533-204837555 GCCTTGGTTCCCAAATAGCTGGG + Intronic
946219524 2:218214957-218214979 GCCTCAGACCCCAACTAGCTGGG - Intergenic
946234459 2:218314803-218314825 GCCTCAGTGCCCAAGTAGCTAGG + Intronic
946250818 2:218410985-218411007 GCCTCAGTTCCTAAGTAGCTGGG - Intergenic
946287253 2:218713267-218713289 ACCTCAGCCTACAAATAGCTGGG - Intronic
947549293 2:231035092-231035114 GCCTCAGTCTACAAAGTGCTGGG + Intergenic
947560673 2:231147380-231147402 ACCTCAGCTCCCAAATAGCTGGG - Intronic
947773888 2:232692573-232692595 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
947800567 2:232927039-232927061 ACCTCATTGAACAAATAGGTGGG - Exonic
948011784 2:234654442-234654464 GCCTCAGTCCCCAAGTAGCTGGG - Intergenic
948204080 2:236152526-236152548 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
948940723 2:241195023-241195045 GCCTCTGTGTATGAATAGCTTGG + Intronic
1168788069 20:556943-556965 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1169072728 20:2743082-2743104 GCCTCTGTGCAGACATGGCTTGG + Intronic
1169114703 20:3056583-3056605 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1169592738 20:7163467-7163489 GCCTCAGTTCCCAAGTAGTTGGG + Intergenic
1169598193 20:7225661-7225683 GCCCCACTGAACAAATACCTTGG - Intergenic
1169716140 20:8620622-8620644 GCCTCAGCCCCCAAATAGCTGGG - Intronic
1170094759 20:12633758-12633780 GCCTCAGCCCTCAAGTAGCTGGG + Intergenic
1172362921 20:34326744-34326766 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1172473811 20:35222070-35222092 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1173897661 20:46563066-46563088 GCCTCAGTGCTCAGCCAGCTGGG - Intronic
1173958432 20:47052734-47052756 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1175106393 20:56618060-56618082 GCCTCAGTTCCCAAGTAGCTGGG + Intergenic
1176981370 21:15384994-15385016 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
1177214099 21:18106608-18106630 GCCTCAGCCTCCAAATAGCTGGG + Intronic
1177586840 21:23107809-23107831 GCCTCAGAACCCAAGTAGCTGGG - Intergenic
1177668978 21:24200792-24200814 GCGTCAGTCTCCAAATAGCTGGG + Intergenic
1178063651 21:28879355-28879377 GCCTCAGTCTCCAAATAGCTGGG + Intronic
1180031833 21:45215510-45215532 GCCTTAGTTCCCAAGTAGCTGGG - Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1182018787 22:27063453-27063475 GCCCCAGTGCACCAATACCATGG - Intergenic
1182399180 22:30061446-30061468 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
1182782905 22:32881938-32881960 GCCTCAGTCTCCGAATAGCTGGG - Intronic
1183140140 22:35930134-35930156 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1183570187 22:38647347-38647369 GCCTCAGCGCTCAAGTAGCTGGG - Intronic
1184185385 22:42861410-42861432 GCCTCAGTCCCCAAGTAGCTGGG - Intronic
1184203443 22:42985210-42985232 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1184426497 22:44412006-44412028 GCTTCAGTGCAGAAAGAGCCTGG + Intergenic
1184486245 22:44781636-44781658 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1185162274 22:49237109-49237131 GCCTCCCTGCACAAAAAGCGAGG + Intergenic
951287657 3:20834718-20834740 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
951439162 3:22702883-22702905 GCCACTCTGCAGAAATAGCTTGG - Intergenic
951515870 3:23558808-23558830 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
952427389 3:33189360-33189382 GCCTCAGTCCCCGAGTAGCTGGG - Intronic
952794152 3:37224117-37224139 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
952857798 3:37786476-37786498 GCCTCAGTTCCCAAGTAGCTGGG - Intronic
954173181 3:48821798-48821820 GCCTCAGTCCCCTAGTAGCTGGG - Intronic
955249274 3:57262505-57262527 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
956138144 3:66119047-66119069 GCCTCAGCGTCCAAGTAGCTGGG - Intergenic
957299600 3:78374881-78374903 GCCTGAGTGAACAAATATCAGGG - Intergenic
958962196 3:100521367-100521389 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
958965722 3:100556094-100556116 GCCTCAGCTCCCAAGTAGCTAGG + Intronic
960041647 3:113155837-113155859 GCCTCAGACCACAGGTAGCTGGG - Intergenic
960097121 3:113699240-113699262 CCCTGAGTGCATAAAGAGCTGGG + Intergenic
961196761 3:125008680-125008702 GCCTCAGCCTCCAAATAGCTGGG - Intronic
961318283 3:126055397-126055419 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
961398117 3:126612151-126612173 GCCTCAGTCCCCAAGTAGCTGGG + Intronic
961955195 3:130794264-130794286 GCCTCAGACCCCAAGTAGCTGGG - Intergenic
961983806 3:131110323-131110345 GTGTCAGTGCACACTTAGCTAGG + Intronic
962551233 3:136494154-136494176 GCCTCAGCTCCCAAGTAGCTAGG - Intronic
962721752 3:138182606-138182628 GCCTCAGCCCCCACATAGCTGGG + Intergenic
963170934 3:142250607-142250629 GCCTCAGTCCTCCAGTAGCTGGG - Intergenic
963516348 3:146314001-146314023 GCTTCAGCTCACAAGTAGCTGGG - Intergenic
963867286 3:150376370-150376392 GCTTTAGTGGACAAATAGCTGGG - Intergenic
965107342 3:164373591-164373613 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
965385888 3:168045993-168046015 GCCTCAGCTCTCAAGTAGCTGGG + Intronic
965801986 3:172504103-172504125 GCCTCAGCTCCCCAATAGCTGGG - Intergenic
965995351 3:174874996-174875018 ACCTCAGCCCCCAAATAGCTGGG - Intronic
966428835 3:179810126-179810148 GCCTCAGCGTCCGAATAGCTGGG + Intronic
966716740 3:183020514-183020536 GCCTCAGTTCCCAAGTAGCTGGG - Intronic
966854496 3:184184792-184184814 GCCTCAGCCCCCGAATAGCTGGG - Intronic
966994240 3:185264592-185264614 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
966996407 3:185284598-185284620 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
967587567 3:191233875-191233897 GCCTCAGCCCCCAAGTAGCTAGG - Intronic
968133334 3:196205773-196205795 GCCTCAGCCTCCAAATAGCTGGG + Intronic
968337148 3:197923613-197923635 GCCTCAGCCCCCAGATAGCTGGG - Intronic
968418732 4:464352-464374 GCCTCAGCCCCCAAGTAGCTAGG - Intronic
968869016 4:3231930-3231952 GCATGAGTGCACAAAGAGCTGGG - Intronic
969419959 4:7087917-7087939 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
969930484 4:10626162-10626184 GCCTCAGTCCCCATAGAGCTGGG + Intronic
969967427 4:11011645-11011667 GCCTCAGCCTCCAAATAGCTGGG - Intergenic
971150019 4:24021834-24021856 GTCTCAGTTCACCTATAGCTGGG + Intergenic
971345586 4:25809256-25809278 GCCTCAGTTCCCGAGTAGCTGGG + Intronic
972252456 4:37318138-37318160 GCCTCAGCCTCCAAATAGCTGGG + Intronic
972435487 4:39030099-39030121 GCCTCAGTCCCCAAGCAGCTGGG - Intronic
972517161 4:39819232-39819254 ACCTCAGGGCACAAGGAGCTGGG - Intergenic
972909829 4:43800763-43800785 GCCCCAGTGCAATAATATCTGGG + Intergenic
973091050 4:46137090-46137112 GCCTCAGTCTCCAAGTAGCTGGG + Intergenic
973219513 4:47709406-47709428 ACCTCAGTCCCCAAGTAGCTGGG + Intronic
973761340 4:54118722-54118744 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
974012577 4:56620499-56620521 GCCTCACTGCCCGAGTAGCTGGG + Intergenic
974937974 4:68430862-68430884 GCCTCAGCCCCCAAGTAGCTAGG - Intergenic
975535142 4:75442245-75442267 ACCTCAGTCCCCAAGTAGCTGGG - Intergenic
976223737 4:82778979-82779001 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
976630006 4:87226445-87226467 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
976669313 4:87634726-87634748 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
976881005 4:89925249-89925271 GCCTCAGTGCCCAAGCAGCTGGG + Intronic
977233773 4:94482283-94482305 GCCTCAGTGCCCAAAATGTTGGG + Intronic
977237417 4:94525301-94525323 GCCTCAGCCCCCAAGTAGCTAGG - Intronic
978814962 4:112893743-112893765 GCCTCAGCTCCCAAAGAGCTGGG - Intronic
979814757 4:125087117-125087139 GCCTCAGCCCTCAAGTAGCTGGG + Intergenic
980876652 4:138668404-138668426 AGCTAAGTACACAAATAGCTTGG + Intergenic
980985250 4:139688990-139689012 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
981091332 4:140735594-140735616 GCCTCAGTCCACAGGTAGCTGGG - Intronic
981699254 4:147590757-147590779 GCCTCAGTTCCCGAGTAGCTGGG + Intergenic
981818195 4:148855421-148855443 GCCTCAGCCCCCAAGTAGCTTGG + Intergenic
982086548 4:151841810-151841832 GCCTCAGAGCATAAAGAGCCTGG + Intergenic
982121861 4:152150673-152150695 TCTTCAGTAAACAAATAGCTTGG - Intergenic
983200515 4:164855889-164855911 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
983355342 4:166649603-166649625 GCCTCAGTTCCCAAGTAGCTGGG - Intergenic
984246186 4:177277777-177277799 GCCTCAGCCTCCAAATAGCTAGG + Intergenic
984898276 4:184561538-184561560 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
985248626 4:188000879-188000901 GCCTCAGGCCCCAAGTAGCTGGG - Intronic
986948911 5:13058328-13058350 GCCTCAGTTCCCAAAGTGCTGGG - Intergenic
987095278 5:14543999-14544021 GCCTCAGTTTTCAAATAGTTGGG - Intergenic
987239980 5:15986138-15986160 CCCTCAGTGCCCAAATATTTAGG - Intergenic
988114328 5:26865456-26865478 TCCTCAGGGCACAAAGAGCATGG + Intergenic
988581276 5:32470983-32471005 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
988589365 5:32535530-32535552 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
991962537 5:72059640-72059662 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
992148875 5:73880815-73880837 ACCTCAGCCCACAAATAGCTGGG - Intronic
992834319 5:80624793-80624815 GCCTCAGCCCCCAATTAGCTGGG - Intergenic
993180970 5:84551138-84551160 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
996268874 5:121578347-121578369 GCCTCAGTCATCAAGTAGCTGGG - Intergenic
997164339 5:131642753-131642775 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
998030803 5:138866058-138866080 GCCTCAGCCCACAAAGAGTTGGG - Intronic
998651306 5:144124422-144124444 GCCCCAGAGTAGAAATAGCTAGG - Intergenic
1000093434 5:157950061-157950083 GTCACAGTGCACAAGTACCTTGG + Intergenic
1000882241 5:166711749-166711771 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1001238288 5:170048274-170048296 GTCTCAGGCCCCAAATAGCTGGG - Intronic
1001501724 5:172241901-172241923 ACCTCAGTCCGCAAGTAGCTGGG - Intronic
1004156377 6:13171879-13171901 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1004156567 6:13173821-13173843 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1004859909 6:19793172-19793194 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
1004932007 6:20471464-20471486 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1005830024 6:29663155-29663177 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1005876691 6:30015957-30015979 GCCTGAGTGTACACATATCTGGG - Intergenic
1006322260 6:33326707-33326729 GCCTCAGCTCCCAAATAGCTGGG - Intronic
1006480670 6:34291072-34291094 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1006912619 6:37573300-37573322 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1007057352 6:38900730-38900752 GCCTCAGCTCACGAGTAGCTGGG + Intronic
1007156572 6:39751187-39751209 GCCTCAGGTCCCTAATAGCTGGG + Intergenic
1007546893 6:42701237-42701259 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1007598796 6:43068694-43068716 GCCTCAGTCTCCAAATAGTTGGG - Intronic
1007605989 6:43118419-43118441 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1008469355 6:51865885-51865907 GCCACTGAGCACAAATAGCTAGG + Intronic
1008587907 6:52965755-52965777 GCCTCAGCCTACAAGTAGCTGGG + Intergenic
1010430379 6:75771115-75771137 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1011246831 6:85328464-85328486 GCCTCAGCCTCCAAATAGCTGGG - Intergenic
1012457174 6:99420130-99420152 GCCTCAGTCCCCAAAGTGCTGGG + Intronic
1012471901 6:99581803-99581825 GCCTCAATTCCCAAGTAGCTGGG + Intergenic
1012668367 6:102008187-102008209 GCTTCAGTGTACAAATAGAAAGG + Intronic
1013135544 6:107279102-107279124 GCCTCAGTCTCCAAATAGCTGGG - Intronic
1014054889 6:117002399-117002421 GCCTCAGTCTCCCAATAGCTGGG + Intergenic
1014149341 6:118035802-118035824 GCCTCAGCCCCCACATAGCTGGG + Intronic
1014737533 6:125112049-125112071 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
1015104233 6:129517831-129517853 GCCTCACTCCCCAAGTAGCTGGG + Intergenic
1015501971 6:133944085-133944107 GCCTCAGTCTCCAAGTAGCTAGG + Intergenic
1015523612 6:134155026-134155048 GCCTCAGCCCCCAAAGAGCTGGG - Intergenic
1015537455 6:134280951-134280973 GCCTCAGCCCTCAAGTAGCTGGG - Intronic
1015538954 6:134295586-134295608 GCCTCAGTCCCCCAGTAGCTGGG - Intronic
1015554410 6:134445946-134445968 GCCTTAGTTCCCAAGTAGCTGGG + Intergenic
1015738191 6:136423909-136423931 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1015777575 6:136829820-136829842 GCCTCAGCCACCAAATAGCTGGG - Intronic
1016388414 6:143550921-143550943 GCCTCAGTTCCCAAGTAGCTGGG - Intronic
1016833787 6:148456744-148456766 TCCTCAGCCCCCAAATAGCTGGG - Intronic
1016906946 6:149160130-149160152 ACCTCAGCCCACAAGTAGCTGGG - Intergenic
1016963313 6:149693973-149693995 GCCCCAGCCCACAAGTAGCTGGG - Intronic
1017315397 6:153025196-153025218 GCCTCAACTCCCAAATAGCTGGG - Intronic
1017451720 6:154560290-154560312 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1020425100 7:8056181-8056203 GCCTCAGTCTCCGAATAGCTGGG - Intronic
1020744422 7:12064234-12064256 ATCTCAGTGCTCAAGTAGCTTGG + Intergenic
1020778843 7:12493085-12493107 ACCTCAGTCCCCAAGTAGCTGGG - Intergenic
1021273548 7:18622436-18622458 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1021596800 7:22325678-22325700 ACCTCAGACCACAAGTAGCTGGG + Intronic
1022114250 7:27248644-27248666 ACCTCAGGGCACAATTTGCTTGG - Intergenic
1022699945 7:32750323-32750345 GCCTCAGCCTCCAAATAGCTGGG - Intergenic
1023379585 7:39593573-39593595 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1024437148 7:49371133-49371155 GCCTCAGCTAACAAATAGCCTGG - Intergenic
1025043136 7:55665705-55665727 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1025920572 7:65908296-65908318 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1026536072 7:71239355-71239377 GCCTCAGTCCCCAGGTAGCTGGG - Intronic
1026826087 7:73582542-73582564 GCCTCAGCTCCCAAGTAGCTAGG + Intergenic
1027506876 7:79026756-79026778 GCCTCAGCCCCCAAATAGCTGGG - Intronic
1030000850 7:105060108-105060130 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1030044714 7:105484701-105484723 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1030439256 7:109565819-109565841 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
1030770073 7:113463688-113463710 GCCTCAGCCACCAAATAGCTAGG + Intergenic
1031631855 7:124053231-124053253 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
1032952100 7:136926120-136926142 GCCTCAGCCCCCAGATAGCTGGG - Intronic
1033421796 7:141210346-141210368 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1034140520 7:148811264-148811286 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1034158019 7:148971587-148971609 ACCTCAGCTAACAAATAGCTGGG + Intergenic
1035435094 7:158853767-158853789 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1036382087 8:8242537-8242559 GCCTCAGTGCCTAAAGTGCTAGG + Intergenic
1036461151 8:8953982-8954004 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1036811590 8:11870576-11870598 GCCTCAGCGCTCGAGTAGCTGGG - Intergenic
1037068424 8:14612799-14612821 GCCTCACTGCTCAAGTTGCTGGG + Intronic
1038619285 8:29124766-29124788 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1038920249 8:32075786-32075808 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1039597026 8:38799264-38799286 GCATCACTGAACAATTAGCTAGG + Intronic
1039774162 8:40719325-40719347 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1040987095 8:53307653-53307675 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1041614663 8:59892534-59892556 GCCTCAGCCTCCAAATAGCTGGG + Intergenic
1041676198 8:60542397-60542419 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1042314483 8:67411265-67411287 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
1043406185 8:79936210-79936232 ACCTCAGCTCACAAGTAGCTGGG - Intronic
1044244605 8:89928134-89928156 GCCTCACTTCCCAAGTAGCTGGG - Intergenic
1044447225 8:92293201-92293223 GCCTCAGCCCCCAAGTAGCTAGG + Intergenic
1044554209 8:93544446-93544468 GCCTCAGCTTCCAAATAGCTAGG + Intergenic
1045871653 8:106934333-106934355 GCCTCAGGGCACAGAGAGATAGG + Intergenic
1046218107 8:111176113-111176135 GCCTCAGCCTCCAAATAGCTGGG - Intergenic
1046830029 8:118734965-118734987 GGCTTAGAACACAAATAGCTTGG - Intergenic
1047344276 8:124011733-124011755 GCCTCAGCCCCCAAATTGCTGGG + Intronic
1047371233 8:124257687-124257709 GCCTCAGCACCCAAGTAGCTGGG - Intergenic
1048486489 8:134852530-134852552 ACCTCAGTCCCCAAGTAGCTGGG - Intergenic
1050494689 9:6228737-6228759 GCCTCAGTCTTCAAGTAGCTAGG - Intronic
1051143899 9:14006924-14006946 GCCTCAGTCCACAAAAGACTTGG + Intergenic
1051400640 9:16678381-16678403 GCCTCAGCCTCCAAATAGCTGGG + Intronic
1051627651 9:19113687-19113709 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1052958039 9:34270104-34270126 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1054758595 9:68983938-68983960 GCCTCAGCCCCCAAGTAGCTGGG - Intronic
1055018463 9:71644305-71644327 GCCTCAGTCCACAAATAGCTGGG - Intergenic
1056355462 9:85797357-85797379 GCCTCAGTTCCCAAAATGCTGGG + Intergenic
1057767392 9:97934230-97934252 GCCTCAGCTCCCAAGTAGCTGGG - Intronic
1058025594 9:100139755-100139777 GCCTCAGCCCCCAAGTAGCTGGG + Intronic
1058203715 9:102075047-102075069 GCCTCAGTCCCCGAGTAGCTAGG - Intergenic
1058900041 9:109434256-109434278 GCCTCAGTTCCCAAGTAGCTGGG + Intronic
1058900065 9:109434421-109434443 GCCTCAGTTCCCAAGTAGCTGGG + Intronic
1059873589 9:118605764-118605786 GCCTCAGTCCCCAAGTAGCTGGG - Intergenic
1059967792 9:119632984-119633006 GCCTCAGTCTCCCAATAGCTGGG - Intergenic
1060397834 9:123328444-123328466 GCCTCAGCACCCAAGTAGCTGGG - Intergenic
1060409482 9:123390647-123390669 GCCCCAGTGCACAGCTAGCCTGG - Intronic
1061197764 9:129117160-129117182 GCCTCAGCCCCCGAATAGCTAGG + Intronic
1061668879 9:132177100-132177122 GCCTCAGCTCCCAAGTAGCTGGG + Intronic
1062447386 9:136600800-136600822 TCCTCAGTGCACACATTCCTTGG - Intergenic
1062447431 9:136601292-136601314 TCCTCAGTGCACACATTCCTCGG - Intergenic
1185703617 X:2250045-2250067 GCCTCAGCACCCAAGTAGCTGGG - Intronic
1185752449 X:2624534-2624556 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
1185801039 X:3011362-3011384 GCCTCAGTTCCTGAATAGCTGGG + Intronic
1186188244 X:7042761-7042783 GCCTCACTGCAGAAATGGCATGG - Intergenic
1187121450 X:16410986-16411008 GCCTCAGCTCCCAAGTAGCTGGG - Intergenic
1187167350 X:16816426-16816448 GCCTTAGCCCCCAAATAGCTAGG + Intronic
1187906955 X:24075817-24075839 GCCTCAGTGTCTAAGTAGCTAGG + Intronic
1188846042 X:35073663-35073685 GCCTCAATACAATAATAGCTGGG - Intergenic
1189508130 X:41633872-41633894 GCCTCAGGCCCCCAATAGCTGGG + Intronic
1189761886 X:44330139-44330161 GCCTCAGCCCCCCAATAGCTGGG - Intronic
1190724487 X:53179520-53179542 GCCTCAGCCCTCAAGTAGCTGGG - Intergenic
1191215336 X:57927450-57927472 GCCTCAGCCCCCAAGTAGCTGGG + Intergenic
1192456556 X:71281266-71281288 GCCTCAGTTCCCGAGTAGCTGGG - Intergenic
1192889761 X:75377379-75377401 GCCTCAGAACCCAAGTAGCTGGG - Intronic
1194504346 X:94714305-94714327 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1196065818 X:111463161-111463183 GCCTCAGCGCCCAAGTAGCTGGG - Intergenic
1196623226 X:117848043-117848065 GCCTCAGCTCCCAAGTAGCTGGG + Intergenic
1196909630 X:120472491-120472513 GCCTCAGCCCCCAAGTAGCTGGG - Intergenic
1197182834 X:123554545-123554567 GCCTCATTGAACAAATAATTTGG + Intergenic
1198368540 X:135968644-135968666 GCCTCAGCCCCCAAGTAGCTAGG + Intronic
1198783640 X:140263558-140263580 GCCTCAGTCTCCAAGTAGCTGGG + Intergenic
1199857810 X:151774573-151774595 GCCTCATGGTCCAAATAGCTTGG - Intergenic
1200166547 X:154039499-154039521 GCCTCAGTCCCCGAGTAGCTGGG - Intronic
1200301878 X:154984604-154984626 ACTTCAGTTCACAAACAGCTCGG - Intronic
1200313921 X:155110836-155110858 TCCAGAGTTCACAAATAGCTAGG - Intronic
1200351968 X:155506596-155506618 TCCTCAGTGACCAAACAGCTAGG - Intronic