ID: 906380992

View in Genome Browser
Species Human (GRCh38)
Location 1:45332093-45332115
Sequence GGCACAGGGTTGAGTGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906380982_906380992 24 Left 906380982 1:45332046-45332068 CCCGACAGGCTCCCTGAGGCTAA 0: 1
1: 0
2: 2
3: 14
4: 146
Right 906380992 1:45332093-45332115 GGCACAGGGTTGAGTGTCATAGG 0: 1
1: 0
2: 1
3: 9
4: 138
906380987_906380992 -7 Left 906380987 1:45332077-45332099 CCTGCTCCACCTGAGAGGCACAG 0: 1
1: 0
2: 2
3: 21
4: 246
Right 906380992 1:45332093-45332115 GGCACAGGGTTGAGTGTCATAGG 0: 1
1: 0
2: 1
3: 9
4: 138
906380984_906380992 13 Left 906380984 1:45332057-45332079 CCCTGAGGCTAAGAGCTGTTCCT 0: 1
1: 0
2: 3
3: 22
4: 174
Right 906380992 1:45332093-45332115 GGCACAGGGTTGAGTGTCATAGG 0: 1
1: 0
2: 1
3: 9
4: 138
906380983_906380992 23 Left 906380983 1:45332047-45332069 CCGACAGGCTCCCTGAGGCTAAG 0: 1
1: 0
2: 1
3: 22
4: 201
Right 906380992 1:45332093-45332115 GGCACAGGGTTGAGTGTCATAGG 0: 1
1: 0
2: 1
3: 9
4: 138
906380985_906380992 12 Left 906380985 1:45332058-45332080 CCTGAGGCTAAGAGCTGTTCCTG 0: 1
1: 0
2: 1
3: 20
4: 157
Right 906380992 1:45332093-45332115 GGCACAGGGTTGAGTGTCATAGG 0: 1
1: 0
2: 1
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906380992 Original CRISPR GGCACAGGGTTGAGTGTCAT AGG Intronic
901278411 1:8011186-8011208 GGCACAGGGCTAGGTGACATGGG + Intronic
904273944 1:29368147-29368169 GGAATAGGGTTGAGTGTGAGTGG - Intergenic
904805963 1:33132746-33132768 GGCACGCACTTGAGTGTCATTGG + Intergenic
905559986 1:38918925-38918947 GGCACCGGGGTAAGTGGCATGGG - Intronic
905927353 1:41760899-41760921 GGGACATGTTTGAGGGTCATGGG - Intronic
906380992 1:45332093-45332115 GGCACAGGGTTGAGTGTCATAGG + Intronic
909842728 1:80349171-80349193 GTCACAGGGATGAGTGGCAGTGG + Intergenic
913236022 1:116784194-116784216 GGCACAGGGTTGTATGTGCTGGG + Intergenic
916079589 1:161224102-161224124 GGGACAGGGTTGAGGGCTATGGG + Intergenic
923312266 1:232746624-232746646 GGCACAGGGATGACTGTACTTGG + Intergenic
924679637 1:246219229-246219251 GGCACAGGGTGGGGTGGGATAGG - Intronic
1063738113 10:8785229-8785251 GGCTAAGGGCTGAGTGTCAATGG + Intergenic
1068086887 10:52384464-52384486 AGCACAGGTTTGAGTGACAGGGG - Intergenic
1070414532 10:76177104-76177126 GGAACAGGGCTGCGTATCATTGG + Intronic
1073887241 10:108053855-108053877 AGCACAGTTTTGAGAGTCATAGG - Intergenic
1075120812 10:119663244-119663266 GGCACAGGGTTGGGGGTTAGAGG + Intronic
1077008947 11:371526-371548 GGCCCTGGATTGAGTGTCCTTGG - Intronic
1077110098 11:858526-858548 GGAACCGGGGTGAGTGTCAGCGG - Intronic
1077341985 11:2030331-2030353 GGCACAGTGTGGAGTGGCAGGGG - Intergenic
1083540565 11:63509069-63509091 GACACAATGTTGAGTGGCATTGG + Intronic
1084107273 11:66988349-66988371 CCCAGAGGGTAGAGTGTCATGGG - Intergenic
1084688695 11:70712222-70712244 GGCATAGGGCTGAGAGTCAGAGG - Intronic
1085404469 11:76253858-76253880 GACACAGGGTAGAATGCCATGGG - Intergenic
1089958349 11:122593515-122593537 GGTAAAGGGTTTATTGTCATAGG + Intergenic
1090458574 11:126870154-126870176 GGCACAGGGTCGTATGTCCTGGG + Intronic
1202824971 11_KI270721v1_random:85520-85542 GGCACAGTGTGGAGTGGCAGGGG - Intergenic
1092989799 12:13885586-13885608 AGCACTGGGTTGAGTGACAGAGG - Intronic
1093414702 12:18906965-18906987 GGCTCAGGGTGGAGGGTCAGAGG - Intergenic
1096787098 12:54023235-54023257 GGCTCAGGGCTGAGCGTGATGGG + Intronic
1097009295 12:55940980-55941002 GGTACAGGGCTGAGAGTCTTGGG + Exonic
1099869030 12:88322755-88322777 GTCACAGGGTTTTGTATCATGGG + Intergenic
1101406397 12:104432952-104432974 GACACAGGGTTGGGTGTCATTGG + Intergenic
1102075920 12:110060183-110060205 TGCACAGGCTGGAGTGTAATGGG - Intronic
1102254622 12:111408415-111408437 GGCCCAGGTTTGAGAGGCATGGG - Intronic
1103139501 12:118536228-118536250 TGCAGAGGCTTGAGGGTCATGGG + Intergenic
1108914947 13:55596525-55596547 GGCACAAGGTTCACTGTCCTAGG + Intergenic
1110851768 13:80254262-80254284 AGCACAGGGTTGTGTGACAATGG - Intergenic
1111095424 13:83507707-83507729 GACACAGGAGTGAGTATCATGGG + Intergenic
1113054278 13:106251354-106251376 GGAACAGGGGTGAGTGTGAAGGG + Intergenic
1117287994 14:54306085-54306107 AGCACAGGGTTTAGTGGCTTTGG + Intergenic
1118637506 14:67761260-67761282 AACACAGGGTTAAGTGTCAGGGG + Intronic
1119572172 14:75684566-75684588 TTCACAGAGTTGAGCGTCATTGG + Intronic
1121750130 14:96346819-96346841 GACACAGGATTGAGTGTCAGGGG - Intronic
1122728981 14:103780951-103780973 GGCAGAGGGTAGAGTGTTACAGG + Intronic
1124070482 15:26388377-26388399 GGCACAGGGCAGGGTGCCATTGG - Intergenic
1125741289 15:41966547-41966569 GTCTCAGGCTTGAGTCTCATTGG - Intronic
1128328553 15:66741068-66741090 GGCAGAGGGATGAGGGCCATTGG - Intronic
1128780816 15:70357551-70357573 AGCCCAGGGTTGGGTGGCATGGG - Intergenic
1137728181 16:50670859-50670881 GGGGCAGCATTGAGTGTCATCGG + Intronic
1138277626 16:55747483-55747505 ATGACAGGGTTGAATGTCATTGG + Intergenic
1138308429 16:56001565-56001587 ATCAGAGGGTTGAATGTCATGGG + Intergenic
1140346966 16:74222673-74222695 AGCACAGGTTTCAGTGTCAGGGG - Intergenic
1140729091 16:77839933-77839955 GGCATAGAGTTGAGAGTCTTTGG + Intronic
1144208897 17:12998581-12998603 TGCAATGGTTTGAGTGTCATTGG + Intronic
1150281099 17:63930073-63930095 GGCACAGAGCTGCGAGTCATGGG - Exonic
1153543163 18:6178936-6178958 GACACAGGGCTAAGTGCCATGGG - Intronic
1154301791 18:13200549-13200571 GGCACAGGTTTGGGTGTACTTGG + Intergenic
1154325609 18:13388658-13388680 GGCTCAGGCTTGATTGGCATGGG + Intronic
1156171848 18:34494386-34494408 GGCACGGGGGTGAGTGTCTTCGG + Intronic
1157427432 18:47595820-47595842 GGGACTTGGTTGAGTGTCAAGGG + Intergenic
1157442135 18:47719338-47719360 AGCACAGGGTGGTGTCTCATTGG - Intergenic
1161031983 19:2061769-2061791 GGCTCAGGGTTGGGGGTCAGTGG + Intergenic
1163258124 19:16170157-16170179 GGCCCAGGGCTGAGTGTTCTTGG - Intronic
1163399750 19:17085109-17085131 GGCACAGGGATGAGCTTCAAGGG + Intronic
1164239225 19:23369239-23369261 GGCAGAGGTTGGAGTGTGATAGG + Intronic
1165417585 19:35704323-35704345 GGCAGAGCCTTGAGTCTCATTGG - Intergenic
1166217124 19:41343079-41343101 GGCACTGGGAGGAGTGTCCTGGG - Intronic
1166929809 19:46295759-46295781 GTCTCAGGGTTGATTCTCATTGG + Intergenic
925357932 2:3255552-3255574 GCCACATGGGTGTGTGTCATGGG - Intronic
929924959 2:46200416-46200438 AGCAGAGGGTTGGGTGTCATGGG + Intergenic
930664924 2:54092467-54092489 GGAACAGGGTTGGGTGACAAAGG + Intronic
932150245 2:69364518-69364540 GTCATAAGGTTGTGTGTCATTGG - Intronic
934646024 2:96059887-96059909 GGCTCAGGCCTGAGTGGCATGGG - Intergenic
934839428 2:97615977-97615999 GGCTCAGGCCTGAGTGGCATGGG - Intergenic
935931256 2:108128565-108128587 GGGACAGGGTTAAGTATCATGGG - Intergenic
940789863 2:158020652-158020674 GGCACAGGGCTGAGGTTCACAGG + Intronic
940896035 2:159082281-159082303 GGTACAGGGTTGGGTGGCAGTGG - Intronic
941863083 2:170305597-170305619 GGCACAGGGAAAAGTGTCCTGGG - Intronic
943847979 2:192676071-192676093 CGCACATGGTTAAATGTCATCGG + Intergenic
943952415 2:194147353-194147375 GGCACAGGAATGGCTGTCATGGG - Intergenic
944069697 2:195655212-195655234 GGCACAGGGGTGAGAAGCATGGG + Intronic
945026773 2:205627065-205627087 GGCACAGGGTTGAGGCACATTGG - Intergenic
946393695 2:219432250-219432272 GGCACAGTGTTGGGTGGCTTTGG + Intergenic
1168736913 20:148287-148309 GTAACAGAGTTGAGGGTCATGGG + Intergenic
1169849888 20:10036837-10036859 GGCTGAGGGTCGAGGGTCATGGG + Intronic
1170648724 20:18219797-18219819 GGCCCAGGCTGGAGTGTGATGGG - Intergenic
1170844988 20:19954710-19954732 GGCACAGGGGTGAGGGACACAGG - Intronic
1172249077 20:33466132-33466154 TGCACAGGGGTGAGTTTCACTGG - Intergenic
1172449329 20:35010619-35010641 GGGCCAGGCTTGAGTGTGATTGG - Intronic
1175722275 20:61294482-61294504 GGCATAGGGTGGAGGGTGATGGG - Intronic
1178631418 21:34264512-34264534 GCCCCCAGGTTGAGTGTCATGGG + Intergenic
1179094488 21:38300012-38300034 AGCACATGGTAGAATGTCATGGG - Exonic
1181527817 22:23500230-23500252 GGCACAGGGGAGAATGCCATGGG + Intergenic
1182319172 22:29467214-29467236 AGGACAGGGTTGAGTGGCATAGG - Intergenic
1182552328 22:31107061-31107083 GGGACAGGATTGGGAGTCATAGG + Intronic
1183105245 22:35610758-35610780 GGCACAGAGAAGAGTGGCATAGG + Intronic
1184554750 22:45227101-45227123 GGCACAAGGGTGGGTGGCATTGG - Intronic
951552369 3:23886740-23886762 GGCAGAGGGTTAAATGTCAGGGG - Intronic
955192190 3:56771743-56771765 GGCAGAGGGTGGACTGTCCTGGG + Intronic
956769198 3:72510162-72510184 GGCACAGGGCTGAGTGCCGGAGG - Intergenic
958695699 3:97525689-97525711 GGCTCATGATTGAGTGGCATTGG + Intronic
959602336 3:108201512-108201534 GCCACATGTTTGAGTGTGATGGG - Intronic
964682268 3:159355337-159355359 TGCATTGGGATGAGTGTCATTGG - Intronic
969241091 4:5898213-5898235 GGAAGAGGCATGAGTGTCATTGG - Intronic
969613649 4:8240331-8240353 GGCACAGTGTTGAGTGACCCAGG - Intronic
969848917 4:9941772-9941794 GGCACTGGGCTGGGTATCATAGG - Intronic
971244718 4:24917420-24917442 GGCACAGGCTTGAGCGTGATTGG + Intronic
973024139 4:45245818-45245840 GGCACAGTGTTGTGTGTGGTGGG + Intergenic
973972230 4:56224944-56224966 TGGAGAGGGTTGAGTGTCAGAGG + Intronic
977535608 4:98253407-98253429 AACACAAGGTTGAATGTCATGGG - Intergenic
977585759 4:98773825-98773847 GTCACAGGGTTGTCTGGCATTGG + Intergenic
986169136 5:5301697-5301719 GGCACAGGATGGAGGGTCAAAGG + Intronic
995272987 5:110243831-110243853 TGCACAGTGTTGAGTGACCTAGG + Intergenic
995760870 5:115560473-115560495 TGTACAAGGTTGAGAGTCATTGG - Intergenic
997384552 5:133462437-133462459 GCCACAGAGTTGAGTGTTAATGG - Intronic
999275797 5:150329303-150329325 GGCATGGTGTTCAGTGTCATGGG - Intronic
1002595303 5:180318187-180318209 GACAGAGGGTTGAGTGTGGTGGG + Intronic
1002629581 5:180562142-180562164 GGCACAGGGATGAGTTCCCTGGG - Intronic
1003071431 6:2948235-2948257 GGCACACTGTGGAGTGTCAGGGG + Exonic
1004484332 6:16051632-16051654 GGCACAGCGGTGAGTATCACAGG - Intergenic
1010916994 6:81632373-81632395 TGCACAGGGTTGATTCTCAAGGG - Intronic
1011632952 6:89345208-89345230 GGCACAGGTTGGAATGTTATGGG + Intronic
1015939200 6:138431748-138431770 GGCACAGGGGTGAGTGCTGTGGG + Exonic
1029035216 7:97512879-97512901 GCCACAGGGTTGAGAGTTCTAGG + Intergenic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1033183639 7:139205012-139205034 GGAAGAGGGTTTAGTGGCATAGG + Intergenic
1033271360 7:139935779-139935801 GGCACAGGGTTTTGTGTGACTGG - Intronic
1034585112 7:152084091-152084113 GGCACAGAGAAGAGTGTCAGAGG - Intronic
1037769760 8:21791446-21791468 GGCAGAGGGTGGGGTGTCATGGG - Intronic
1038155586 8:24986419-24986441 GGCAAAGAATTGAGTGTGATAGG - Intergenic
1042916145 8:73878232-73878254 GGCACAGGATTAAGAGTCAAAGG + Intronic
1044426355 8:92055480-92055502 TGCTCAGGCTGGAGTGTCATGGG + Intronic
1045128461 8:99121262-99121284 GCCACAGGGATGGGTGTCATGGG + Exonic
1046599978 8:116304917-116304939 GGCATAGTGTTGAGTGTTCTTGG - Intergenic
1049045988 8:140151834-140151856 GGTAAAGATTTGAGTGTCATTGG - Intronic
1049421680 8:142519401-142519423 GGCACAGGGCTGAGCCTCAGGGG - Intronic
1050467024 9:5937611-5937633 AGCACAGAGTTGAGTTTCAGAGG - Intronic
1055146336 9:72939094-72939116 GGCACAGGTTATAGTGTCAGAGG + Intronic
1058604494 9:106706282-106706304 GTCACATGTTTGAGAGTCATGGG - Intergenic
1058752490 9:108052730-108052752 TGCACAGGGTTGGGGATCATTGG + Intergenic
1060395837 9:123315754-123315776 GTCACAGGGCTGACTGTCTTTGG - Intergenic
1062289303 9:135787393-135787415 GGCTCAGGGGTGGGTGTCACTGG - Intronic
1062437483 9:136552967-136552989 TGCCCAGGCTGGAGTGTCATGGG + Intergenic
1062619558 9:137413777-137413799 GGCACATGGTTGGTTGTCTTTGG - Intronic
1189466334 X:41280467-41280489 GGCACAATGTTTGGTGTCATTGG - Intergenic
1193036573 X:76957790-76957812 GGCACAGGGTTGGGGGGCACTGG + Intergenic
1195736357 X:108016839-108016861 GGCACAGGCTTTAGAGTCAGAGG + Intergenic
1195736744 X:108019525-108019547 GGCAGAGAGTTGAGGGGCATGGG + Intergenic
1199886065 X:152023030-152023052 TGCACAGGGATGATTCTCATGGG + Intergenic