ID: 906381766

View in Genome Browser
Species Human (GRCh38)
Location 1:45337006-45337028
Sequence GTTTGGCTATGAAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 1, 2: 3, 3: 39, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906381766 Original CRISPR GTTTGGCTATGAAGGGAAGG AGG (reversed) Intronic
901209037 1:7514253-7514275 GTCTGGCTAGGAAGGGCTGGAGG - Intronic
902434921 1:16392301-16392323 GTTTGGTTCTGAAGAGAAGCTGG + Intronic
904989941 1:34584400-34584422 GTTTTGCTGTGAAAAGAAGGAGG + Intergenic
906381766 1:45337006-45337028 GTTTGGCTATGAAGGGAAGGAGG - Intronic
906708867 1:47914644-47914666 ATTTGGCAATGGAGGGAAAGAGG - Intronic
907230917 1:52997484-52997506 TTTTGGCCATGAAAGGAATGAGG + Intronic
911902309 1:103522216-103522238 GCTTGGCTATGAAGGGTGAGGGG + Intergenic
912537584 1:110386756-110386778 GTTTGCCTGTGAAGGTCAGGAGG - Intronic
912574194 1:110649916-110649938 GTTTGGCTTTGAGTGGAAGGGGG + Intergenic
913043708 1:115055218-115055240 AGCTGGCAATGAAGGGAAGGAGG - Intronic
914349986 1:146832395-146832417 GGTGTGCTATGGAGGGAAGGAGG - Intergenic
914387886 1:147189374-147189396 GTTTGGCAGTGAAAGGAAGGAGG + Intronic
914434195 1:147645762-147645784 GTTCTGCTATGAAGGGGAGAAGG + Exonic
914683726 1:149959657-149959679 GTATGGCTAAGTAGGGGAGGAGG - Intronic
915834673 1:159166745-159166767 GTTTGGTTCTGAAGGAAAGATGG - Intergenic
916942882 1:169694706-169694728 GTTTGGCTGTGAAGGAGAAGTGG - Intronic
917107643 1:171509420-171509442 GTTTAGATAAGAAGGGAAGTGGG + Intronic
917257034 1:173126655-173126677 TTCTGGCCATGATGGGAAGGGGG - Intergenic
917688085 1:177438435-177438457 GTTTGGCTGGGAAGGGGAAGAGG + Intergenic
918010011 1:180577907-180577929 TTGTGGCTAGGAAGGGAATGAGG - Intergenic
919113693 1:193253753-193253775 GTTTGCTTATGAAAGGAAAGTGG + Exonic
920051740 1:203168530-203168552 GTTGGGGTGAGAAGGGAAGGTGG - Intronic
921327229 1:213997987-213998009 GATAGGCCATCAAGGGAAGGGGG - Exonic
923515932 1:234698131-234698153 GTTTGGTGATGAAGAGAAGGAGG - Intergenic
923573575 1:235138657-235138679 GGTTGCCTTTGGAGGGAAGGAGG - Intronic
1062803584 10:397872-397894 GTTCAGCCATGATGGGAAGGAGG + Intronic
1064091729 10:12391125-12391147 TTTTGGCCATGAAGGGTAGAGGG + Intronic
1064520214 10:16193009-16193031 TTTAGGCTATGATGGGAAGGGGG + Intergenic
1067260056 10:44681480-44681502 GTATGGTGATGAAGGCAAGGAGG - Intergenic
1067459290 10:46445632-46445654 GCTTGGCTCTGAGGGGAAGAAGG + Intergenic
1067627904 10:47938998-47939020 GCTTGGCTCTGAGGGGAAGAAGG - Intergenic
1067745411 10:48932039-48932061 GGTTGGCAATGAAGGGGAGTGGG - Intronic
1067929009 10:50540826-50540848 TTTTGGCTTTTAGGGGAAGGAGG + Intronic
1068731827 10:60366630-60366652 GCTTGGGGAGGAAGGGAAGGAGG + Intronic
1069817929 10:71210333-71210355 GTTAGGCTGAGAAGGGAAGTGGG + Intergenic
1069968286 10:72140756-72140778 GCTTGGCTGTGAAAGGAAGATGG + Intronic
1072890198 10:99316713-99316735 GTTTGGCTCTGAGGGGGCGGGGG - Intergenic
1073338459 10:102727924-102727946 GGTTGGCCATGTATGGAAGGAGG + Intronic
1073442354 10:103559538-103559560 ATTTGGAAAGGAAGGGAAGGCGG + Intronic
1074032839 10:109705698-109705720 GTTTGGCTATGAGGAGGAGAGGG + Intergenic
1074110682 10:110420698-110420720 GTTTGGCAGTGAAAGGAAAGGGG + Intergenic
1074654432 10:115568827-115568849 GTTTATCTATGAAGGCAGGGAGG - Intronic
1076370932 10:129953168-129953190 GTATGGCTGTGCAGGGTAGGGGG + Intronic
1076837012 10:133026186-133026208 GTTAGGCAAAGAAGGGAATGGGG + Intergenic
1078074906 11:8149732-8149754 TCTTGGCTATGACGGGATGGGGG + Intronic
1078289592 11:9995221-9995243 GTTAGGCTTTGAAGGAAAGCAGG + Intronic
1079642822 11:22828618-22828640 GTGTGGTTATCAAGGGAAGAGGG + Intronic
1080355762 11:31443790-31443812 GACTGGCTATGAATGTAAGGTGG - Intronic
1082245873 11:49921663-49921685 GTTGAGCTATAAAGGAAAGGTGG + Intergenic
1084067809 11:66715390-66715412 CTTTGGCTGTGGAGGGACGGGGG + Exonic
1084188428 11:67487645-67487667 GTCTGGCTAATAGGGGAAGGCGG - Intronic
1084416725 11:69036753-69036775 GAATGGGCATGAAGGGAAGGGGG + Intergenic
1088278212 11:108111448-108111470 GTTTAGCAGAGAAGGGAAGGGGG - Intergenic
1088313758 11:108486874-108486896 GTTCGGCCACGAAGGGAAAGGGG + Intronic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1092049706 12:5459457-5459479 GCTGGGGTGTGAAGGGAAGGAGG - Intronic
1092615942 12:10215597-10215619 GTTTGGAGAGGAAGAGAAGGGGG - Intronic
1093623756 12:21322758-21322780 TTTAGGCCATGATGGGAAGGAGG - Intronic
1093831201 12:23760692-23760714 GTTTGGCACTGAAGGGAAAAAGG - Intronic
1093875282 12:24342547-24342569 GATTGGATATGAAGGAAAAGGGG - Intergenic
1094133542 12:27100273-27100295 TTTAGGCCATGATGGGAAGGGGG + Intergenic
1094348835 12:29500240-29500262 GCTTGGCTGTGAAGGGCAGACGG + Intergenic
1095095751 12:38147708-38147730 GTTTCCCTAGGGAGGGAAGGAGG - Intergenic
1095582185 12:43813142-43813164 GTATGACTATGAAGGCAAGTGGG - Intergenic
1096483683 12:51961047-51961069 GTTTGGCTAGGAAGAGAAGTGGG - Intronic
1096876666 12:54634977-54634999 GTTTGGGGAAGAAGGGGAGGAGG - Intergenic
1096929985 12:55197228-55197250 ATTTGGCCATGAAGGGCAGGAGG + Intergenic
1097157242 12:57021797-57021819 GTCAGGCCATGATGGGAAGGGGG + Intronic
1097244257 12:57598018-57598040 GGTTGGCTGTGAAGAGAAAGAGG + Intronic
1097864935 12:64552181-64552203 GCTTGGCTAGAAAGGGAAGGAGG + Intergenic
1098837301 12:75438534-75438556 GTTGGGCTCTGTAGGGGAGGAGG - Intergenic
1098981507 12:76961689-76961711 GTTTGGCTATGATGTGAAGATGG + Intergenic
1100177579 12:92048747-92048769 GGTTGGCTAGGTAGGCAAGGTGG + Intronic
1100850582 12:98705962-98705984 GTTTACATATGCAGGGAAGGAGG - Intronic
1104185322 12:126425145-126425167 GTTAGGCTTTGAAGGGAAGGTGG + Intergenic
1105024445 12:132838939-132838961 GTTTGGCTGTGATGTGAGGGAGG - Intronic
1105909696 13:24851550-24851572 GTTTGGCTTTGAGAGAAAGGAGG + Exonic
1106167617 13:27262714-27262736 ATTTAGCTATGAAAGGGAGGAGG - Intergenic
1106434501 13:29711995-29712017 TTTAGGCCATGATGGGAAGGGGG - Intergenic
1106862451 13:33924266-33924288 GGTTTTCTATGAATGGAAGGTGG + Intronic
1108364200 13:49693636-49693658 ATTTTGCTCTGAAGGGGAGGTGG - Intergenic
1109673917 13:65647795-65647817 ATATGGAAATGAAGGGAAGGAGG + Intergenic
1110982425 13:81918012-81918034 TTCTGGCCATGATGGGAAGGAGG + Intergenic
1112399602 13:99064344-99064366 ATTTGGATATCAAAGGAAGGTGG + Intronic
1112515758 13:100051597-100051619 TTCTGGCCATGATGGGAAGGGGG - Intergenic
1113308271 13:109102198-109102220 GATTGGATAAAAAGGGAAGGAGG + Intronic
1113835519 13:113326145-113326167 GTCTGGCTCTGAGGGGAATGGGG - Intronic
1114871106 14:26659611-26659633 GTTTGGCTATGAAGAAAATCAGG - Intergenic
1115157844 14:30360566-30360588 GTGTGGAAATGAAGGGAAGGAGG + Intergenic
1115372787 14:32637435-32637457 ATTTAACTGTGAAGGGAAGGAGG + Intronic
1115973356 14:38970291-38970313 GTTTGGCTGTAAAGGAAAGCAGG + Intergenic
1117344974 14:54822851-54822873 GTATGTTTATGAGGGGAAGGAGG - Intergenic
1117814686 14:59584722-59584744 GTCTGGCAATGAAGGGAAGCAGG - Intergenic
1118494147 14:66291510-66291532 CTCTGGCTATTAAGGGAAAGGGG + Intergenic
1120492818 14:85198165-85198187 CTTTGACTATGAAGGGAAGCCGG + Intergenic
1121397611 14:93640706-93640728 GTTTTGCTAATATGGGAAGGTGG - Intronic
1121725807 14:96148987-96149009 GTTTGGCTACGAGGGCAAGTAGG + Intergenic
1122677117 14:103424681-103424703 ATTTGGCCATGAAGAGGAGGAGG + Intronic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1123986672 15:25652538-25652560 GCTTGGCTATGGAGGGCAGGTGG + Intergenic
1124392669 15:29273773-29273795 GTCTGACTTTCAAGGGAAGGAGG - Intronic
1126009618 15:44289660-44289682 GTGTGTCTTTGAAGGTAAGGGGG - Intronic
1126825372 15:52543043-52543065 GGTGGGGTATGAAGGGAAGAGGG - Intergenic
1127289200 15:57555123-57555145 ATTTTGCCATGAAGGGGAGGAGG - Intergenic
1128768783 15:70266723-70266745 GTTTGGCTGTGAAAGAAAAGCGG - Intergenic
1129761139 15:78130068-78130090 CTTTGGCTGTGAAGGAAAGCAGG - Intronic
1130635871 15:85619335-85619357 GGCTGGCTAGGGAGGGAAGGAGG + Intronic
1132336642 15:101052228-101052250 CTCTGGCTACGAGGGGAAGGGGG - Intronic
1135346132 16:21690119-21690141 GTTTAGCTGTGAAGGGGAAGAGG + Intronic
1135353217 16:21747930-21747952 GTTTGGCTATGGAGAAAAGATGG - Intronic
1135451704 16:22564053-22564075 GTTTGGCTATGGAGAAAAGATGG - Intergenic
1135577806 16:23599454-23599476 GCTTGTCTATGAAAGGTAGGAGG - Intergenic
1135705414 16:24670804-24670826 GCTTGGGTCTGAAGGGAGGGTGG + Intergenic
1136674995 16:31895006-31895028 GTCTGGCTGTGAAGGGGAGCCGG + Intronic
1137493733 16:48952859-48952881 GTCTGTCTATGAAGAGAAGTGGG - Intergenic
1138190545 16:55010272-55010294 GTTTGGGTATGAAGAAAAGGTGG + Intergenic
1139984052 16:70883136-70883158 GGTGTGCTATGGAGGGAAGGAGG + Intronic
1140259118 16:73362124-73362146 GGTTGGCAAGGAAGGCAAGGAGG - Intergenic
1142678493 17:1531036-1531058 CTTTTGCTGTGAAGGAAAGGAGG - Intronic
1146500739 17:33362319-33362341 GTGTGGCTAAGAAGGGGTGGAGG + Intronic
1146513087 17:33467467-33467489 TTCAGGCTATGATGGGAAGGAGG + Intronic
1146577930 17:34011443-34011465 ATTGGGCTATGAATGGGAGGTGG - Intronic
1146713434 17:35062815-35062837 GTTTGGCGATGAAAAGCAGGAGG + Intronic
1147178633 17:38671936-38671958 GTTGAGGTATGAAGGGAAGCTGG - Exonic
1147620540 17:41863781-41863803 GTTTTGCTAAGAACCGAAGGAGG - Intronic
1148149656 17:45389123-45389145 GTTTGGCTGCAAAGGGGAGGAGG + Intergenic
1148797186 17:50202647-50202669 GTTTGACTGTGCTGGGAAGGAGG - Intergenic
1149161075 17:53693981-53694003 TTTTGGATATGATGGGATGGAGG - Intergenic
1149309785 17:55382771-55382793 CCTTGGTTATGAAGGGAAAGAGG - Intergenic
1150465728 17:65391204-65391226 GATTGGCTGTCTAGGGAAGGTGG - Intergenic
1150657182 17:67046892-67046914 GTTAGGCTAAGAAGGCAAAGAGG - Intronic
1151820628 17:76494888-76494910 TTGGGGCAATGAAGGGAAGGGGG + Intronic
1152484092 17:80578430-80578452 GTTTGGCCATGTTGGGAAGCTGG - Intronic
1152529332 17:80907825-80907847 GCTGGGCTTTGAAGGGAAGGAGG - Intronic
1152872496 17:82764295-82764317 GTGTAGCTAGGAAGGGAATGGGG + Intronic
1153837019 18:8972405-8972427 GTTTGGCCGTGAGGGGCAGGTGG - Intergenic
1153993549 18:10420681-10420703 GTTTGGCAAGGCAGGGAATGGGG + Intergenic
1154968873 18:21386941-21386963 GATTTCCCATGAAGGGAAGGTGG - Intronic
1156382158 18:36572949-36572971 GTTTGTTTGGGAAGGGAAGGAGG + Intronic
1156936360 18:42713747-42713769 GTTTGGCTACAAAGAGAAGAGGG - Intergenic
1157225950 18:45865018-45865040 GTTTGGATATTAGGGGGAGGTGG - Intronic
1157234699 18:45953519-45953541 GTTTGGCAGTGAAGGGAAGCTGG - Intronic
1157313845 18:46572353-46572375 GTTTGGCTGAGATTGGAAGGAGG + Intronic
1157409528 18:47452199-47452221 GTTTATCGATGTAGGGAAGGAGG - Intergenic
1158215827 18:55099707-55099729 ATTTGGATATGGAGGGAATGAGG - Intergenic
1159077343 18:63696183-63696205 GTTAGACAATGAATGGAAGGAGG - Intronic
1159347195 18:67221465-67221487 GTGGGGCGGTGAAGGGAAGGAGG - Intergenic
1160800237 19:964261-964283 GTTTGGCCATGATGGGGATGCGG - Exonic
1162198944 19:9007538-9007560 GTTGGATTATGAAGGGAAGGGGG - Intergenic
1164887406 19:31793643-31793665 GCCTGGCTATGAAGGAGAGGTGG - Intergenic
1166831796 19:45643744-45643766 ATTGGGCTACGAAGGGAAGGAGG - Intronic
925212041 2:2057564-2057586 GTGTGGCTCTGAAAGGAAAGAGG - Intronic
925781490 2:7386232-7386254 GATGAGCTATTAAGGGAAGGAGG + Intergenic
929171615 2:38937950-38937972 TTTGTGATATGAAGGGAAGGAGG - Intronic
932142790 2:69294423-69294445 GTTGGACTATGAAGAGAATGAGG - Intergenic
932548587 2:72742503-72742525 GTTTTGCTGGGAAGGGAAGAGGG - Intronic
933021470 2:77198791-77198813 GTTTGCCTAAGTAGGCAAGGAGG - Intronic
933270876 2:80231548-80231570 TTTAGGCAATGATGGGAAGGAGG + Intronic
933413393 2:81952766-81952788 GTTTGGAAATGGAGGGAAAGAGG + Intergenic
935042519 2:99446875-99446897 GTTAGGCTTTGGAGGGAATGGGG - Intronic
936291271 2:111225693-111225715 GATTGGTTGTGAAAGGAAGGTGG + Intergenic
936472275 2:112809911-112809933 GCTTGGCAATGAAGGAAGGGAGG - Intergenic
937104108 2:119294382-119294404 ATTTGGCTGTGAAGGGAAGATGG + Intergenic
937499583 2:122463253-122463275 GTTTGTCTATGAGGGTGAGGGGG + Intergenic
937758468 2:125570006-125570028 GATTGGCTATTGAGGAAAGGAGG + Intergenic
938157038 2:128950579-128950601 GTTTAGTAATGAAGGTAAGGTGG + Intergenic
938730975 2:134146907-134146929 GTATGGCTATGAAGAAAAGTAGG + Intronic
939277720 2:140021977-140021999 GTTTGGCCAAAAAGTGAAGGTGG + Intergenic
939290385 2:140186727-140186749 TTCTGGCTAAGAAGGAAAGGAGG + Intergenic
939718408 2:145615445-145615467 GTTTGGCCATAAAGGAAAGGAGG + Intergenic
939810872 2:146830569-146830591 GTCTGGCTATCAGGGAAAGGTGG + Intergenic
940588333 2:155686019-155686041 GATTGGGTTTGAAGTGAAGGGGG - Intergenic
941561855 2:167056801-167056823 ATATGGATATGGAGGGAAGGAGG - Intronic
941654452 2:168127999-168128021 GTTAGGCTTGGGAGGGAAGGTGG + Intronic
942956876 2:181783714-181783736 GTTTGGCTGTGAAGGAGAGCAGG + Intergenic
944361477 2:198862424-198862446 GGTTGGCTGGGCAGGGAAGGAGG + Intergenic
944486222 2:200208735-200208757 GTTTGGTTATGAATAGAAAGGGG + Intergenic
944517732 2:200529132-200529154 GTTTTGCTGTGAAGGGAAGCAGG + Intronic
944732321 2:202529336-202529358 ATTTGGGTATGGAGGGAGGGTGG - Intronic
946388623 2:219401876-219401898 GTTTGATCATGAAGGGAAGGAGG + Intergenic
946848876 2:223885805-223885827 CTGTGGCTGGGAAGGGAAGGGGG - Intronic
947244136 2:228028069-228028091 GTTGGGCCATGAAAGGAAGCGGG - Intronic
947541826 2:230985176-230985198 CTTTGGAGATGAAGGGAGGGAGG + Intergenic
948672588 2:239578031-239578053 CTCGGGCTATGAAGGGTAGGAGG + Intergenic
948737748 2:240020562-240020584 GTTAGGAGAGGAAGGGAAGGTGG - Intronic
1169262868 20:4150209-4150231 GTTTTGCTGTGAAGGGAAGAAGG - Intronic
1170723473 20:18904362-18904384 GTGAGGCCAGGAAGGGAAGGCGG - Intergenic
1170857393 20:20069674-20069696 GGTTGGTTATCAATGGAAGGTGG + Intronic
1170939338 20:20835471-20835493 TTATGGCCATGAAGAGAAGGAGG + Intergenic
1171291587 20:23985738-23985760 GTTCGGCTATGACGTGAAGTGGG - Exonic
1171405844 20:24911973-24911995 TTCTGGCCATGATGGGAAGGTGG + Intergenic
1172228018 20:33318139-33318161 GTTTGCCTACAAAGGGCAGGTGG - Intergenic
1173860134 20:46277860-46277882 GTTGGGCTTTGAAGGGAAGGAGG + Intronic
1175187288 20:57187319-57187341 GGTTGGCTATCACGGAAAGGGGG - Intronic
1175238136 20:57526744-57526766 GCTTGGATAAGAAGGGGAGGAGG + Intergenic
1175423400 20:58850135-58850157 CCTTGGCTATGAATAGAAGGTGG - Intronic
1175596058 20:60233901-60233923 GTTTGGTGATCAAGGAAAGGTGG - Intergenic
1175625299 20:60484349-60484371 GGGTGGCCATGAAAGGAAGGAGG - Intergenic
1176012171 20:62903846-62903868 GTGTGGCAAAGAAGGGAAGAGGG + Intronic
1177449141 21:21242868-21242890 GAATTGCTATGAAGGGAAAGAGG + Intronic
1177453187 21:21299602-21299624 GTCTGGCTAAAAAGGGAGGGAGG - Intronic
1178087909 21:29131114-29131136 GTCTGCCTATGAAAGGATGGTGG - Intronic
1179267084 21:39813116-39813138 GCTTGGCTTTCATGGGAAGGAGG + Intergenic
1180765809 22:18345355-18345377 GTTCGGCTATGACGTGAAGAGGG + Intergenic
1180780501 22:18517023-18517045 GTTCGGCTATGACGTGAAGAGGG - Exonic
1180813220 22:18774344-18774366 GTTCGGCTATGACGTGAAGAGGG - Intergenic
1181199394 22:21208660-21208682 GTTCGGCTATGACGTGAAGAGGG - Exonic
1181400361 22:22647197-22647219 GTTCGGCTATGACGTGAAGCGGG + Exonic
1181649004 22:24248594-24248616 GTTCGGCTATGACGTGAAGCGGG - Intergenic
1181702340 22:24628295-24628317 GTTCGGCTATGACGTGAAGCGGG + Exonic
1181929175 22:26385794-26385816 GTCTGGCCATGATGGGATGGAGG - Intergenic
1182074252 22:27484083-27484105 GTTTGGCTATGGAGGGAAGGAGG - Intergenic
1182529150 22:30941864-30941886 GTGTGGCTGGGAAGGGAGGGAGG - Intronic
1183337650 22:37259813-37259835 GGTTGGGTAGGAAGGGGAGGGGG - Intergenic
1184059568 22:42073960-42073982 GTTTGGCTCTGCCGGGAAAGTGG + Intergenic
1185323260 22:50212114-50212136 GTTTGGCTTTGATGTCAAGGTGG + Intronic
1203227431 22_KI270731v1_random:86246-86268 GTTCGGCTATGACGTGAAGAGGG + Intergenic
1203263322 22_KI270734v1_random:26-48 GTTCGGCTATGACGTGAAGAGGG - Intergenic
949226043 3:1697578-1697600 CTCTGGATATGAAGGGAAAGAGG + Intergenic
949650603 3:6154741-6154763 GTTTGGGTATCCAGGGAAGGTGG - Intergenic
951950755 3:28197972-28197994 AGTTTGCTATGAAGGGAAAGAGG + Intergenic
952184956 3:30958545-30958567 GTGTGGAGATGAAGGGAGGGAGG - Intergenic
952270803 3:31829599-31829621 GTGTGTCTATGAGGGGAAGCAGG + Intronic
952736372 3:36695390-36695412 GTTTGGCTGGGAGGTGAAGGTGG + Intergenic
953131868 3:40147360-40147382 GTCTGGATATAAAGAGAAGGAGG - Intronic
953533167 3:43756283-43756305 GTGGGGCCAGGAAGGGAAGGAGG + Intergenic
954241537 3:49297669-49297691 GTTTAGCTCTGCAGGGCAGGAGG + Intronic
955315345 3:57934039-57934061 GATTAGCTATGAAGTGCAGGAGG - Intergenic
957064372 3:75509398-75509420 TTTTGACTATGAGGGGAATGAGG - Intergenic
957735725 3:84199943-84199965 GTTTTGCTATTAAGGTAATGTGG - Intergenic
958445960 3:94215481-94215503 GTTTGGCTTCCAAGGGAAGCTGG - Intergenic
958712713 3:97737506-97737528 GTTTGAATATGGAGGGAGGGAGG + Intronic
959996253 3:112683833-112683855 GGTGGGCTATGAAGGGTTGGGGG - Intergenic
960538148 3:118835487-118835509 CTTTTGCTATGGAGGGAAGGAGG - Intergenic
960621726 3:119643396-119643418 GTTTGGCTTTTCAGGGAAGGTGG - Intronic
960807869 3:121601272-121601294 GTTTGACAATGAAAGGAAGGGGG - Intronic
961212069 3:125133128-125133150 GTTTGGCTTTGAAGAGGAGAGGG + Intronic
961288984 3:125830005-125830027 TTTTGACTATGAAAGGAATGAGG + Intergenic
961321417 3:126078917-126078939 GTTTTGCCATGAAGAGGAGGAGG - Intronic
961414517 3:126747752-126747774 CTCTGGAAATGAAGGGAAGGAGG - Intronic
962040906 3:131706572-131706594 TTTAGGCTATGATAGGAAGGGGG + Intronic
962238872 3:133733367-133733389 GCTTGGCAAAGATGGGAAGGAGG - Intergenic
962252156 3:133842011-133842033 GTTAGGCCATGAAGGGAACAAGG - Intronic
962312268 3:134335011-134335033 GTTTTACTGTGAAGGAAAGGTGG - Intergenic
962313727 3:134344919-134344941 GTTTGGCTATGAAGGAGAAGGGG - Intergenic
962420199 3:135221168-135221190 GTTTGGCCAAGAAGGGGATGGGG + Intronic
962743733 3:138382107-138382129 GCTTCCCTATGAAGGGAAAGAGG - Intronic
963972693 3:151447020-151447042 GTGTGGATCTGAAGGGAACGTGG + Exonic
964793485 3:160474196-160474218 ATGTGGCTCTGAAGGGGAGGAGG - Intronic
965548323 3:169937964-169937986 CTTTGGCTCTGAAGGCAATGGGG - Intronic
966143456 3:176783719-176783741 TTTTGGAAATGAATGGAAGGGGG - Intergenic
966424668 3:179768232-179768254 GTTTGGCTGCAGAGGGAAGGCGG + Intronic
969198971 4:5586477-5586499 TTCAGGCCATGAAGGGAAGGGGG + Intronic
969417014 4:7067694-7067716 GTTTGGCTCGGAAGGTACGGTGG - Intronic
971076374 4:23153755-23153777 TTCAGGCCATGAAGGGAAGGTGG + Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
974834907 4:67236713-67236735 GTGGGGCTATGAAGAGAAAGGGG + Intergenic
975797643 4:78025913-78025935 TTTAGGCCATGATGGGAAGGGGG - Intergenic
976980973 4:91228719-91228741 TTTTTGCTATGAGGTGAAGGTGG - Intronic
977622448 4:99153015-99153037 TTTAGGCCATGAAGGGAAGCTGG + Intronic
979957591 4:126973645-126973667 GATTGGTTATGAAGGGTAAGGGG + Intergenic
982269187 4:153569281-153569303 GGTTGGCTCTCAGGGGAAGGAGG - Intronic
983965443 4:173804087-173804109 GGTTGGAGATGCAGGGAAGGTGG - Intergenic
984647268 4:182233149-182233171 GTTTGGCTGAGCACGGAAGGTGG - Intronic
985877833 5:2613543-2613565 GTTTGACTGTGCAGGGAGGGAGG - Intergenic
987695596 5:21325593-21325615 CTTTTGCTATGAAGGGATGATGG - Intergenic
988185901 5:27861612-27861634 GTGTGTGCATGAAGGGAAGGGGG - Intergenic
990638924 5:57760988-57761010 GTTTTGCTGTGGAGGGAAGCAGG + Intergenic
991744807 5:69726505-69726527 CTTTTGCTATGAAGGGATGATGG + Intergenic
991752898 5:69828721-69828743 CTTTTGCTATGAAGGGATGATGG - Intergenic
991796377 5:70306233-70306255 CTTTTGCTATGAAGGGATGATGG + Intergenic
991802516 5:70385455-70385477 CTTTTGCTATGAAGGGATGATGG - Intergenic
991824187 5:70601819-70601841 CTTTTGCTATGAAGGGATGATGG + Intergenic
991832217 5:70703849-70703871 CTTTTGCTATGAAGGGATGATGG - Intergenic
991888755 5:71305789-71305811 CTTTTGCTATGAAGGGATGATGG + Intergenic
992164798 5:74038780-74038802 TTCAGGCTATGATGGGAAGGGGG + Intergenic
992865674 5:80954738-80954760 GTTTTGCTATAAAGGGAAGCAGG + Intergenic
993044991 5:82856754-82856776 GTTAGGCTATGTAGCCAAGGGGG - Intergenic
994214335 5:97120577-97120599 GTTTAGACATGAAGAGAAGGTGG + Intronic
994374405 5:99002822-99002844 GTTTGGCTATAAAGGGGAGAAGG + Intergenic
994732699 5:103512181-103512203 ATTTGACTTTGAAGGGAAGGGGG + Intergenic
995590305 5:113692892-113692914 GCTTGTCTCTGTAGGGAAGGAGG - Intergenic
995728166 5:115203951-115203973 CTTTGGCTATTAAGGGATGGGGG - Intergenic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
996285039 5:121780023-121780045 GTTTGGCTGTGAAGGAAATTAGG + Intergenic
996321558 5:122222652-122222674 GTTTGGCCTAGAAGGCAAGGTGG - Intergenic
996555850 5:124778253-124778275 GTTTGGCTATGAAGGGGAAGAGG + Intergenic
997258152 5:132445000-132445022 TTTAGGCCATGATGGGAAGGGGG - Intronic
999130342 5:149278233-149278255 GTTTGGCCAGGAAAGGAAGGAGG - Intronic
999601677 5:153273176-153273198 GATAGGTTATGAGGGGAAGGAGG - Intergenic
1000357438 5:160413524-160413546 GTTTGACTATGATGGGAAGAGGG - Exonic
1000462227 5:161536930-161536952 GTTTGGTTCTGAAGGGATGTAGG - Intronic
1001003838 5:168031994-168032016 GTCTGGCTTTGGAGGGAAGTAGG + Intronic
1002968544 6:1991392-1991414 GTTTGACAATGAAGTGAAGTGGG - Intronic
1002995656 6:2282003-2282025 GTTTGACTATGAAGGAAAAGAGG + Intergenic
1004125540 6:12869257-12869279 GTTGGACTATGAAGTGGAGGTGG - Intronic
1004351359 6:14893071-14893093 GGTTGGGGATGGAGGGAAGGAGG + Intergenic
1004580486 6:16946485-16946507 GTGTGGCTAAGGAGGCAAGGTGG + Intergenic
1005555187 6:26972473-26972495 CTTTTGCTATGAAGGGATGATGG + Intergenic
1007265877 6:40595530-40595552 GTTTAGCTGTGAAAGGAGGGTGG + Intergenic
1009596208 6:65739907-65739929 GTTAGCTTACGAAGGGAAGGAGG + Intergenic
1010052953 6:71529767-71529789 ATTTTGCTTTAAAGGGAAGGCGG + Intergenic
1010429482 6:75762633-75762655 GTCTGGCTCAGAAGGGAAGTGGG - Intronic
1013088986 6:106882347-106882369 TTTAGGCCATGATGGGAAGGGGG - Intergenic
1013607340 6:111762414-111762436 TTCAGGCCATGAAGGGAAGGTGG + Intronic
1017652065 6:156593095-156593117 GTTTGTCAAGGAAGGGAGGGAGG + Intergenic
1023392364 7:39722362-39722384 GTCTGGCTGAGAAGGGAAGATGG + Intergenic
1026422070 7:70250090-70250112 GTCTTGCTTTGAAGGGAATGGGG - Intronic
1026440537 7:70439833-70439855 GTTTGGTTATGAAGTTAATGTGG + Intronic
1027601604 7:80246975-80246997 TTTGGGCCATGAAGGGAAGGAGG - Intergenic
1028931648 7:96419796-96419818 TTTTGTCTAAGTAGGGAAGGTGG + Intergenic
1029195644 7:98803533-98803555 GTTTGGCAATGTAGGCAAGAAGG - Intergenic
1029885161 7:103861837-103861859 GTTTGGTGATGAAGGAAAGCTGG + Intronic
1031404411 7:121367483-121367505 TTTTGGCTATGAGGGCAAAGAGG - Intronic
1031595738 7:123647692-123647714 TTTTGGCCACGATGGGAAGGTGG - Intergenic
1031640757 7:124161323-124161345 GTTAGGGTCTGAGGGGAAGGCGG - Intergenic
1032392200 7:131562604-131562626 GTGTGGATGGGAAGGGAAGGAGG + Intergenic
1032510877 7:132471448-132471470 GTTGGGCCATGAAGGGATGAAGG - Intronic
1032535016 7:132655834-132655856 GTTTTGAGATGAAGGGAATGAGG - Intronic
1032617467 7:133490055-133490077 GTGTGGATATGAATGGAATGTGG + Intronic
1037604333 8:20424781-20424803 GTTCACCTGTGAAGGGAAGGAGG - Intergenic
1037998425 8:23369829-23369851 GTGTGGCTCTGAAGGGAATCAGG + Intronic
1038350435 8:26771466-26771488 GTTTGGGTAGGTAGAGAAGGTGG - Intronic
1038373419 8:27014316-27014338 GTATGGCAATGCAGGGAAGGTGG + Intergenic
1038458152 8:27692033-27692055 GTTCAGCCATGATGGGAAGGGGG + Intergenic
1038889018 8:31697586-31697608 TTTTTGCTAGGAAGGGAAGCCGG + Intronic
1039501404 8:38020574-38020596 TTCAGGCTATGAAGGGAAAGGGG - Intergenic
1041100591 8:54392740-54392762 CTTTGTCTATGCAGAGAAGGAGG + Intergenic
1042068589 8:64905595-64905617 CTTTGGCCATGACAGGAAGGAGG - Intergenic
1042428031 8:68672156-68672178 GTCTGGTTATGGAGGCAAGGGGG + Intronic
1044684942 8:94817444-94817466 GTTTGGCTCTGAAGAGAAGAGGG - Intronic
1044751037 8:95415718-95415740 GTTGGGCTGTGAAGGGTAAGGGG - Intergenic
1044797251 8:95916348-95916370 GTTTCTCTATAAAGGGAAGTAGG - Intergenic
1047680190 8:127246836-127246858 GTTTTGCTAAGAAGGGGAGCAGG + Intergenic
1050820917 9:9878869-9878891 GTTTGATTGTGGAGGGAAGGAGG - Intronic
1058447057 9:105063920-105063942 CTTTGTTTATGAAGGGAATGGGG - Intergenic
1186471285 X:9824063-9824085 ATTTGGGTATGAAGTGAATGAGG + Intronic
1189945998 X:46179840-46179862 GTTTAGCTCTCAGGGGAAGGGGG - Intergenic
1190594199 X:52036764-52036786 ATTTTGCTGTGAAGGGAAGCAGG + Intergenic
1192417839 X:71000030-71000052 ATCTGGCTATGAAAGGAAGGAGG - Intergenic
1192960300 X:76123246-76123268 ATTTAGCTCTGAAGGTAAGGTGG + Intergenic
1194262235 X:91710565-91710587 GTCAGGCCATGATGGGAAGGGGG - Intergenic
1195466633 X:105186391-105186413 GTTGGGATATGCATGGAAGGTGG + Intronic
1195735398 X:108007733-108007755 GTTTGGCTGTGAAGGGGAGAAGG + Intergenic
1196568688 X:117239837-117239859 AATTGGCTATGTAGGCAAGGGGG + Intergenic
1198544859 X:137680580-137680602 GTTTGGCTCTCAAGGCAAGTAGG + Intergenic
1199033502 X:143027497-143027519 GGCTGGCTATGAGGCGAAGGAGG + Intronic
1199159589 X:144593008-144593030 GTATGGGTTTGAGGGGAAGGTGG - Intergenic
1199764814 X:150933655-150933677 GTTTGTATATGATGTGAAGGAGG - Intergenic
1200781591 Y:7221151-7221173 GTTGGGTGATGAAGGGAGGGAGG + Intergenic