ID: 906415402

View in Genome Browser
Species Human (GRCh38)
Location 1:45617923-45617945
Sequence GTCACTGCCCTCTTAATATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906415398_906415402 12 Left 906415398 1:45617888-45617910 CCCATTATCACAGAGTATTCAAG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 906415402 1:45617923-45617945 GTCACTGCCCTCTTAATATAGGG 0: 1
1: 0
2: 0
3: 7
4: 84
906415397_906415402 13 Left 906415397 1:45617887-45617909 CCCCATTATCACAGAGTATTCAA 0: 1
1: 0
2: 0
3: 19
4: 174
Right 906415402 1:45617923-45617945 GTCACTGCCCTCTTAATATAGGG 0: 1
1: 0
2: 0
3: 7
4: 84
906415399_906415402 11 Left 906415399 1:45617889-45617911 CCATTATCACAGAGTATTCAAGA 0: 1
1: 0
2: 1
3: 27
4: 226
Right 906415402 1:45617923-45617945 GTCACTGCCCTCTTAATATAGGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906415402 Original CRISPR GTCACTGCCCTCTTAATATA GGG Intronic
906415402 1:45617923-45617945 GTCACTGCCCTCTTAATATAGGG + Intronic
906618309 1:47251105-47251127 CTCCCTGCCCTTTTAATACAGGG - Exonic
910818668 1:91321141-91321163 GGCTCTGCCCTTTTAATTTAAGG - Intronic
912957601 1:114166410-114166432 GTCACTGCCCTCAGATTTTACGG + Intergenic
916737420 1:167620197-167620219 GTCACTGCCCTCTTAACGTCAGG - Intergenic
918846927 1:189627935-189627957 GTCTCTTCCCTCTTCCTATAAGG - Intergenic
922854716 1:228764981-228765003 CTAATAGCCCTCTTAATATAAGG + Intergenic
1070174264 10:73956918-73956940 GTCACTGCCCTCTGAGTGGAAGG - Intergenic
1072330046 10:94339343-94339365 GTCACTACTCTCTTTATGTAAGG - Intronic
1073992786 10:109282567-109282589 GTCACTCCTCTCCTAATAAAAGG + Intergenic
1078136960 11:8659562-8659584 ATCCTTGCCCTCTTAATATCAGG + Intronic
1082007251 11:47426245-47426267 GTCACTGGACTCTCAATATTCGG + Exonic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1094230142 12:28093315-28093337 TTCACTTCCCTCTTAATGGAGGG + Intergenic
1096577923 12:52566108-52566130 GTCACTGCCTTTTTAACAAAAGG - Exonic
1101859800 12:108473857-108473879 CTTACTGCCTTCTTATTATAGGG - Intergenic
1103960529 12:124606500-124606522 GTCTCTGTCCTCTTTTTATAAGG - Intergenic
1106148767 13:27077344-27077366 GTCAGTGCACTATTAATAAATGG + Intronic
1106267243 13:28121321-28121343 GTCATTCCCATCTTAATAAAGGG - Intergenic
1108356500 13:49633258-49633280 GTCTCTTCCCTCTTATTAGAAGG - Exonic
1111976891 13:94975632-94975654 GTCACTGCCCACTTAAAAGCAGG - Intergenic
1115912894 14:38276231-38276253 GTCACTGCATTCTCAGTATATGG - Intergenic
1119056639 14:71428757-71428779 GACCCTGCCCTCTAAATATCAGG - Intronic
1135867485 16:26117633-26117655 TTTACTGCCTTCTTAATATCTGG + Intronic
1140975987 16:80060914-80060936 GTCACTGGCATCTTATAATAAGG - Intergenic
1141517737 16:84557601-84557623 GTAGCTGCTCACTTAATATATGG - Intergenic
1147260874 17:39209337-39209359 AACACTGCCCTCTTTATACATGG - Intergenic
1147359134 17:39920436-39920458 GTCAGTGCCCTCGTGAGATAAGG + Intergenic
1147567554 17:41547107-41547129 GGCACTGTCCTCTTCCTATATGG + Intergenic
1150660547 17:67072401-67072423 GTCACTGCCATCTTAGGACAGGG + Exonic
1153318384 18:3747559-3747581 GTCACTGCCCTGATAACATTTGG - Intronic
1153955500 18:10092590-10092612 GTCTCTGCCCTCCTAATCTCAGG - Intergenic
1159419234 18:68195108-68195130 CTAACTGCCCTCTTAACTTAGGG - Intergenic
1160013211 18:75122327-75122349 GTCACTGCCCTCTTCATTGATGG + Intergenic
1163190095 19:15671022-15671044 GTCAATGCCATATTAATATAGGG - Intergenic
1163203077 19:15782241-15782263 GTCAATGCCATATTAATACAGGG + Intergenic
1163223235 19:15936861-15936883 GTCAATGCCATATTAATACAGGG + Intergenic
1164397678 19:27880120-27880142 GTTTCTGCCCTCCTAATATTGGG - Intergenic
926181441 2:10647770-10647792 GTCAGTGCCTTCTAAATACATGG - Intronic
929637480 2:43539172-43539194 GTGACTGCCGTCTGAATACACGG - Intronic
929938443 2:46312013-46312035 GTCATTGCCCTGGTAATATTTGG - Intronic
930744529 2:54867988-54868010 GTCACTGAGCACTTAAAATACGG + Intronic
931951155 2:67363651-67363673 GTCTCTGTCTTCATAATATAGGG - Intergenic
934607529 2:95708452-95708474 GTCCCTGCCCTCCTAATATTTGG + Intergenic
935473842 2:103493700-103493722 TTCATTGCCCTCTTAGTATTTGG + Intergenic
936540923 2:113350643-113350665 GTCCCTGCCCTCCTAATATTTGG + Intergenic
938104434 2:128520463-128520485 GTCACTGCCCACTTCATCTTGGG + Intergenic
938628688 2:133140605-133140627 TTCACTGCCCGCCTAATTTATGG + Intronic
941685117 2:168440247-168440269 CTCCCTGCACTCTGAATATAAGG + Intergenic
944900239 2:204206498-204206520 ATCTCTGCTCTGTTAATATAAGG + Intergenic
946947164 2:224833044-224833066 GTCACTGCTCAGTTAAAATATGG - Intronic
947285174 2:228506238-228506260 CTCACTCACCTCATAATATATGG - Intergenic
947691247 2:232138397-232138419 TTCTCTACCTTCTTAATATAAGG + Intronic
1170258462 20:14374780-14374802 CTCACTCCCCTATTAATTTATGG + Intronic
1175575785 20:60060004-60060026 GACTCTGCTCTCTTAATATAAGG + Intronic
950529305 3:13543968-13543990 GTCGCTGCCCCCTTTATTTAAGG + Intergenic
950928356 3:16765507-16765529 GTTACTGCCCCCAGAATATAAGG + Intergenic
951706544 3:25549637-25549659 GTAACTTCCCTCTTAAAATGAGG - Intronic
951761653 3:26153789-26153811 CTCACTGTCCTTTTTATATAAGG + Intergenic
958086914 3:88821616-88821638 GTCACTACCCTCTAAATCCAAGG + Intergenic
960987760 3:123291789-123291811 TTCATTGTCCTCTTAATATCAGG + Intronic
965957675 3:174390227-174390249 GTCCATGCCCTATTAATATGTGG - Intergenic
966811111 3:183845749-183845771 ATCACTGCTCTCTTCCTATAGGG - Intronic
971529345 4:27665272-27665294 GTCAATGTTTTCTTAATATAAGG + Intergenic
978550026 4:109915447-109915469 GTCACTGCACTGTTCAAATACGG - Intronic
979965695 4:127074188-127074210 TCCAATGCCCTCTTAAGATATGG - Intergenic
980974401 4:139597274-139597296 GTCACTCCCCTCTTATGATGTGG - Intronic
984650292 4:182263338-182263360 GATCCTGCCCTCTTAATAAAAGG + Intronic
995499192 5:112784826-112784848 GTCACTATTTTCTTAATATAAGG - Intronic
996533792 5:124554884-124554906 GTTACAACCCTCTTAAAATAGGG + Intergenic
996690452 5:126334485-126334507 GTCACTGCCCTAGTTATATAAGG - Intergenic
1000814835 5:165908177-165908199 GTCCCTGCCCTAATAATACAGGG - Intergenic
1003766570 6:9243572-9243594 GTCACTGCCCTATCAATGTTTGG - Intergenic
1008136808 6:47786403-47786425 CTCACTACCCTCTAAATCTATGG + Intronic
1010927451 6:81760937-81760959 TTGACTCCCCTCCTAATATAGGG + Intergenic
1015151689 6:130046280-130046302 TTCACCGCACTCTTAATACACGG + Intronic
1018326434 6:162674940-162674962 GTCACTGCCCTAGCCATATAAGG - Intronic
1021485106 7:21158792-21158814 GTCACTGCCCTCCTCACACAGGG + Intergenic
1030651577 7:112121502-112121524 GTCACTGACCTCTTAGCATTAGG + Intronic
1032670989 7:134082276-134082298 GTTACTCCCCTTTTTATATAGGG + Intergenic
1032989504 7:137376706-137376728 TTCTCTGCACTCTTAATAAACGG + Intergenic
1033897165 7:146087461-146087483 GCAACTGCCTACTTAATATATGG - Intergenic
1049401661 8:142430359-142430381 GTGACAACCCACTTAATATACGG + Intergenic
1049569388 8:143361465-143361487 GTTACTGCCTTCTTAACAAATGG + Intergenic
1050709912 9:8449823-8449845 GACTCTGCCCTCTTCCTATAGGG + Exonic
1186690805 X:11973720-11973742 CTCATTGCCCTCCTAATAAATGG - Intergenic
1188429550 X:30090851-30090873 GTGACTGCTCCCATAATATAAGG - Intergenic
1192054657 X:67760726-67760748 GTCAGTGTCCTCTTCACATAGGG - Intergenic
1195675339 X:107503376-107503398 GTCAGTGATCTCTTGATATATGG + Intergenic
1197019765 X:121672707-121672729 GTGACTGCCCTCTGTAGATAGGG - Intergenic
1198597223 X:138249753-138249775 TTCTCTGGCCTCTTATTATAAGG - Intergenic
1198605942 X:138337705-138337727 GTCACTGCTCTTTTAATGCATGG - Intergenic