ID: 906419698

View in Genome Browser
Species Human (GRCh38)
Location 1:45654782-45654804
Sequence CAGAGTCCACAGAATCATGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1390
Summary {0: 1, 1: 0, 2: 3, 3: 123, 4: 1263}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906419694_906419698 -10 Left 906419694 1:45654769-45654791 CCCTTAGAGACACCAGAGTCCAC 0: 1
1: 0
2: 3
3: 7
4: 140
Right 906419698 1:45654782-45654804 CAGAGTCCACAGAATCATGGCGG 0: 1
1: 0
2: 3
3: 123
4: 1263
906419692_906419698 11 Left 906419692 1:45654748-45654770 CCTGTGATTCCAGCATATGCTCC 0: 1
1: 0
2: 0
3: 21
4: 195
Right 906419698 1:45654782-45654804 CAGAGTCCACAGAATCATGGCGG 0: 1
1: 0
2: 3
3: 123
4: 1263
906419689_906419698 27 Left 906419689 1:45654732-45654754 CCAACCAGATGGGTTCCCTGTGA 0: 1
1: 0
2: 2
3: 10
4: 106
Right 906419698 1:45654782-45654804 CAGAGTCCACAGAATCATGGCGG 0: 1
1: 0
2: 3
3: 123
4: 1263
906419691_906419698 12 Left 906419691 1:45654747-45654769 CCCTGTGATTCCAGCATATGCTC 0: 1
1: 0
2: 2
3: 13
4: 194
Right 906419698 1:45654782-45654804 CAGAGTCCACAGAATCATGGCGG 0: 1
1: 0
2: 3
3: 123
4: 1263
906419690_906419698 23 Left 906419690 1:45654736-45654758 CCAGATGGGTTCCCTGTGATTCC 0: 1
1: 0
2: 0
3: 10
4: 138
Right 906419698 1:45654782-45654804 CAGAGTCCACAGAATCATGGCGG 0: 1
1: 0
2: 3
3: 123
4: 1263
906419693_906419698 2 Left 906419693 1:45654757-45654779 CCAGCATATGCTCCCTTAGAGAC 0: 1
1: 0
2: 0
3: 7
4: 100
Right 906419698 1:45654782-45654804 CAGAGTCCACAGAATCATGGCGG 0: 1
1: 0
2: 3
3: 123
4: 1263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906419698 Original CRISPR CAGAGTCCACAGAATCATGG CGG Exonic
900601809 1:3505944-3505966 TGGAGTCCACAGACTCATGGCGG + Intronic
900771928 1:4552231-4552253 GGGAGGCCTCAGAATCATGGTGG + Intergenic
900835984 1:5004462-5004484 GAGAGGCCTCACAATCATGGTGG + Intergenic
901214010 1:7544154-7544176 GGGAGGCCTCAGAATCATGGTGG + Intronic
902150906 1:14442621-14442643 CAGAGGCCACAGACACTTGGAGG + Intergenic
902271102 1:15305782-15305804 GGGAGGCCTCAGAATCATGGTGG - Intronic
902273406 1:15322923-15322945 GGGAGGCCTCAGAATCATGGCGG + Intronic
902456572 1:16537662-16537684 GGGAGGCCTCAGAATCATGGCGG + Intergenic
902474085 1:16671598-16671620 GGGAGGCCTCAGAATCATGGCGG + Intergenic
902484718 1:16735844-16735866 GGGAGGCCTCAGAATCATGGCGG - Intergenic
902495592 1:16870249-16870271 GGGAGGCCTCAGAATCATGGCGG - Intronic
902740335 1:18433488-18433510 GGGAGGCCTCAGAATCATGGCGG - Intergenic
903054920 1:20629249-20629271 GGGAGGCCTCAGAATCATGGCGG + Intergenic
903146659 1:21377114-21377136 GGGAGGCCTCAGAATCATGGCGG - Intergenic
903813475 1:26047312-26047334 CAGAGTCCAGAGAAGCAGAGAGG - Intergenic
904386288 1:30144446-30144468 GGGAGGCCTCAGAATCATGGCGG + Intergenic
904427203 1:30436454-30436476 GAGAGGCCTCAGAATCATGGTGG - Intergenic
904927908 1:34062938-34062960 GGGAGGCCTCAGAATCATGGTGG + Intronic
905171494 1:36112486-36112508 CAGAGTCCACAGGATAAGGTTGG - Intronic
905227077 1:36486018-36486040 AAGAGTTCACAGTATAATGGAGG - Intergenic
905379298 1:37548875-37548897 GAGAGGCCTCACAATCATGGTGG - Intronic
905475469 1:38224090-38224112 GGGAGTCCTCACAATCATGGTGG - Intergenic
905755354 1:40504739-40504761 GAGAGGCCTCACAATCATGGCGG + Intergenic
906020940 1:42628727-42628749 GGGAGGCCTCAGAATCATGGTGG - Intronic
906373093 1:45270845-45270867 GGGAGGCCTCAGAATCATGGTGG - Intronic
906419698 1:45654782-45654804 CAGAGTCCACAGAATCATGGCGG + Exonic
906760997 1:48378531-48378553 GGGAGGCCTCAGAATCATGGTGG + Intronic
907077791 1:51594067-51594089 CAGAGTTCAGAGGATCTTGGGGG - Intronic
907325271 1:53633922-53633944 CAGTGAACAGAGAATCATGGCGG + Intronic
907392382 1:54166698-54166720 GGGAGGCCTCAGAATCATGGCGG + Intronic
907439407 1:54469694-54469716 GGGAGGCCTCAGAATCATGGCGG - Intergenic
907625262 1:56023252-56023274 GAGTGGCCTCAGAATCATGGCGG + Intergenic
907886639 1:58598151-58598173 CAGAAGCCACAGAAGCAGGGAGG - Intergenic
907914540 1:58856568-58856590 GGGAGGCCTCAGAATCATGGTGG - Intergenic
908075977 1:60518450-60518472 TGGAGGCCTCAGAATCATGGTGG + Intergenic
908212963 1:61920458-61920480 GAGAGGCCTCATAATCATGGCGG - Intronic
908624909 1:66029129-66029151 CAGAGGCCTCAGAATCATGGTGG + Intronic
908765887 1:67554405-67554427 GGGAGGCCTCAGAATCATGGTGG - Intergenic
908815949 1:68034464-68034486 GGGAGGCCTCAGAATCATGGTGG + Intergenic
908816416 1:68039910-68039932 GGGAGTCCTCACAATCATGGTGG - Intergenic
908853510 1:68397005-68397027 GGGAGGCCTCAGAATCATGGTGG + Intergenic
908919153 1:69169310-69169332 CAGAAGCCTCAGAATCATGGTGG - Intergenic
909063579 1:70906121-70906143 CGGAGGCCTCAGAATCATGGTGG - Intronic
909253209 1:73384550-73384572 GGGAGGCCTCAGAATCATGGTGG + Intergenic
909529036 1:76660503-76660525 CAGAGTCCAGAGTATCCTGTAGG + Intergenic
909646064 1:77919054-77919076 AGGAGTCCTCAGAATCATGGCGG + Intronic
909681139 1:78293607-78293629 GGGAGGCCTCAGAATCATGGTGG - Intergenic
909700110 1:78512755-78512777 GAGAGGTGACAGAATCATGGAGG + Intronic
910140491 1:84021946-84021968 GGGAGGCCTCAGAATCATGGTGG + Intergenic
910643666 1:89490534-89490556 CAGAGGCCTCACAATCATGGTGG + Intergenic
910715415 1:90224685-90224707 GAGAGGCCTCACAATCATGGTGG - Intergenic
910746828 1:90583303-90583325 GGGAGGCCTCAGAATCATGGCGG - Intergenic
910774384 1:90860947-90860969 GGGAGGCCTCAGAATCATGGCGG + Intergenic
910850105 1:91641684-91641706 GGGAGGCCTCAGAATCATGGCGG - Intergenic
910934220 1:92474236-92474258 CAGTCTCCACAGAATCAAAGCGG + Intergenic
911234737 1:95400008-95400030 CAGAGTCCACACAGTGTTGGAGG + Intergenic
911358373 1:96848241-96848263 GGGAGGCCTCAGAATCATGGAGG - Intergenic
911612030 1:99968429-99968451 GGGAGGCCTCAGAATCATGGCGG + Intergenic
912151114 1:106859969-106859991 GAGAGGCCTCACAATCATGGCGG + Intergenic
912170519 1:107093712-107093734 GAGAGGCCTCACAATCATGGTGG - Intergenic
912279585 1:108298744-108298766 GAGAGGCCTCAGAATCATGGTGG + Intergenic
912288641 1:108395613-108395635 GAGAGGCCTCAGAATCATGGTGG - Intronic
913004636 1:114616925-114616947 GGGAGGCCTCAGAATCATGGTGG + Intronic
913081700 1:115394529-115394551 GGGAGGCCTCAGAATCATGGCGG + Intergenic
913098256 1:115540071-115540093 GGGAGGCCTCAGAATCATGGCGG + Intergenic
913277918 1:117157397-117157419 GGGAGGCCTCAGAATCATGGAGG + Intronic
913489320 1:119364178-119364200 GGGAGTCCTCAGGATCATGGCGG + Intergenic
914394406 1:147251047-147251069 GAGAGGCCTCACAATCATGGTGG - Intronic
914982711 1:152429309-152429331 GGGAGGCCTCAGAATCATGGCGG - Intergenic
914987708 1:152474609-152474631 GAGAGGCCTCACAATCATGGTGG + Intergenic
915080750 1:153350058-153350080 CTGAGTTCACAGAATCAGAGAGG - Intergenic
915336008 1:155142005-155142027 GGGAGGCCTCAGAATCATGGCGG - Intergenic
915865921 1:159499047-159499069 GAGAGGCCTCACAATCATGGTGG - Intergenic
916197775 1:162240846-162240868 CAGAGTTCACAGTCTGATGGCGG + Intronic
916533519 1:165680918-165680940 GGGAGGCCTCAGAATCATGGCGG + Intronic
916733905 1:167590206-167590228 CAGAGGCCTCATAATCATGGTGG - Intergenic
916814274 1:168336780-168336802 GGGAGGCCTCAGAATCATGGCGG + Intergenic
916989182 1:170224070-170224092 GAGAGGCCTCACAATCATGGTGG + Intergenic
917035608 1:170744334-170744356 GAGAGGCCTCACAATCATGGTGG + Intergenic
917100496 1:171440281-171440303 GGGAGGCCTCAGAATCATGGTGG + Intergenic
917111747 1:171556031-171556053 CAGAGTCTACAGAGTCAGGCAGG + Intronic
917118952 1:171629052-171629074 GGGAGTCCTCAGAATCATGGCGG + Intergenic
917396470 1:174600049-174600071 AGGAGGCCTCAGAATCATGGTGG + Intronic
917927171 1:179798932-179798954 CAGAGTCCTCACACTCAGGGTGG - Intronic
918787218 1:188777140-188777162 GAGAGACCTCAGATTCATGGTGG - Intergenic
919248125 1:195015055-195015077 GAGAGGCCTCACAATCATGGTGG + Intergenic
919308635 1:195877551-195877573 GGGAGGCCTCAGAATCATGGCGG + Intergenic
919362573 1:196612753-196612775 GGGAGACCTCAGAATCATGGAGG - Intergenic
919460398 1:197871091-197871113 GGGAGGCCTCAGAATCATGGCGG + Intergenic
919484969 1:198134521-198134543 GAGAGGCCTCACAATCATGGTGG - Intergenic
919586787 1:199448962-199448984 CACAATCCACAGGAACATGGAGG + Intergenic
919656827 1:200205148-200205170 CAGTGTGCACAAAGTCATGGAGG + Intergenic
919900067 1:202037635-202037657 GGGAGGCCTCAGAATCATGGTGG - Intergenic
920860157 1:209699356-209699378 GGGAGGCCTCAGAATCATGGTGG + Intronic
920860440 1:209701248-209701270 GGGAGGCCTCAGAATCATGGCGG + Intronic
920949315 1:210557583-210557605 AGGAGGCCTCAGAATCATGGCGG + Intronic
921000445 1:211038296-211038318 GGGAGGCCTCAGAATCATGGTGG - Intronic
921424546 1:214986163-214986185 GGGAGACCTCAGAATCATGGCGG - Intergenic
921470735 1:215545320-215545342 CAGAATTCACTGAACCATGGTGG + Intergenic
921519093 1:216137332-216137354 GGGAGGCCTCAGAATCATGGTGG + Intronic
921649287 1:217657888-217657910 GAGAGGCCTCACAATCATGGCGG + Intronic
923198139 1:231687326-231687348 GGGAGGCCTCAGAATCATGGCGG + Intronic
923297710 1:232611180-232611202 GGGAGGCCTCAGAATCATGGCGG - Intergenic
923330835 1:232923170-232923192 GGGAGGCCTCAGAATCATGGTGG + Intergenic
923919186 1:238545148-238545170 GGGAGGCCTCAGAATCATGGTGG + Intergenic
923920959 1:238564391-238564413 CGGAGGCCTCACAATCATGGTGG + Intergenic
924504278 1:244666826-244666848 GGGAGGCCTCAGAATCATGGCGG + Intronic
924806414 1:247365246-247365268 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1062808293 10:441669-441691 GGGAGGCCTCAGAATCATGGTGG - Intronic
1063022930 10:2147343-2147365 GAGAGGCCTCACAATCATGGCGG - Intergenic
1063110790 10:3035475-3035497 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1063748754 10:8917944-8917966 GAGAGGCCTCACAATCATGGTGG - Intergenic
1063828434 10:9924984-9925006 GAGAGGCCTCACAATCATGGTGG - Intergenic
1064293335 10:14054912-14054934 GAAAGTCCTCACAATCATGGAGG - Intronic
1064907137 10:20358855-20358877 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1065347869 10:24765946-24765968 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1065398436 10:25267430-25267452 TAGAGATCACTGAATCATGGGGG - Intronic
1065758866 10:28963007-28963029 CAGAGGCCTCACAATCATGGTGG - Intergenic
1065852495 10:29802438-29802460 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1065945689 10:30604021-30604043 GAGAGGCCTCACAATCATGGTGG + Intergenic
1066497260 10:35954383-35954405 CATGGTCCTCAGGATCATGGAGG - Intergenic
1066599744 10:37092377-37092399 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1066600327 10:37098957-37098979 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1066641638 10:37559977-37559999 GAGAGGCCTCACAATCATGGTGG + Intergenic
1066712535 10:38251247-38251269 AGGAGGCCTCAGAATCATGGCGG - Intergenic
1066754098 10:38692344-38692366 AGGAGACCTCAGAATCATGGCGG - Intergenic
1067033197 10:42894119-42894141 GGGAGTCCTCAGAATCATGGTGG - Intergenic
1067721003 10:48727706-48727728 CTTAGTCCTCAGAATCATTGGGG + Intronic
1067812147 10:49438313-49438335 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1068184352 10:53565220-53565242 GAGAGGCCTCACAATCATGGTGG - Intergenic
1068467171 10:57409208-57409230 GAGAGACCTCACAATCATGGCGG - Intergenic
1068509530 10:57946690-57946712 CGGAGGCCTCACAATCATGGTGG - Intergenic
1068571396 10:58633216-58633238 CAGAGGCCTCACAATCGTGGTGG - Intronic
1068625281 10:59239257-59239279 GAGAGGCCTCACAATCATGGTGG + Intronic
1068647166 10:59480631-59480653 GGGAGTCCTCAGAATCATGGTGG + Intergenic
1069173454 10:65261792-65261814 AGGAGGCCTCAGAATCATGGTGG + Intergenic
1069281585 10:66661269-66661291 GGGAGGCCTCAGAATCATGGCGG + Intronic
1070226888 10:74516949-74516971 GGGAGGCCTCAGAATCATGGTGG + Intronic
1070407576 10:76110742-76110764 GGGAGGCCTCAGAATCATGGTGG - Intronic
1071395289 10:85217690-85217712 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1071723320 10:88169527-88169549 CGGAGGCCTCACAATCATGGCGG + Intergenic
1071965865 10:90851935-90851957 GAGAGGCCTCACAATCATGGTGG - Intronic
1071971816 10:90915651-90915673 CAGAGTCAACAGGTTCAAGGTGG + Intronic
1072068857 10:91897138-91897160 CCGAGGCCTCAGAATCATGGCGG - Intergenic
1072550834 10:96475984-96476006 GGGAGTCCTCACAATCATGGTGG - Intronic
1073071967 10:100800173-100800195 CAAAGTCTACAAAATCAGGGTGG - Intronic
1073551201 10:104403307-104403329 GAGAGGCCTCACAATCATGGAGG - Intronic
1073734067 10:106326145-106326167 GGGAGTCCTCACAATCATGGCGG + Intergenic
1074024596 10:109621359-109621381 AGGAGGCCTCAGAATCATGGCGG + Intergenic
1074287339 10:112110537-112110559 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1074534953 10:114322142-114322164 GAGAGGCCTCACAATCATGGTGG - Intronic
1074619757 10:115106741-115106763 GGGAGGCCTCAGAATCATGGTGG - Intronic
1074662517 10:115677634-115677656 GGGAGGCCTCAGAATCATGGCGG - Intronic
1074665742 10:115721491-115721513 GGGAGGCCTCAGAATCATGGTGG + Intronic
1074789531 10:116872556-116872578 AGGAGGCCACACAATCATGGTGG - Intronic
1074966825 10:118498174-118498196 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1075360896 10:121832660-121832682 GAGAGGCCTCAGAATCATAGTGG - Intronic
1075509122 10:123055225-123055247 GGGAGGCCTCAGAATCATGGTGG + Exonic
1075509253 10:123056273-123056295 GGGAGGCCTCAGAATCATGGCGG + Exonic
1075920390 10:126207030-126207052 GGGAGGCCACACAATCATGGCGG - Intronic
1076464679 10:130670919-130670941 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1077193241 11:1264817-1264839 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1077547336 11:3180170-3180192 GGGAGGCCACAGAGTCATGGTGG + Intergenic
1078203285 11:9204074-9204096 CAGAGACCAGAGCAGCATGGAGG - Exonic
1078365245 11:10700853-10700875 GAGAGGCCTCACAATCATGGTGG - Intergenic
1078408169 11:11089373-11089395 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1078440303 11:11359543-11359565 CAGAGTCCACAGAGTCAGGAAGG - Intronic
1078482367 11:11688505-11688527 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1078496848 11:11825849-11825871 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1078553770 11:12301027-12301049 GGGAGGCCTCAGAATCATGGCGG + Intronic
1079176637 11:18148094-18148116 CAGAGGCCTCACAATCATGAAGG + Intronic
1079213335 11:18483529-18483551 GGGAGACCTCAGAATCATGGTGG - Intronic
1079585895 11:22126723-22126745 GGGAGTCCTCACAATCATGGAGG + Intergenic
1079624540 11:22600077-22600099 GGGAGACCTCAGAATCATGGCGG - Intergenic
1079639452 11:22785899-22785921 CACAGTCCATAGCATCATGAAGG - Intronic
1079701411 11:23553206-23553228 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1079826851 11:25206841-25206863 GAGAGGCCTCATAATCATGGTGG - Intergenic
1080153245 11:29077767-29077789 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1080739194 11:35048165-35048187 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1080817591 11:35773157-35773179 GGGAGGCCTCAGAATCATGGCGG - Intronic
1080930497 11:36805144-36805166 CAGAGTCCACACTAGCATGGAGG + Intergenic
1080993897 11:37577590-37577612 GGGAGTCCTCACAATCATGGTGG - Intergenic
1081021887 11:37957872-37957894 GAGAGGCCTCACAATCATGGTGG + Intergenic
1081192348 11:40119478-40119500 CAGAGTCCACAGGCTGATGGAGG - Intronic
1081356475 11:42120548-42120570 CAGAGGCCTCACAATCATGGTGG - Intergenic
1081367560 11:42254451-42254473 CAGAAGCCTCATAATCATGGTGG - Intergenic
1081376066 11:42359987-42360009 TAGAGTTAACTGAATCATGGGGG - Intergenic
1081400225 11:42635065-42635087 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1081400575 11:42637310-42637332 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1081442262 11:43093389-43093411 GAGAGGCCTCACAATCATGGCGG - Intergenic
1081582442 11:44361395-44361417 CAGAGGCGACAGAGTCATGTAGG + Intergenic
1081598874 11:44478050-44478072 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1082091726 11:48095951-48095973 CAGTTTCCACATATTCATGGGGG - Intronic
1082229289 11:49744285-49744307 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1083098351 11:60277057-60277079 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1083500624 11:63104614-63104636 GGGAGGCCTCAGAATCATGGTGG + Intronic
1083814451 11:65124721-65124743 GAGAGTCCAGAGCCTCATGGGGG - Intronic
1084306137 11:68284813-68284835 GGGAGTCCTCACAATCATGGTGG - Intergenic
1084479953 11:69414241-69414263 CAGAGGCCTCACCATCATGGTGG - Intergenic
1084751300 11:71205791-71205813 CAGAGTCCACAGGGTCACTGTGG + Intronic
1084894111 11:72252835-72252857 GAGAGTCCTCACAGTCATGGCGG - Intergenic
1085732261 11:79010057-79010079 GGGAGTCCTCACAATCATGGAGG - Intronic
1085754908 11:79194175-79194197 GGGAGGCCTCAGAATCATGGTGG - Intronic
1085807282 11:79648005-79648027 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1085875899 11:80405622-80405644 CAGAGGCCTCACAATCATGGAGG - Intergenic
1085890654 11:80574466-80574488 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1086231586 11:84577134-84577156 GGAAGTCCTCAGAATCATGGCGG - Intronic
1086231880 11:84579059-84579081 AGGAGGCCTCAGAATCATGGCGG - Intronic
1086620791 11:88884840-88884862 GGGAGGCCTCAGAATCATGGCGG - Intronic
1086721537 11:90127630-90127652 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1086759086 11:90604091-90604113 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1086794431 11:91083126-91083148 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1086995876 11:93354598-93354620 GGGAGGCCTCAGAATCATGGGGG + Intronic
1087189398 11:95236495-95236517 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1087447816 11:98276973-98276995 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1087763541 11:102126547-102126569 AGGAGGCCTCAGAATCATGGCGG - Intronic
1087838141 11:102895260-102895282 GGGAGTCCTCACAATCATGGTGG + Intergenic
1087942594 11:104116909-104116931 GGGAGGCCTCAGAATCATGGAGG - Intronic
1088377504 11:109158797-109158819 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1088427333 11:109718352-109718374 GAGAGGCCTCACAATCATGGTGG + Intergenic
1088696258 11:112368591-112368613 CAGAGCACAGAGAATCAGGGTGG + Intergenic
1088869467 11:113878688-113878710 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1089405356 11:118192989-118193011 CAGAGGTCTCAGAATCATGGCGG - Intergenic
1090208042 11:124896555-124896577 CAGAGCCCACAGTCTCATGGTGG - Exonic
1090401981 11:126454757-126454779 CAGGCTCCCCAGAATCATGTGGG - Intronic
1090431303 11:126648996-126649018 GGGAGGCCTCAGAATCATGGAGG + Intronic
1090506644 11:127321860-127321882 GAGAGGCCTCACAATCATGGTGG + Intergenic
1090666557 11:128918506-128918528 CCCAGGCCACAGAATTATGGAGG + Exonic
1091121556 11:133062143-133062165 CAGAGTCCACAGTGTCAGGGAGG + Intronic
1091215637 11:133899699-133899721 CAGAGTCCACAGAAAGAGAGGGG + Intergenic
1091505108 12:1060136-1060158 GGGAGGCCTCAGAATCATGGTGG + Intronic
1091602772 12:1928078-1928100 CAGAGGCCACAGCAGCCTGGAGG + Intergenic
1091787201 12:3250363-3250385 CAGAGTCTGCAAAATCATGAAGG - Intronic
1091858762 12:3759973-3759995 GGGAGGCCTCAGAATCATGGTGG - Intronic
1092093744 12:5824812-5824834 GGGAGGCCTCAGAATCATGGTGG + Intronic
1092304709 12:7287383-7287405 CAAAGTCAACATGATCATGGTGG - Intergenic
1092325662 12:7528456-7528478 GAGAGGCCTCAGAATCATGGTGG - Intergenic
1093230393 12:16536647-16536669 GGGAGGCCTCAGAATCATGGTGG + Intronic
1093285047 12:17248744-17248766 CAAAGTCCACAGTAACATTGTGG - Intergenic
1093753566 12:22828795-22828817 GAGAGGCCACACAATCATGGCGG - Intergenic
1094342992 12:29433409-29433431 GAGAGGCCTCATAATCATGGCGG - Intronic
1094417092 12:30228613-30228635 GAGAGGCCTCACAATCATGGCGG - Intergenic
1094489378 12:30949406-30949428 GGGAGGCCTCAGAATCATGGTGG + Intronic
1095235169 12:39786370-39786392 GGGAGGCCTCAGAATCATGGTGG - Intronic
1095324364 12:40870114-40870136 GAGAGGCCTCACAATCATGGTGG - Intronic
1095610367 12:44121005-44121027 GAGAGGCCCCACAATCATGGTGG + Intronic
1095623087 12:44282150-44282172 GGGAGGCCTCAGAATCATGGTGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097445458 12:59666688-59666710 GAGAGACCTCACAATCATGGTGG - Intronic
1097707707 12:62885010-62885032 GGGAGGCCTCAGAATCATGGCGG + Intronic
1097757946 12:63427459-63427481 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1097999258 12:65922950-65922972 GGGAGGCCTCAGAATCATGGTGG - Intronic
1098078708 12:66760432-66760454 GGGAGGCCTCAGAATCATGGTGG + Intronic
1098238757 12:68444007-68444029 AAGAGGCCTCAGGATCATGGTGG + Intergenic
1098435387 12:70463380-70463402 CAGATTCCAAAGAATATTGGGGG + Intergenic
1098493953 12:71113292-71113314 GAGAGGCCTCACAATCATGGTGG + Intronic
1099058341 12:77873150-77873172 GAGAGGCCTCACAATCATGGTGG - Intronic
1099104908 12:78485726-78485748 AAGAGGCCTCAGAAACATGGTGG + Intergenic
1099342880 12:81460337-81460359 GGGAGGCCACACAATCATGGTGG - Intronic
1099466860 12:82999553-82999575 GGGAGGCCACAAAATCATGGCGG + Intronic
1099503527 12:83445353-83445375 AGGAGGCCTCAGAATCATGGTGG - Intergenic
1099507923 12:83501239-83501261 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1099537419 12:83861757-83861779 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1099700219 12:86074184-86074206 GGGAGGCCTCAGAATCATGGTGG - Intronic
1099846291 12:88032123-88032145 GAGAGGCCTCAGAATCATGGTGG + Intronic
1100061681 12:90586323-90586345 CGGAGGCCTCACAATCATGGTGG + Intergenic
1100276633 12:93077457-93077479 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1100672518 12:96832207-96832229 GAGAGGCCTCACAATCATGGTGG - Intronic
1100871233 12:98912559-98912581 CAGAGTTCACAGATTAATGAGGG - Intronic
1101116183 12:101533781-101533803 CAGAGTAGTGAGAATCATGGAGG + Intergenic
1101340114 12:103835907-103835929 GGGAGGCCTCAGAATCATGGCGG + Intronic
1101340420 12:103838030-103838052 CAGAGGCCTCAGAATCATGGCGG + Intronic
1101505437 12:105341978-105342000 CAGAGGCCTCACAGTCATGGTGG - Intronic
1101540727 12:105662727-105662749 CAGTGTTCCCAGAATCATGTGGG - Intergenic
1101663407 12:106787588-106787610 GGGAGGCCTCAGAATCATGGTGG + Intronic
1102249129 12:111374078-111374100 CGGAGGCCTCAGAGTCATGGCGG + Intergenic
1102326932 12:111993822-111993844 CAGATACCACAGAATCATCAGGG - Intronic
1102396178 12:112588332-112588354 GAGAGGCCTCACAATCATGGCGG + Intronic
1102758626 12:115366080-115366102 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1102758913 12:115368013-115368035 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1102784748 12:115595294-115595316 CAGGGTCCACATGATGATGGAGG + Intergenic
1103260331 12:119582667-119582689 GAGAGGCCTCACAATCATGGTGG - Intergenic
1103302015 12:119935021-119935043 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1103880614 12:124163279-124163301 GGGAGGCCTCAGAATCATGGTGG + Intronic
1104114510 12:125736410-125736432 GAGAGGCCTCACAATCATGGTGG + Intergenic
1104240658 12:126985805-126985827 GAGAGGCCTCACAATCATGGTGG + Intergenic
1104481163 12:129109720-129109742 GGGAGGCCTCAGAATCATGGCGG - Intronic
1104742611 12:131189410-131189432 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1106121146 13:26861005-26861027 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1106386893 13:29295751-29295773 GGGAGTCCTCACAATCATGGTGG + Intronic
1106631376 13:31478435-31478457 GAGAGGCCTCACAATCATGGCGG + Intergenic
1106633185 13:31498598-31498620 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1106791822 13:33163026-33163048 GGGAGGCCTCAGAATCATGGCGG + Intronic
1106873000 13:34042170-34042192 CAGAGTCCACACCACCAAGGAGG + Intergenic
1106940733 13:34776376-34776398 CTGACTCCAGATAATCATGGCGG - Intergenic
1106978679 13:35252313-35252335 CAGAGCTGACTGAATCATGGGGG - Intronic
1107130885 13:36894394-36894416 AAGAGGCCTCACAATCATGGTGG - Intronic
1107961811 13:45565683-45565705 GGGAGGCCTCAGAATCATGGTGG - Intronic
1108156022 13:47585256-47585278 GAGAAGCCTCAGAATCATGGTGG + Intergenic
1108156031 13:47585319-47585341 GAGAGGTCTCAGAATCATGGCGG + Intergenic
1108603566 13:52015714-52015736 ATGAGGCCTCAGAATCATGGCGG - Intronic
1108933852 13:55863535-55863557 CAGAGGCCTCAGAATCATAGTGG - Intergenic
1109034785 13:57242267-57242289 GAGAGGCCTCACAATCATGGTGG - Intergenic
1109098416 13:58146190-58146212 GGGAGTCCTCACAATCATGGCGG - Intergenic
1109143778 13:58750798-58750820 GAGAGGCCTCAGAATCATGGTGG - Intergenic
1109150797 13:58844985-58845007 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1109221872 13:59647877-59647899 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1109285856 13:60408053-60408075 GGGAGGCCTCAGAATCATGGCGG - Intronic
1109285882 13:60408200-60408222 GGGAGGCCTCAGAATCATGGCGG - Intronic
1109286159 13:60410127-60410149 GGGAGGCCTCAGAATCATGGTGG - Intronic
1109433391 13:62266819-62266841 GAGAGGCCTCAAAATCATGGTGG - Intergenic
1109526418 13:63581396-63581418 GAGAGGCTTCAGAATCATGGCGG + Intergenic
1109824015 13:67693348-67693370 AGGAGCCCTCAGAATCATGGCGG + Intergenic
1110048515 13:70861531-70861553 GGGAGGCCACACAATCATGGTGG + Intergenic
1110083240 13:71344766-71344788 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1110341798 13:74401582-74401604 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1110357093 13:74578997-74579019 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1110453113 13:75659460-75659482 GAGAGGCCTCAGAATCATGGCGG + Intronic
1110455700 13:75688083-75688105 CGGAGGCCTCACAATCATGGTGG - Intronic
1110492259 13:76123623-76123645 GGGAGTCCTCACAATCATGGAGG - Intergenic
1110713709 13:78677787-78677809 GTGAGGCCTCAGAATCATGGTGG + Intergenic
1110902938 13:80846330-80846352 GGGAGACCTCAGAATCATGGTGG - Intergenic
1111234454 13:85390420-85390442 CAGAGGTGACTGAATCATGGGGG + Intergenic
1111334137 13:86799707-86799729 GAGAGGCCTCACAATCATGGTGG - Intergenic
1111475289 13:88738221-88738243 GGGAGACCTCAGAATCATGGTGG - Intergenic
1111498159 13:89081548-89081570 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1111527222 13:89488472-89488494 GAGAGGCCTCAGAATCATGGTGG - Intergenic
1111527467 13:89491508-89491530 GAGAGGCCTCACAATCATGGTGG + Intergenic
1111569549 13:90064450-90064472 GAGAGGCCTCACAATCATGGTGG - Intergenic
1111890052 13:94070108-94070130 CAGAGGCCTCACAATCATGGTGG + Intronic
1111919808 13:94398048-94398070 GAGAGACCTCACAATCATGGTGG - Intronic
1112027352 13:95423602-95423624 AGGAGTCCCCACAATCATGGCGG + Intergenic
1112295068 13:98179314-98179336 CAGAGATAACTGAATCATGGGGG - Intronic
1112671007 13:101638551-101638573 GAGAGGCCTCACAATCATGGTGG + Intronic
1112815414 13:103267474-103267496 GAGAGGCCTCACAATCATGGTGG - Intergenic
1112887758 13:104194525-104194547 GAGAGGCCTCAGAATCATGGCGG - Intergenic
1112963387 13:105156898-105156920 GAGAGGCCTCATAATCATGGTGG + Intergenic
1112968134 13:105224781-105224803 GAGAGGCCTCAGAATGATGGTGG + Intergenic
1112979068 13:105358842-105358864 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1113064681 13:106360868-106360890 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1113068469 13:106394822-106394844 GAGAGGCCTCACAATCATGGTGG + Intergenic
1113470885 13:110545053-110545075 GGGAGACCTCAGAATCATGGTGG - Intronic
1113538446 13:111086437-111086459 GAGAGGCCTCACAATCATGGTGG - Intergenic
1114217328 14:20666724-20666746 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1114388814 14:22283656-22283678 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1114693250 14:24605022-24605044 GAGAGGCCTCACAATCATGGCGG - Intergenic
1114812679 14:25918323-25918345 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1115006999 14:28498282-28498304 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1115010479 14:28539403-28539425 GAGAGGCCTCACAATCATGGTGG - Intergenic
1115113824 14:29855890-29855912 TAGAGGCCTCACAATCATGGTGG - Intronic
1115116043 14:29881364-29881386 GGGAGGCCTCAGAATCATGGTGG - Intronic
1115484213 14:33894071-33894093 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1115527951 14:34300222-34300244 GAGAGACCTCACAATCATGGCGG + Intronic
1115917381 14:38331055-38331077 GTGAGGCCTCAGAATCATGGCGG + Intergenic
1115929645 14:38477070-38477092 GAGAGGCCTCACAATCATGGTGG - Intergenic
1116164001 14:41310669-41310691 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1116316524 14:43402610-43402632 GAGAGGCCTCATAATCATGGTGG + Intergenic
1116448205 14:45036901-45036923 GGGAGGCCTCAGAATCATGGCGG + Intronic
1116589789 14:46757367-46757389 GAGAGGCCTCACAATCATGGCGG - Intergenic
1116986370 14:51224008-51224030 CAGAGGCCTCACAATCATGGTGG + Intergenic
1117186451 14:53245077-53245099 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1117496780 14:56313368-56313390 GAGAGGCCTCACAATCATGGTGG + Intergenic
1118296163 14:64571787-64571809 CGGAGGCCTCACAATCATGGTGG + Intronic
1118657349 14:67967038-67967060 GGGAGGCCTCAGAATCATGGTGG + Intronic
1118933636 14:70265476-70265498 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1119050174 14:71359295-71359317 GGGAGACCACACAATCATGGCGG - Intronic
1119076245 14:71642345-71642367 CAGAGCACAGAGAATCAGGGAGG + Intronic
1120104520 14:80479398-80479420 GAGAGGCCTCAGAATCATGGTGG + Intronic
1120152593 14:81054269-81054291 AAGAGGCCTCACAATCATGGCGG - Intronic
1120324856 14:83010588-83010610 GAGAGGCCTCAAAATCATGGTGG - Intergenic
1120366895 14:83582623-83582645 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1120524015 14:85556910-85556932 GGGAGGCCTCAGAATCATGGCGG + Intronic
1120670135 14:87353791-87353813 GAGAGGCCTCACAATCATGGCGG + Intergenic
1120674153 14:87400706-87400728 CAGAGTCCAGAGAATTAAGTTGG - Intergenic
1120760425 14:88279978-88280000 GGGAGGCCCCAGAATCATGGTGG - Intronic
1120809320 14:88786782-88786804 GGGAGGCCTCAGAATCATGGTGG - Intronic
1120863799 14:89278170-89278192 GAGAGGCCTCACAATCATGGTGG + Intronic
1120914399 14:89697858-89697880 GAGAGGCCTCACAATCATGGTGG - Intergenic
1120916003 14:89711038-89711060 CGGAGGCCTCACAATCATGGTGG + Intergenic
1120951080 14:90042596-90042618 TGGAGTCCTCACAATCATGGTGG + Intronic
1120964129 14:90152577-90152599 GAGAGGCCTCACAATCATGGTGG - Intronic
1121483679 14:94297406-94297428 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1121483959 14:94299318-94299340 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1121536318 14:94693479-94693501 GAGAGGCCACACAATCATGGTGG - Intergenic
1121602461 14:95216126-95216148 GAGAGGCCTCACAATCATGGTGG + Intronic
1121654463 14:95585169-95585191 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1121840882 14:97132819-97132841 CGGAGGCCTCACAATCATGGTGG + Intergenic
1121968143 14:98329456-98329478 CGGAGACCTCACAATCATGGTGG - Intergenic
1122047131 14:99032195-99032217 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1122615907 14:103017822-103017844 CAGATTCCACTGAAGCATTGCGG - Intronic
1123002721 14:105304726-105304748 CAGAGGCCTCACAATCATGGAGG + Exonic
1123757098 15:23405470-23405492 GAGAGGCCTCAGAATCACGGCGG + Intergenic
1123892604 15:24796277-24796299 AGGAGGCCTCAGAATCATGGTGG - Intergenic
1124580914 15:30954115-30954137 CAGAGTGCACATAATCATTCAGG + Intronic
1124621583 15:31277031-31277053 CAGAGTCCACAGAGGCAAGCTGG - Intergenic
1124695677 15:31862488-31862510 GTGAGGCCTCAGAATCATGGCGG + Intronic
1125198121 15:37072003-37072025 CAAAGTCCACAGTAACATGCAGG - Intronic
1125200474 15:37097698-37097720 CTGAGTCCCCAGAATCTTGCCGG - Intronic
1125279139 15:38025960-38025982 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1125304066 15:38290618-38290640 GAGAGGCCTCAGAGTCATGGCGG + Intronic
1125304342 15:38292513-38292535 GGGAGGCCTCAGAATCATGGTGG + Intronic
1125881544 15:43199914-43199936 GGGAGGCCTCAGAATCATGGCGG - Intronic
1126162968 15:45631193-45631215 GGGAGGCCTCAGAATCATGGAGG - Intronic
1126788238 15:52196649-52196671 CAGAGTTCTAAGACTCATGGTGG + Intronic
1126866711 15:52944823-52944845 GGGAGTCCTCAAAATCATGGTGG + Intergenic
1126918219 15:53489822-53489844 CAGAGACCTCACAATCATGGTGG - Intergenic
1127145122 15:56015636-56015658 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1127356645 15:58207233-58207255 GCGAGGCCTCAGAATCATGGTGG - Intronic
1127362838 15:58260161-58260183 GGGAGGCCTCAGAATCATGGTGG - Intronic
1127443542 15:59036577-59036599 CAGAGATAACTGAATCATGGGGG - Intronic
1127805885 15:62519954-62519976 GAGAGGCCTCACAATCATGGTGG + Intronic
1127854789 15:62945483-62945505 GAGAGTCCTCACAATCATGGTGG + Intergenic
1128264154 15:66253212-66253234 CGGAGTCCCCAGACTCAAGGGGG + Intronic
1128710489 15:69867797-69867819 CAGAGGCCATACATTCATGGTGG - Intergenic
1129469311 15:75741738-75741760 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1129469606 15:75743656-75743678 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1130060773 15:80568471-80568493 CAGAATGCCCAGAATCATGACGG + Intronic
1130181790 15:81637158-81637180 GGGAGCCCTCAGAATCATGGTGG - Intergenic
1130782616 15:87059112-87059134 CGGAGGCCTCAGAATCATGGTGG + Intergenic
1131307812 15:91260757-91260779 GGGAGGCCTCAGAATCATGGCGG + Intronic
1131462713 15:92629947-92629969 CAGAGGCCTCACAATCATGGTGG - Intronic
1131800237 15:96060826-96060848 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1131897471 15:97049230-97049252 GGGAGTCCTCATAATCATGGTGG - Intergenic
1132081710 15:98871611-98871633 GAGAGGCCTCAAAATCATGGCGG + Intronic
1132141568 15:99401265-99401287 GAGAGGCCTCACAATCATGGCGG + Intergenic
1133108722 16:3532858-3532880 CAGAGTGCACAGAACCACTGAGG - Intronic
1134331823 16:13258642-13258664 GCGAGGCCTCAGAATCATGGTGG + Intergenic
1134354685 16:13470446-13470468 GAAAGGCCTCAGAATCATGGTGG + Intergenic
1134459220 16:14417227-14417249 GAGAGGCCTCAGAATCACGGTGG - Intergenic
1134542315 16:15077497-15077519 GGGAGGCCTCAGAATCATGGCGG - Intronic
1134583101 16:15388328-15388350 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1134885810 16:17790478-17790500 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1135314600 16:21433869-21433891 GAGAGGCCTCAGAATCATGGTGG - Intronic
1135359893 16:21803579-21803601 GGGAGCCCTCAGAATCATGGCGG - Intergenic
1135367523 16:21866149-21866171 GAGAGGCCTCAGAATCATGGTGG - Intronic
1135444291 16:22505013-22505035 GAGAGGCCTCAGAATCATGGTGG + Intronic
1136193187 16:28631049-28631071 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1136311266 16:29412550-29412572 GAGAGGCCTCAGAATCATGGTGG - Intergenic
1136324713 16:29514343-29514365 GAGAGGCCTCAGAATCATGGTGG - Intergenic
1136439398 16:30254328-30254350 GAGAGGCCTCAGAATCATGGTGG - Intronic
1137802442 16:51273607-51273629 CAAAGTCCCCAGGCTCATGGAGG - Intergenic
1137818414 16:51421341-51421363 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1137818707 16:51423247-51423269 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1137841028 16:51641010-51641032 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1137954433 16:52814706-52814728 CTGACACCACGGAATCATGGAGG + Intergenic
1138899631 16:61253193-61253215 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1139238756 16:65368724-65368746 GGGAGGCCACATAATCATGGTGG - Intergenic
1139812905 16:69637506-69637528 GGGAGGCCTCAGAATCATGGTGG + Intronic
1139858785 16:70003480-70003502 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1139885903 16:70206628-70206650 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1140039769 16:71398397-71398419 CAGAGTCCACTAAATTGTGGTGG + Intergenic
1140566091 16:76044141-76044163 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1140759041 16:78094842-78094864 AGGAGGCCTCAGAATCATGGCGG + Intergenic
1141037659 16:80642640-80642662 GGGAGGCCTCAGAATCATGGAGG + Intronic
1141057908 16:80835710-80835732 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1141313702 16:82939929-82939951 CACAGCCCTCACAATCATGGTGG + Intronic
1141376022 16:83531552-83531574 GAGAGGCCTCACAATCATGGTGG - Intronic
1141693296 16:85608295-85608317 CAGAGTGCACTGAATCCGGGGGG - Intergenic
1142274256 16:89107972-89107994 GGGAGGCCTCAGAATCATGGTGG + Intronic
1143430473 17:6879402-6879424 AAGAGTCCACAGACTCCTGCTGG + Intronic
1143468626 17:7156466-7156488 GAGAGTTCACAGAAACGTGGAGG - Intergenic
1143654444 17:8285710-8285732 AAGAGCCCACAGAATTGTGGAGG + Intergenic
1144213495 17:13034687-13034709 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1145139071 17:20437006-20437028 CAGAGGCCAGAGAACCTTGGAGG - Intergenic
1146619847 17:34388926-34388948 CTGACTGCACAGGATCATGGTGG + Intergenic
1146697236 17:34919019-34919041 GAGAGGCCTCAGAATCATGGCGG - Intergenic
1147331852 17:39704009-39704031 CAGAGTCCAGAGAGACATGAAGG + Intronic
1147377719 17:40032807-40032829 CAGAGTCCACAGAAGGGTGACGG - Intronic
1148287792 17:46411226-46411248 CAGAGGCCTCACAATCATGGTGG + Intergenic
1148309961 17:46628806-46628828 CAGAGGCCTCACAATCATGGTGG + Intronic
1148953875 17:51337438-51337460 CAGAAGCCTCAGAATCAGGGAGG - Intergenic
1148964320 17:51422045-51422067 TATGGTCCAGAGAATCATGGAGG + Intergenic
1149381911 17:56103068-56103090 CACAGTCCCCAGGATCATAGAGG - Intergenic
1150092460 17:62339885-62339907 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1150508681 17:65725697-65725719 GGGAGGCCTCAGAATCATGGTGG + Intronic
1150687586 17:67332958-67332980 GGGAGTCCTCACAATCATGGTGG - Intergenic
1150720744 17:67612261-67612283 CAGGCTCCACAGGGTCATGGGGG + Intronic
1150949457 17:69785850-69785872 GAGAGGCCTCACAATCATGGTGG - Intergenic
1151007819 17:70458540-70458562 CAGAGGCCTCACAATCATGGTGG + Intergenic
1151197155 17:72439761-72439783 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1151232106 17:72692452-72692474 GGGAGGCCTCAGAATCATGGCGG + Intronic
1151269074 17:72979075-72979097 CGGAGGCAACTGAATCATGGGGG + Intronic
1151828086 17:76534847-76534869 CAGGGGCCACAGAACCGTGGAGG - Intronic
1152259435 17:79259222-79259244 CAGAGTCCACAGATGCCAGGTGG - Intronic
1152989566 18:350328-350350 GGGAGGCCTCAGAATCATGGTGG - Intronic
1153011791 18:546381-546403 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1153012115 18:548616-548638 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1153433329 18:5042005-5042027 CGGAGGCCTCGGAATCATGGAGG - Intergenic
1153449565 18:5212018-5212040 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1153684417 18:7530951-7530973 CAGAGACAACTGAAACATGGAGG - Intergenic
1153775016 18:8445133-8445155 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1153820054 18:8825110-8825132 CAGGGTCGACAGCATCACGGCGG + Exonic
1153845168 18:9043031-9043053 CAGATTTCACAGAATCTTGGGGG - Intergenic
1153943755 18:10000314-10000336 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1154396817 18:13998387-13998409 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1155632262 18:27907158-27907180 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1155789761 18:29950845-29950867 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1155880420 18:31141051-31141073 GGGAGGCCTCAGAATCATGGAGG - Intronic
1156364499 18:36413331-36413353 GAGGGGCCACAGACTCATGGGGG - Intronic
1156373424 18:36491187-36491209 GAGAGTCCCCAGGCTCATGGAGG - Intronic
1156640886 18:39096729-39096751 GAGAGGCCTCACAATCATGGTGG + Intergenic
1156650987 18:39227171-39227193 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1156809215 18:41225938-41225960 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1157973218 18:52295146-52295168 AGGAGGCCTCAGAATCATGGTGG + Intergenic
1158029078 18:52940474-52940496 CAGCGTAAATAGAATCATGGTGG - Intronic
1158078579 18:53562010-53562032 GAGAGGCCTCACAATCATGGTGG + Intergenic
1158083480 18:53622091-53622113 GAGAGGCCTCAGAATCATGGTGG - Intergenic
1158221934 18:55159394-55159416 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1158374318 18:56846506-56846528 GGGAGGCCTCAGAATCATGGAGG - Intronic
1158488716 18:57891179-57891201 GGGAGTCCTCATAATCATGGTGG - Intergenic
1158552996 18:58452879-58452901 GGGAGACCTCAGAATCATGGCGG + Intergenic
1158677779 18:59537545-59537567 AAGAGGCCTCACAATCATGGTGG - Intronic
1158684588 18:59601465-59601487 GAGAGGCCTCACAATCATGGTGG - Intronic
1159083301 18:63759854-63759876 TGGAGGCCTCAGAATCATGGGGG - Intronic
1159215436 18:65385983-65386005 GAGAGGCCTCATAATCATGGTGG - Intergenic
1159731749 18:72035619-72035641 AGGAGGCCACACAATCATGGCGG + Intergenic
1159932500 18:74328212-74328234 GAGAGGCCTCACAATCATGGCGG + Intronic
1159982876 18:74807368-74807390 CAGGGTCCCGAGAGTCATGGAGG + Intronic
1160522063 18:79513437-79513459 CAGAGTCCTCAGAAGCCTCGGGG - Intronic
1160629005 18:80232446-80232468 GGGAGGCCTCAGAATCATGGTGG + Intronic
1162596367 19:11632658-11632680 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1162596656 19:11634571-11634593 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1163045800 19:14640896-14640918 GGGAGGCCTCAGAATCATGGCGG - Intronic
1164274487 19:23704614-23704636 GGGAGACCTCAGAATCATGGTGG - Intergenic
1164285828 19:23816734-23816756 AAGAGACCTCACAATCATGGTGG + Intronic
1164634067 19:29779999-29780021 CAGAGTTCTGAGATTCATGGTGG - Intergenic
1164841313 19:31394511-31394533 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1164904029 19:31952245-31952267 GGGAGGCCACACAATCATGGCGG - Intergenic
1165226750 19:34360196-34360218 CAGAATCCCCAGGATCCTGGGGG - Intronic
1165371591 19:35410718-35410740 CAGAAAACATAGAATCATGGTGG + Intergenic
1165984879 19:39759195-39759217 CAGGGACCACAGAAACTTGGAGG - Intergenic
1166165054 19:40981646-40981668 GAGAGGCCTCACAATCATGGTGG + Intergenic
1167820182 19:51920716-51920738 CAAAGTCCACAGCCTCCTGGGGG - Intronic
1168019953 19:53601948-53601970 CAGAGTCCACTGACTCAGGAGGG + Intronic
1168132023 19:54327410-54327432 CAGAGGCCTCACAATCATGGTGG + Intergenic
1168463911 19:56586857-56586879 AGGAGACCTCAGAATCATGGTGG + Intronic
1202707461 1_KI270713v1_random:34012-34034 GGGAGGCCTCAGAATCATGGCGG + Intergenic
925089778 2:1144599-1144621 GGGAGGCCTCAGAATCATGGTGG + Intronic
925107136 2:1301250-1301272 CAGAGTCCACATACTCACTGTGG + Intronic
925167025 2:1722335-1722357 CTGAGTCCTCAGAGTCCTGGTGG + Intronic
925256951 2:2498609-2498631 GGGAGGCCTCAGAATCATGGTGG + Intergenic
925790935 2:7487824-7487846 AAGAGGCCTCACAATCATGGTGG - Intergenic
925805275 2:7642208-7642230 GCGAGGCCTCAGAATCATGGTGG + Intergenic
925871570 2:8276306-8276328 GAGAGGCCTCACAATCATGGCGG - Intergenic
926213468 2:10888986-10889008 GAGAGGCCTCAGAATCATGGCGG + Intergenic
926310705 2:11674013-11674035 GGGAGACCACACAATCATGGTGG + Intergenic
926441710 2:12895736-12895758 GGGAGGCCACAGGATCATGGTGG + Intergenic
926448368 2:12972548-12972570 GGGGGTCCTCAGAATCATGGTGG + Intergenic
926454523 2:13048862-13048884 GGGAGACCTCAGAATCATGGTGG + Intergenic
926607677 2:14913999-14914021 GAGAGGCCTCACAATCATGGTGG + Intergenic
926686597 2:15703111-15703133 GGGAGGCCTCAGAATCATGGCGG + Intronic
926944287 2:18170158-18170180 GGGAGGCCTCAGAATCATGGTGG - Intronic
927061999 2:19431999-19432021 GGGAGGCCACACAATCATGGTGG - Intergenic
927100197 2:19782176-19782198 GGGAGGCCTCAGAATCATGGCGG - Intergenic
927185385 2:20478577-20478599 GGGAGGCCTCAGAATCATGGTGG - Intergenic
927288116 2:21378211-21378233 GGGAGGCCTCAGAATCATGGTGG + Intergenic
927288403 2:21380194-21380216 GGGAGGCCTCAGAATCATGGTGG + Intergenic
927341095 2:21983686-21983708 GGGAGGCCTCAGAATCATGGTGG + Intergenic
927351732 2:22124592-22124614 CAGAACCCAAAGAATGATGGGGG + Intergenic
927409400 2:22807129-22807151 GAGAGGCCTCACAATCATGGAGG + Intergenic
927612750 2:24558396-24558418 GGGAGGCCCCAGAATCATGGCGG + Intronic
927640958 2:24845056-24845078 AGGAGGCCTCAGAATCATGGCGG - Intronic
927749368 2:25653368-25653390 AAGAGGCCTCAGAATCATGGTGG - Intronic
927807662 2:26162206-26162228 AAAATTCCACAGAATCATCGAGG + Intergenic
928104174 2:28457160-28457182 GAGAGGCCTCACAATCATGGCGG - Intronic
928153564 2:28855205-28855227 CAGATTACATAGAATCATGCAGG + Intronic
928250076 2:29668816-29668838 CGGAGACCTCACAATCATGGTGG + Intronic
928465452 2:31518744-31518766 GGGAGGCCTCAGAATCATGGTGG - Intergenic
928680260 2:33694012-33694034 AGGAGGCCTCAGAATCATGGTGG + Intergenic
928771720 2:34709905-34709927 GAGAGGCCTCAAAATCATGGTGG - Intergenic
928777243 2:34780549-34780571 GGGAGGCCTCAGAATCATGGTGG + Intergenic
928890796 2:36200645-36200667 CGGAGGCCTCACAATCATGGTGG - Intergenic
928927307 2:36593183-36593205 AGGAGGCCTCAGAATCATGGTGG + Intronic
929134392 2:38609272-38609294 GTGAGGCCTCAGAATCATGGTGG + Intergenic
929251153 2:39757074-39757096 TAGAGACCAAAGAATCATGACGG + Intronic
929552996 2:42906120-42906142 CAGGGTCCACAGATTCATGCTGG + Intergenic
929851213 2:45592155-45592177 GGGAGGCCTCAGAATCATGGTGG - Intronic
930006652 2:46903240-46903262 GGGAGGCCTCAGAATCATGGTGG - Exonic
930006935 2:46905107-46905129 GGGAGGCCTCAGAATCATGGCGG - Exonic
930155424 2:48102722-48102744 GAGAGGCCTCAGAATTATGGCGG + Intergenic
930183376 2:48386532-48386554 AAGGGTCCACAGACTCCTGGTGG - Intergenic
930263268 2:49171212-49171234 GAGAGGCCTCACAATCATGGTGG - Intergenic
930309810 2:49726373-49726395 CAGAGGCCTCAGATTCATGGTGG + Intergenic
930444442 2:51452114-51452136 GGGAGGCCTCAGAATCATGGCGG - Intergenic
930503554 2:52254764-52254786 GGGAGGCCTCAGAATCATGGTGG + Intergenic
930941985 2:57024858-57024880 GTGAGTCCTCACAATCATGGCGG + Intergenic
931174562 2:59840191-59840213 CGGAGGCCTCACAATCATGGTGG - Intergenic
931294242 2:60906015-60906037 GGGAGGCCTCAGAATCATGGCGG + Intronic
931407217 2:61990616-61990638 GAGAGGCCTCACAATCATGGTGG + Intronic
931793107 2:65682973-65682995 GAGAGGCCTCACAATCATGGTGG - Intergenic
932317861 2:70798092-70798114 GGGAGGCCTCAGAATCATGGTGG + Intergenic
932318135 2:70800015-70800037 GGGAGGCCTCAGAATCATGGTGG + Intergenic
932976299 2:76603361-76603383 GGGAGGCCTCAGAATCATGGTGG + Intergenic
933064926 2:77780851-77780873 GGGAGGCCTCAGAATCATGGTGG - Intergenic
933065159 2:77782729-77782751 GGGAGGCCTCAGAATCATGGGGG - Intergenic
933350236 2:81144894-81144916 GGGAGGCCTCAGAATCATGGTGG + Intergenic
933402031 2:81810353-81810375 GGGAGGCCTCAGAATCATGGTGG - Intergenic
933423834 2:82085831-82085853 CAGAGACAACTGAATCATGGGGG - Intergenic
933786003 2:85842065-85842087 CAGAGTTCACAGATTCAGGTGGG + Intronic
934317398 2:91936681-91936703 AGGAGACCTCAGAATCATGGCGG - Intergenic
935095006 2:99935864-99935886 CAGAGTCCCCAGCGACATGGAGG + Intronic
935151194 2:100438001-100438023 GAGAGGCTTCAGAATCATGGAGG - Intergenic
935608471 2:104995282-104995304 GGGAGGCCTCAGAATCATGGTGG + Intergenic
935896507 2:107743626-107743648 GAGAGGCCTCACAATCATGGTGG - Intergenic
935927654 2:108088161-108088183 GGGAGGCCTCAGAATCATGGTGG - Intergenic
936114329 2:109690070-109690092 CAGGGTTCACAGTACCATGGTGG - Intergenic
936549945 2:113428288-113428310 GAGAGGCCTCACAATCATGGCGG - Intergenic
936792500 2:116165821-116165843 TGGAGGCCTCAGAATCATGGCGG - Intergenic
936827681 2:116602051-116602073 GGGAGGCCTCAGAATCATGGTGG - Intergenic
936897729 2:117446835-117446857 GGGAGTCCTCACAATCATGGTGG - Intergenic
937398840 2:121563904-121563926 GAGAGGCCTCACAATCATGGGGG + Intronic
937518872 2:122686573-122686595 GGGAGGCCTCAGAATCATGGTGG + Intergenic
937614281 2:123902373-123902395 GGGAGTCCACAGAATCATTGAGG + Intergenic
937799468 2:126064878-126064900 AAGAGGCCTCACAATCATGGCGG - Intergenic
937881115 2:126865609-126865631 GGGAGGCCTCAGAATCATGGCGG + Intergenic
938687737 2:133756823-133756845 GGGAGGCCTCAGAATCATGGTGG + Intergenic
939079061 2:137638416-137638438 GGGAGGCCTCAGAATCATGGTGG - Intronic
939136081 2:138295952-138295974 CCGAGGCCTCACAATCATGGTGG + Intergenic
939559135 2:143713200-143713222 GAGAGACCTCAGAATCATGGCGG + Intronic
939741777 2:145916859-145916881 GGGAGTCCACAGGATCATTGTGG + Intergenic
940616179 2:156051377-156051399 GGGAGGCCTCAGAATCATGGTGG + Intergenic
940622261 2:156126920-156126942 GAGAGGCCCCACAATCATGGTGG + Intergenic
940790626 2:158026825-158026847 GAGAGACCTCAGAATCATGGTGG + Intronic
940986877 2:160059733-160059755 GGGAGTCCTCAGAATCATGGTGG + Intronic
941335797 2:164241793-164241815 CAGAAGCCTCACAATCATGGTGG + Intergenic
941450857 2:165658662-165658684 GAGAGGCCTCACAATCATGGCGG + Intronic
941560163 2:167035058-167035080 GGGAGGCCTCAGAATCATGGTGG - Intronic
941560444 2:167036970-167036992 GGGAGGCCTCAGAATCATGGCGG - Intronic
941742043 2:169045225-169045247 GGGAGGCCTCAGAATCATGGCGG - Intergenic
942054438 2:172169005-172169027 AGGAGGCCTCAGAATCATGGTGG - Intergenic
942387968 2:175461762-175461784 AGGAGGCCTCAGAATCATGGCGG - Intergenic
942949962 2:181711304-181711326 GGGAGGCCTCAGAATCATGGTGG - Intergenic
942991652 2:182209190-182209212 GAGAGGCCTCACAATCATGGTGG + Intronic
943072034 2:183152983-183153005 GACAGGCCTCAGAATCATGGTGG + Intronic
943072330 2:183154900-183154922 GGGAGGCCTCAGAATCATGGCGG + Intronic
943081034 2:183259467-183259489 GAGAGGCCTCACAATCATGGTGG - Intergenic
943208442 2:184930958-184930980 GGGAGTCCTCACAATCATGGTGG + Intronic
943543417 2:189244903-189244925 GAGAGGCCTCACAATCATGGCGG + Intergenic
943864626 2:192914028-192914050 CAGAGGCAATTGAATCATGGAGG - Intergenic
943880795 2:193141419-193141441 GAGAGGCCTCACAATCATGGTGG + Intergenic
943978038 2:194509023-194509045 GGGAGGCCTCAGAATCATGGTGG + Intergenic
943981879 2:194562560-194562582 GAGAGTCCTCACAATCATGATGG - Intergenic
944106253 2:196082751-196082773 GGGAGGCCTCAGAATCATGGTGG - Intergenic
944477620 2:200123997-200124019 GGGAGGCCTCAGAATCATGGTGG + Intergenic
944828128 2:203505270-203505292 GGGAGGCCTCAGAATCATGGTGG + Intronic
944931152 2:204521010-204521032 CATAGAGCACAGAAGCATGGAGG + Intergenic
945090135 2:206170586-206170608 CGGAGGCCTCACAATCATGGTGG + Intergenic
945480186 2:210336381-210336403 GGGAGGCCTCAGAATCATGGCGG - Intergenic
945599427 2:211840301-211840323 GAGAGACCTCACAATCATGGTGG - Intronic
945709362 2:213277189-213277211 AGGAGGCCTCAGAATCATGGTGG - Intergenic
945759907 2:213902388-213902410 AGGAGGCCTCAGAATCATGGTGG + Intronic
946017223 2:216613768-216613790 GGGAGGCCTCAGAATCATGGCGG + Intergenic
946455250 2:219820405-219820427 AAGAGGCCACAGAATAATGAAGG + Intergenic
946558550 2:220887128-220887150 GAGAGGCCTCACAATCATGGTGG + Intergenic
946802174 2:223430070-223430092 GGGAGTCCTCACAATCATGGCGG - Intergenic
946825307 2:223671802-223671824 GGGAGGCCCCAGAATCATGGTGG - Intergenic
946832311 2:223739315-223739337 GGGAGGCCTCAGAATCATGGCGG + Intergenic
946867446 2:224055204-224055226 AAGAGGCCTCACAATCATGGTGG + Intergenic
946976455 2:225157916-225157938 GAGAGGCCTCACAATCATGGTGG + Intergenic
947084527 2:226436327-226436349 CAGAGGTCACATAATCATGGCGG + Intergenic
947296290 2:228634729-228634751 GAGAGGCCTCATAATCATGGAGG + Intergenic
947646768 2:231747948-231747970 GAGAGGCCTCAGAATCATGGCGG - Intronic
947759993 2:232597176-232597198 CAGAGTCAACAGCATCAGTGAGG + Intergenic
948296496 2:236864522-236864544 GGGAGGCCTCAGAATCATGGTGG + Intergenic
948296756 2:236866401-236866423 CGGAGGCCTCAGAATCATGGTGG + Intergenic
948346418 2:237302662-237302684 GGGAGACCTCAGAATCATGGCGG - Intergenic
948346684 2:237304570-237304592 GGGAGGCCTCAGAATCATGGTGG - Intergenic
948551278 2:238774543-238774565 GGGAGGCCTCAGAATCATGGTGG + Intergenic
948687686 2:239679308-239679330 CAAAGTCAACAGAATCTTTGTGG - Intergenic
948785864 2:240352607-240352629 GGGAGGCCTCAGAATCATGGTGG + Intergenic
949079636 2:242086532-242086554 CAGAGCCCACAGAGTAATGTCGG - Intergenic
1169249547 20:4049847-4049869 GAGAGGCCTCAGAATCATGGCGG + Intergenic
1169409143 20:5352379-5352401 TGGAGGCCTCAGAATCATGGCGG + Intergenic
1169766295 20:9151594-9151616 GGGAGGCCTCAGAATCATGGCGG - Intronic
1169766568 20:9153523-9153545 GGGAGGCCTCAGAATCATGGCGG - Intronic
1169999090 20:11595559-11595581 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1170643725 20:18178485-18178507 GGGAGACCTCAGAATCATGGTGG + Intronic
1170851143 20:20005416-20005438 CCCAGCCCACAGAATCATGGTGG - Intergenic
1171335107 20:24377905-24377927 CGGAGGCCTCAGAATTATGGTGG - Intergenic
1171773843 20:29347937-29347959 AAGAGGCCTCAGAATCATGGTGG + Intergenic
1171815852 20:29785489-29785511 AAGAGGCCTCAGAATCATGGTGG + Intergenic
1171902520 20:30870548-30870570 AAGAGACCTCAGAATCATGGTGG - Intergenic
1172307976 20:33895251-33895273 CATACTCCACATAATCCTGGAGG + Intergenic
1173023400 20:39286467-39286489 GGAAGTCCTCAGAATCATGGCGG - Intergenic
1173545673 20:43896004-43896026 GGGAGACCTCAGAATCATGGAGG - Intergenic
1173960174 20:47064973-47064995 CGGAGGCCTCACAATCATGGTGG + Intronic
1174749704 20:53099781-53099803 CAGAGACAATTGAATCATGGGGG - Intronic
1174856964 20:54055358-54055380 GGGAGGCCTCAGAATCATGGCGG + Intronic
1174926729 20:54768360-54768382 GAGAGGCCTCATAATCATGGTGG - Intergenic
1174960739 20:55154325-55154347 AAGAGGCCTCACAATCATGGTGG - Intergenic
1175008356 20:55709895-55709917 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1175060363 20:56236583-56236605 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1175126350 20:56754833-56754855 CAAAGTCCTAAGAATCCTGGGGG - Intergenic
1175195212 20:57238746-57238768 GGGAGGCCTCAGAATCATGGCGG + Intronic
1176130692 20:63495607-63495629 CAGAGTCCCCAGATAGATGGGGG - Intronic
1176205908 20:63888022-63888044 CAGAATCCTGAGAATCAGGGTGG - Intronic
1176933832 21:14843734-14843756 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1177118013 21:17109115-17109137 GGGAGTCCTCAGAATCATGGTGG + Intergenic
1177118275 21:17111032-17111054 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1177139578 21:17343783-17343805 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1177226884 21:18268494-18268516 GAGAGGCCTCACAATCATGGTGG - Intergenic
1177392763 21:20498210-20498232 GGGAGACCTCAGAATCATGGTGG + Intergenic
1177393056 21:20501339-20501361 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1177477793 21:21645778-21645800 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1177502483 21:21975952-21975974 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1177523880 21:22267721-22267743 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1177740421 21:25147198-25147220 GGGAGCCCTCAGAATCATGGTGG + Intergenic
1177821074 21:26031504-26031526 GGGAGGCCTCAGAATCATGGCGG + Intronic
1177847080 21:26302104-26302126 GAGAGGCCTCACAATCATGGTGG + Intergenic
1177909525 21:27013370-27013392 CAGATGCCTCACAATCATGGTGG - Intergenic
1177981201 21:27916456-27916478 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1178004211 21:28197866-28197888 GGGAGTCCTTAGAATCATGGCGG + Intergenic
1178099439 21:29252237-29252259 GGGAGGCCTCAGAATCATGGAGG + Intronic
1178261719 21:31106168-31106190 GAGAGGCCTCACAATCATGGTGG + Intergenic
1178469151 21:32876150-32876172 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1178750362 21:35296990-35297012 GAGAGGCCTCACAATCATGGCGG - Intronic
1179214756 21:39357910-39357932 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1179235435 21:39541358-39541380 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1179235887 21:39545456-39545478 GGGAGACCTCAGAATCATGGCGG - Intergenic
1179316618 21:40249441-40249463 TGGAGGCCTCAGAATCATGGTGG - Intronic
1179469268 21:41599700-41599722 GGGAGTCCTCACAATCATGGTGG - Intergenic
1179560979 21:42215999-42216021 CAGAGATCACTGAATCATAGGGG + Intronic
1180102195 21:45593671-45593693 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1180305572 22:11120473-11120495 AGGAGACCTCAGAATCATGGCGG - Intergenic
1180319303 22:11306052-11306074 AAGAGGCCTCAGAATCATGGTGG + Intergenic
1180335908 22:11576517-11576539 AAGAGACCTCAGAATCATGGTGG - Intergenic
1180525057 22:16250647-16250669 CATAGGCCTCACAATCATGGTGG + Intergenic
1180544091 22:16482652-16482674 AGGAGACCTCAGAATCATGGCGG - Intergenic
1182207115 22:28639700-28639722 TGGAGTCCTCACAATCATGGTGG - Intronic
1182327667 22:29525994-29526016 CAGAGTGAACAGAGTCATAGGGG + Intronic
1182913790 22:34009539-34009561 CAGAGGCCTCTGAACCATGGAGG - Intergenic
1183022396 22:35037934-35037956 GAGAGGCCTCACAATCATGGCGG + Intergenic
1184654968 22:45936493-45936515 CAGAGTCCTCAGAGACATGTGGG + Intronic
1184994575 22:48196058-48196080 GAGAGGCCTCACAATCATGGTGG - Intergenic
1185240359 22:49739636-49739658 GGGAGGCCTCAGAATCATGGTGG - Intergenic
949146409 3:705821-705843 GAGAGGCCTCAAAATCATGGTGG - Intergenic
949424937 3:3906670-3906692 GAGAGGCCTCAGAATCATGGTGG - Intronic
949749132 3:7330691-7330713 GGGAGGCCTCAGAATCATGGTGG - Intronic
949939615 3:9144690-9144712 GGGAGGCCTCAGAATCATGGTGG - Intronic
949966432 3:9360606-9360628 CGGAGGCCTCACAATCATGGTGG + Intronic
950307346 3:11926336-11926358 CAGAGTACTCAGATTCATAGAGG - Intergenic
950700532 3:14742743-14742765 GGGAGGCCTCAGAATCATGGTGG + Intronic
951192672 3:19787692-19787714 GGGAGGCCTCAGAATCATGGTGG - Intergenic
951289832 3:20862373-20862395 CAGAGGCCTCACAATCATGGTGG + Intergenic
951359070 3:21703174-21703196 GGGAGGCCTCAGAATCATGGCGG + Intronic
952044627 3:29303855-29303877 GGGAGGCCTCAGAATCATGGTGG + Intronic
952170122 3:30798337-30798359 AGGAGGCCTCAGAATCATGGTGG + Intronic
952195601 3:31072609-31072631 GGGAGCCCTCAGAATCATGGCGG - Intergenic
952480356 3:33754709-33754731 GGGAGGCCACAAAATCATGGTGG + Intergenic
952569768 3:34700825-34700847 GAGAGGCCTCAAAATCATGGTGG + Intergenic
952715218 3:36473052-36473074 GAGAAGCCTCAGAATCATGGCGG + Intronic
952932922 3:38374161-38374183 GAGAGTGCAGAGAATCAAGGAGG - Intronic
953134610 3:40171898-40171920 GGGAGGCCACACAATCATGGTGG + Intronic
953224172 3:41001367-41001389 CAGAGTTTACAAACTCATGGGGG - Intergenic
953685661 3:45076596-45076618 GGGAGGCCTCAGAATCATGGTGG - Intergenic
953685944 3:45078534-45078556 GGGAGGCCTCAGAATCATGGTGG - Intergenic
953745858 3:45573489-45573511 CAGAGGCCTCTCAATCATGGTGG - Intronic
954539046 3:51381731-51381753 CAGAGGCCACAGCAGCATGAAGG + Exonic
954732497 3:52676498-52676520 GGGAGGCCTCAGAATCATGGTGG - Intronic
954759418 3:52863271-52863293 GGGAGGCCTCAGAATCATGGCGG + Intronic
954759734 3:52865476-52865498 GGGAGGCCTCAGAATCATGGTGG + Intronic
954977742 3:54712575-54712597 GAGAGGCCTCACAATCATGGTGG - Intronic
955435335 3:58893907-58893929 GAGAGGCCTCACAATCATGGTGG + Intronic
955530146 3:59864400-59864422 GGGAGTCCTCAGAATCATGGTGG - Intronic
955614836 3:60795981-60796003 GGGAGGCCTCAGAATCATGGCGG + Intronic
956546220 3:70406980-70407002 GGGAGGCCTCAGAATCATGGTGG + Intergenic
956739817 3:72267060-72267082 GAGAGGCCTCACAATCATGGCGG + Intergenic
956936274 3:74105406-74105428 GGGAGGCCTCAGAATCATGGTGG + Intergenic
957137487 3:76307935-76307957 CAGAGACAACAGTTTCATGGAGG + Intronic
957274550 3:78074120-78074142 GGGAGGCCTCAGAATCATGGTGG + Intergenic
957630363 3:82710265-82710287 GGGAGGCCTCAGAATCATGGTGG + Intergenic
957630652 3:82712183-82712205 GGGAGGCCTCAGAATCATGGTGG + Intergenic
957662479 3:83178469-83178491 GGGAGGCCTCAGAATCATGGCGG + Intergenic
957782753 3:84840974-84840996 GAGAGGCCTCACAATCATGGTGG + Intergenic
957981876 3:87520596-87520618 GGGAGGCCTCAGAATCATGGTGG - Intergenic
958481761 3:94652804-94652826 GGGAGGCCTCAGAATCATGGTGG - Intergenic
958553436 3:95644506-95644528 CGGAGACCTCAAAATCATGGTGG + Intergenic
958661313 3:97071460-97071482 GGGAGGCCTCAGAATCATGGCGG + Intronic
958684605 3:97377331-97377353 GGGAGGCCTCAGAATCATGGTGG - Intronic
958684868 3:97379217-97379239 GGGAGTCCTCAGAATCATGATGG - Intronic
958910970 3:99994718-99994740 GGGAGGCCTCAGAATCATGGTGG + Intronic
958911261 3:99996638-99996660 GGGAGTCCTCAGAATCATAGTGG + Intronic
959172161 3:102856095-102856117 GGGAGGCCTCAGAATCATGGTGG + Intergenic
959367268 3:105477057-105477079 GGGAGGCCTCAGAATCATGGTGG - Intronic
959727238 3:109558274-109558296 GGGAGGCCTCAGAATCATGGCGG - Intergenic
959756370 3:109904924-109904946 GGGAGGCCTCAGAATCATGGTGG + Intergenic
959975099 3:112450052-112450074 GGGAGGCCTCAGAATCATGGCGG + Intergenic
960009484 3:112817889-112817911 GGGAGGCCCCAGAATCATGGGGG + Intronic
960255246 3:115504905-115504927 GGGAGGCCTCAGAATCATGGCGG - Intergenic
960496605 3:118383150-118383172 GGGAGGCCTCAGAATCATGGTGG - Intergenic
960841263 3:121962158-121962180 GGGAGGCCTCAGAATCATGGAGG - Intergenic
961257943 3:125572685-125572707 GAGAGGCCTCACAATCATGGCGG - Intronic
961279225 3:125752687-125752709 GAGCGTCCACAGAAGCATTGGGG - Intergenic
962033674 3:131628309-131628331 GGGAGGCCTCAGAATCATGGTGG + Intronic
962045922 3:131758906-131758928 GGGAGGCCTCAGAATCATGGTGG - Intronic
962368824 3:134804208-134804230 GGGAGGCCTCAGAATCATGGTGG + Intronic
962440317 3:135407278-135407300 AGGAGGCCTCAGAATCATGGCGG + Intergenic
962672728 3:137725844-137725866 GGGAGGCCTCAGAATCATGGCGG + Intergenic
962769824 3:138601957-138601979 GGGAGGCCTCAGAATCATGGGGG - Intergenic
963311506 3:143715064-143715086 GAGAGACCTCACAATCATGGTGG - Intronic
963356403 3:144213476-144213498 GGGAGGCCTCAGAATCATGGTGG + Intergenic
963374717 3:144449549-144449571 GGGAGGCCTCAGAATCATGGCGG - Intergenic
963418235 3:145026681-145026703 CAGAGGCCCCACAATCATGGTGG - Intergenic
963568325 3:146960408-146960430 GAGAGGCCTCACAATCATGGCGG + Intergenic
964044655 3:152308599-152308621 CTGAGTCCTTAGAAACATGGGGG - Intronic
964076542 3:152699826-152699848 AGGAGGCCTCAGAATCATGGTGG + Intergenic
964098732 3:152963639-152963661 GGGAGGCCTCAGAATCATGGTGG + Intergenic
964150364 3:153517734-153517756 GAGAGGCCTCACAATCATGGTGG + Intergenic
964426604 3:156560845-156560867 GGGAGGCCTCAGAATCATGGCGG - Intergenic
964427265 3:156567317-156567339 GGGAGGCCTCAGAATCATGGTGG - Intergenic
964508691 3:157426069-157426091 GGGAGGCCTCAGAATCATGGCGG - Intronic
964520538 3:157562500-157562522 GGGAGGCCTCAGAATCATGGTGG + Intronic
964520865 3:157564739-157564761 GAAAGGCCTCAGAATCATGGTGG + Intronic
964910640 3:161776309-161776331 AGGAGGCCTCAGAATCATGGTGG - Intergenic
965013207 3:163124402-163124424 GGGAGGCCACACAATCATGGTGG + Intergenic
965025201 3:163292715-163292737 GAGAGGCCTCAGACTCATGGTGG + Intergenic
965087038 3:164112810-164112832 GAGAGGCCTCAGAATCATGGCGG + Intergenic
965267969 3:166571944-166571966 GAGAGGCCTCAGAATTATGGTGG - Intergenic
965299687 3:166994608-166994630 CAGAATCCCCAGAATCCTGGAGG + Intergenic
965458322 3:168930896-168930918 GGGAGGCCTCAGAATCATGGTGG + Intergenic
965499891 3:169444541-169444563 GGGAGACCTCAGAATCATGGCGG - Intronic
966123250 3:176547062-176547084 GGGAGGCCTCAGAATCATGGTGG + Intergenic
966123515 3:176548977-176548999 GGGAGGCCTCAGAATCATGGTGG + Intergenic
966733195 3:183167774-183167796 GGGAGGCCTCAGAATCATGGTGG + Intergenic
966838809 3:184071273-184071295 GGGAGGCCTCAGAATCATGGTGG + Intergenic
966998722 3:185311259-185311281 GGGAGACCTCAGAATCATGGCGG + Intronic
967609304 3:191484236-191484258 GAGAGGCCTCAGAATCATGGTGG - Intergenic
967654598 3:192031827-192031849 CAGAGTCCACAGATGCATGGAGG - Intergenic
967689418 3:192457121-192457143 GGGAGGCCTCAGAATCATGGTGG - Intronic
967689691 3:192459045-192459067 GGGAGGCCTCAGAATCATGGTGG - Intronic
967717002 3:192774401-192774423 TGGAGGCCTCAGAATCATGGTGG - Intergenic
967717284 3:192776273-192776295 GAGAGGTCTCAGAATCATGGTGG - Intergenic
969072464 4:4550525-4550547 GGGAGGCCTCAGAATCATGGCGG - Intergenic
969072728 4:4552431-4552453 GGGAGGCCTCAGAATCATGGCGG - Intergenic
969535473 4:7754122-7754144 GGGAGGCCTCAGAATCATGGCGG - Intergenic
970305962 4:14733141-14733163 GGGAGGCCTCAGAATCATGGAGG + Intergenic
970339002 4:15085327-15085349 AAGAGGCCTCAGATTCATGGTGG + Intergenic
970361405 4:15311855-15311877 GGGAGGCCTCAGAATCATGGTGG - Intergenic
970554061 4:17214180-17214202 CGAAGGCCTCAGAATCATGGTGG + Intergenic
970581623 4:17478657-17478679 GGGAGGCCTCAGAATCATGGCGG + Intronic
970742712 4:19256414-19256436 GAGAGACCTCACAATCATGGTGG - Intergenic
970868282 4:20783431-20783453 GGGAGGCCTCAGAATCATGGTGG + Intronic
970978914 4:22074400-22074422 GGGAGGCCTCAGAATCATGGTGG - Intergenic
971051169 4:22864243-22864265 GAGAGGCCTCAGAATCATGGTGG - Intergenic
971057996 4:22935248-22935270 GGGAGGCCTCAGAATCATGGTGG + Intergenic
971224770 4:24741287-24741309 GAGCGTCCTCAGAATCATAGCGG - Intergenic
971252113 4:24981706-24981728 GAGAGGCCTCACAATCATGGTGG - Intergenic
971533162 4:27714743-27714765 GAGAGGCCTCACAATCATGGTGG - Intergenic
971600061 4:28581247-28581269 CAGAAGCCTCAGAATCATGGTGG - Intergenic
971631353 4:28997658-28997680 GAGAGGCCTCACAATCATGGTGG - Intergenic
971649841 4:29257548-29257570 CAGAGGCTTCACAATCATGGTGG - Intergenic
971668782 4:29528897-29528919 GAGAGGCCTCACAATCATGGTGG - Intergenic
971793772 4:31200586-31200608 TGGAGGCCTCAGAATCATGGTGG + Intergenic
971816124 4:31492037-31492059 GAGAGGCCTCACAATCATGGTGG + Intergenic
971833627 4:31732744-31732766 GGGAGGCCTCAGAATCATGGTGG - Intergenic
971977022 4:33703383-33703405 CAGAGGCAACTGAATCATGGGGG + Intergenic
971996154 4:33967283-33967305 GGGAGGCCTCAGAATCATGGCGG - Intergenic
972014330 4:34225206-34225228 GGGAGGCCTCAGAATCATGGTGG - Intergenic
972023239 4:34341801-34341823 GGGAGGCCACACAATCATGGTGG + Intergenic
972345296 4:38187948-38187970 GAGAGGCCTCACAATCATGGTGG - Intergenic
972567375 4:40281908-40281930 GAGAGGCCTCACAATCATGGTGG - Intergenic
972841173 4:42931900-42931922 CGGAGGCCTCACAATCATGGTGG + Intronic
972856975 4:43119499-43119521 GAGAGGCCTCAGAATCATAGTGG + Intergenic
972957121 4:44406528-44406550 GGGAGGCCTCAGAATCATGGTGG - Intronic
973072851 4:45886429-45886451 CAGAGGCCTCACAATCATGGTGG - Intergenic
973102275 4:46287918-46287940 TAGAGGCCTCACAATCATGGTGG + Intronic
973128112 4:46614275-46614297 GGGAGACCTCAGAATCATGGCGG + Intergenic
973156674 4:46963537-46963559 GGGAGGCCTCAGAATCATGGTGG - Intronic
973332697 4:48925583-48925605 GAGAGGCCACATAATCATGGTGG + Intergenic
974012908 4:56623766-56623788 GGGAGGCCTCAGAATCATGGTGG - Intergenic
974013191 4:56625692-56625714 GGGAGGCCTCAGAATCATGGCGG - Intergenic
974145254 4:57938186-57938208 CGGAGGCATCAGAATCATGGTGG - Intergenic
974324262 4:60393530-60393552 GGGAGGCCACACAATCATGGTGG - Intergenic
974408546 4:61508859-61508881 AGGAGGCCTCAGAATCATGGCGG + Intronic
974480720 4:62439146-62439168 GAGAGACCTCAGAATCATGGCGG + Intergenic
974495136 4:62616177-62616199 GGGAGGCCTCAGAATCATGGTGG + Intergenic
974495219 4:62616865-62616887 GGGAGGCCTCAGAATCATGGTGG - Intergenic
974679979 4:65147879-65147901 CAGATGCCTCATAATCATGGTGG + Intergenic
974753410 4:66171285-66171307 GGGAGGCCTCAGAATCATGGTGG + Intergenic
975253824 4:72212081-72212103 GGGAGGCCACAGAATCATGGAGG + Intergenic
975804160 4:78095599-78095621 AGGAGTCCTCACAATCATGGCGG + Intronic
975804176 4:78095762-78095784 CAGAGATAACTGAATCATGGGGG - Intronic
975878102 4:78868201-78868223 GGGAGGCCTCAGAATCATGGCGG + Intronic
975917499 4:79342053-79342075 GGGAGTCCTCACAATCATGGTGG + Intergenic
975919803 4:79371504-79371526 GAGGGGCCTCAGAATCATGGTGG + Intergenic
976222262 4:82766191-82766213 TGGAGTCCACAGAATGGTGGTGG - Intronic
976286278 4:83374529-83374551 GGGAGGCCTCAGAATCATGGTGG + Intergenic
976405409 4:84656841-84656863 GAGAGGCCTCAGAATCATGGCGG + Intergenic
976731355 4:88265493-88265515 GAGAGGCCACACAATCATGGTGG - Intronic
976875461 4:89849369-89849391 GGGAGGCCACACAATCATGGTGG + Intergenic
977122150 4:93115673-93115695 GGGAGGCCTCAGAATCATGGTGG + Intronic
977303930 4:95299626-95299648 CGGAGGCCTCATAATCATGGTGG + Intronic
977592346 4:98841213-98841235 GGGAGGCCTCAGAATCATGGCGG - Intergenic
977670267 4:99686498-99686520 GGGAGGCCTCAGAATCATGGTGG - Intergenic
978087281 4:104669033-104669055 GGGAGTCCTCACAATCATGGTGG + Intergenic
978284333 4:107057887-107057909 GGGAGGCCTCAGAATCATGGTGG + Intronic
978929552 4:114294417-114294439 GGGAGGCCTCAGAATCATGGTGG + Intergenic
978934266 4:114355909-114355931 GAGAGGCCTCAGAATCATGGCGG + Intergenic
979065505 4:116127079-116127101 GAGAGGCCTCAGAGTCATGGTGG - Intergenic
979125885 4:116970935-116970957 GAGAGGCCACACAATCACGGTGG + Intergenic
979472407 4:121114944-121114966 AAGAACCCACAGAATTATGGTGG - Intergenic
979480210 4:121208043-121208065 GAAAGGCCTCAGAATCATGGCGG - Intronic
979767391 4:124478399-124478421 CAGAGTTTACAGAATGATTGTGG - Intergenic
979854308 4:125612132-125612154 CAGAGGCCTCAGAATCATAGTGG - Intergenic
979901525 4:126225268-126225290 GAGAGGACACACAATCATGGTGG - Intergenic
980071341 4:128245541-128245563 AGGAGGCCTCAGAATCATGGTGG - Intergenic
980083451 4:128368263-128368285 GGGAGGCCTCAGAATCATGGCGG + Intergenic
980202660 4:129676345-129676367 GGGAGGCCTCAGAATCATGGTGG - Intergenic
980478754 4:133357162-133357184 GGGAGGCCACAGAATCATGGTGG + Intergenic
980479129 4:133362766-133362788 GAGAGGCCTCACAATCATGGTGG - Intergenic
980727993 4:136788902-136788924 GAGAGGCCTCACAATCATGGTGG - Intergenic
980738567 4:136921368-136921390 AGAAGTCCTCAGAATCATGGCGG + Intergenic
980741279 4:136952810-136952832 GGGAGTCCTCACAATCATGGTGG + Intergenic
980824520 4:138057471-138057493 GAGAGACCTCACAATCATGGCGG - Intergenic
980953359 4:139403891-139403913 CAGAGAACTCTGAATCATGGCGG + Intronic
981121118 4:141051969-141051991 GGGAGTCCTCACAATCATGGCGG + Intronic
981138969 4:141245299-141245321 GGGAGGCCTCAGAATCATGGCGG - Intergenic
981194368 4:141901608-141901630 GAGAGGCCTCACAATCATGGCGG + Intergenic
981642914 4:146966312-146966334 GGGAGGCCTCAGAATCATGGCGG - Intergenic
981643191 4:146968250-146968272 GGGAGACCTCAGAATCATGGTGG - Intergenic
981863054 4:149380064-149380086 GAGAGGCCTCACAATCATGGTGG - Intergenic
982352692 4:154433252-154433274 GAGAGTCCCCAGAAGCTTGGAGG + Intronic
982415618 4:155128030-155128052 GGGAGGCCACAGAATCATGGTGG + Intergenic
982424828 4:155246618-155246640 AGGAGGCCTCAGAATCATGGCGG + Intergenic
982482859 4:155933329-155933351 GGGAGGCCTCAGAATCATGGCGG - Intronic
982561007 4:156927960-156927982 AGGAGGCCTCAGAATCATGGTGG + Intronic
982679266 4:158409350-158409372 GCGAGGCCTCAGAATCATGGCGG - Intronic
982730927 4:158954368-158954390 GGGAGGCCTCAGAATCATGGTGG - Intronic
982849366 4:160293354-160293376 GGGAGACCTCAGAATCATGGCGG + Intergenic
983068241 4:163236692-163236714 GAGAGGCCTCAGAATCATGGTGG + Intergenic
983337369 4:166414871-166414893 GCGAGGCCTCAGAATCATGGTGG + Intergenic
983337630 4:166416789-166416811 GGGAGGCCTCAGAATCATGGTGG + Intergenic
983437112 4:167730197-167730219 GAGAGGCCTCACAATCATGGTGG - Intergenic
983437365 4:167732086-167732108 GAGAGGCCTCACAATCATGGTGG - Intergenic
983463061 4:168049960-168049982 GAGAGGCCTCAGAATCATGACGG - Intergenic
983647973 4:170011133-170011155 GGGAGGCCTCAGAATCATGGTGG - Intronic
983689124 4:170446631-170446653 GAGAGGCCTCACAATCATGGCGG + Intergenic
983787852 4:171757589-171757611 CAGTCTCCACAGAAAAATGGGGG - Intergenic
983879976 4:172922181-172922203 GGGAGGCCTCAGAATCATGGCGG - Intronic
984017217 4:174441035-174441057 GGGAGGCCTCAGAATCATGGTGG + Intergenic
984017456 4:174442698-174442720 TGGAGGCCTCAGAATCATGGTGG + Intergenic
984065911 4:175047961-175047983 GGGAGGCCTCAGAATCATGGCGG - Intergenic
984467473 4:180119019-180119041 GGGAGGCCTCAGAATCATGGTGG - Intergenic
984774142 4:183466171-183466193 GGGAGGCCTCAGAATCATGGGGG - Intergenic
985133135 4:186759055-186759077 GGGAGGCCTCAGAATCATGGCGG + Intergenic
985182791 4:187283001-187283023 GAGAGGCTACAAAATCATGGGGG - Intergenic
985183845 4:187295478-187295500 GGGAGGCCTCAGAATCATGGCGG + Intergenic
985809044 5:2069704-2069726 GGGAGGCCTCAGAATCATGGCGG - Intergenic
986105360 5:4654957-4654979 GGGAGGCCTCAGAATCATGGTGG + Intergenic
986114054 5:4751590-4751612 GGGAGGCCTCAGAATCATGGTGG + Intergenic
986806426 5:11312387-11312409 GGGAGGCCTCAGAATCATGGCGG + Intronic
986817408 5:11427935-11427957 GGGAGGCCTCAGAATCATGGGGG + Intronic
987012484 5:13781685-13781707 AAGAGGCCTCAGAATCACGGTGG - Intronic
987097772 5:14565466-14565488 GGGAGGCCTCAGAATCATGGAGG + Intergenic
987098059 5:14567393-14567415 GGGAGGCCTCAGAATCATGGTGG + Intergenic
987333201 5:16874917-16874939 GGGAGGCCTCAGAATCATGGCGG + Intronic
987612099 5:20218764-20218786 GGGAGGCCTCAGAATCATGGCGG - Intronic
987642471 5:20629787-20629809 GAGAGGCCTCACAATCATGGTGG + Intergenic
987822378 5:22982034-22982056 GAGAGGCCTCACAATCATGGTGG - Intergenic
987860329 5:23478003-23478025 AAGAGGCCTCACAATCATGGCGG - Intergenic
987894468 5:23926534-23926556 GGGAGGCCTCAGAATCATGGCGG + Intergenic
987984164 5:25124414-25124436 GGGAGGCCTCAGAATCATGGTGG - Intergenic
988009081 5:25460825-25460847 GGGAGACCTCAGAATCATGGTGG - Intergenic
988204246 5:28114430-28114452 GGGAGGCCTCAGAATCATGGTGG + Intergenic
988311765 5:29568174-29568196 CGGAGCCCACAGATTCCTGGAGG - Intergenic
988977234 5:36527323-36527345 CAGAGTACACAGTAACAGGGGGG - Intergenic
989067644 5:37480460-37480482 GAGAGGCCTCACAATCATGGTGG + Intronic
989514400 5:42325109-42325131 GGGAGGCCACACAATCATGGTGG + Intergenic
989742592 5:44790161-44790183 AAGGGTCCACAGACTCATGTTGG - Intergenic
989753558 5:44923653-44923675 CGGAGCCCTCACAATCATGGTGG - Intergenic
990075555 5:51842754-51842776 GAGAGGCCTCAGAATCATGGCGG + Intergenic
990093547 5:52084173-52084195 GGGAGGCCTCAGAATCATGGTGG + Intergenic
990278706 5:54227022-54227044 GGGAGGCCACACAATCATGGGGG - Intronic
990443253 5:55867723-55867745 GGGAGGCCTCAGAATCATGGTGG + Intronic
990804411 5:59642622-59642644 GGGAGGCCTCAGAATCATGGTGG - Intronic
990922408 5:60982282-60982304 CAGAGGCCTCACAATCATGGTGG + Intronic
991104776 5:62831968-62831990 GGGAGGCCTCAGAATCATGGCGG + Intergenic
991183723 5:63784367-63784389 GGGAGGCCTCAGAATCATGGTGG - Intergenic
991243978 5:64489595-64489617 CAGAGGTCTCACAATCATGGCGG + Intergenic
991619574 5:68531628-68531650 GGGAGGCCTCAGAATCATGGCGG - Intergenic
992352969 5:75949704-75949726 GAGAGGCCTCACAATCATGGTGG - Intergenic
992534094 5:77681144-77681166 AGGAGGCCTCAGAATCATGGTGG + Intergenic
992602501 5:78416949-78416971 AAGAGTCCACAGAACCAAGGAGG - Intronic
993015756 5:82532752-82532774 CAGAGGCCTCACAATTATGGTGG + Intergenic
993083165 5:83328070-83328092 GGGAGGCCTCAGAATCATGGCGG + Intronic
993256144 5:85592300-85592322 GGGAGGCCTCAGAATCATGGCGG + Intergenic
993406012 5:87512452-87512474 CAGGGTCCACAGACTCCTGTTGG - Intergenic
993569856 5:89523988-89524010 GAGAGGCCTCACAATCATGGTGG + Intergenic
993575293 5:89592142-89592164 GGGAGGCCTCAGAATCATGGTGG - Intergenic
993773727 5:91964422-91964444 CGGAGTCCTCACAATCATGGTGG - Intergenic
993801666 5:92350616-92350638 CGGAGGCCTCACAATCATGGTGG - Intergenic
994114483 5:96046781-96046803 GGGAGGCCTCAGAATCATGGTGG + Intergenic
994524084 5:100881885-100881907 GAGAGGCCTCAGAATTATGGTGG - Intronic
994590606 5:101768049-101768071 GAGAGGCCTCACAATCATGGTGG + Intergenic
994649222 5:102505295-102505317 GAGAGGCCTCACAATCATGGTGG - Intergenic
994895398 5:105696846-105696868 GAGAGGCCTCAGAATCATGGAGG + Intergenic
994895714 5:105699083-105699105 GAGAGGCCTCAGAATCATGGCGG + Intergenic
994919938 5:106031111-106031133 GAGAGGCCTCAGAATCATGGTGG + Intergenic
995299867 5:110566936-110566958 GAGAGGCCACAAAATCATGGTGG + Intronic
995312532 5:110730567-110730589 GGGAGGCCTCAGAATCATGGCGG + Intronic
995357703 5:111258447-111258469 GGGAGGCCTCAGAATCATGGTGG + Intronic
995488447 5:112663423-112663445 GAGAGCCCTCAGAATCATGGTGG - Intergenic
996027125 5:118658605-118658627 CGGAGGCCTCACAATCATGGTGG + Intergenic
996196212 5:120610676-120610698 GGGAGGCCTCAGAATCATGGTGG - Intronic
996460344 5:123733616-123733638 GCGAGGCCTCAGAATCATGGCGG - Intergenic
996519643 5:124412861-124412883 GGGAGGCCTCAGAATCATGGTGG + Intergenic
996526716 5:124488246-124488268 TGGAGGCCTCAGAATCATGGCGG + Intergenic
997056794 5:130453082-130453104 GGGAGGCCTCAGAATCATGGTGG + Intergenic
997108368 5:131046878-131046900 GGGAGGCCTCAGAATCATGGGGG + Intergenic
997118481 5:131150762-131150784 CTGAGTCAACAGCATAATGGTGG + Intergenic
997506420 5:134421214-134421236 GGGAGGCCTCAGAATCATGGCGG + Intergenic
997693026 5:135839918-135839940 GGGAGGCCACACAATCATGGTGG - Intronic
998144914 5:139721930-139721952 GGGAGACCTCAGAATCATGGCGG - Intergenic
998576784 5:143325227-143325249 GGGAGGCCTCAGAATCATGGCGG + Intronic
998857808 5:146410742-146410764 CTGAGTCCTCAGACTCCTGGGGG + Intergenic
999127108 5:149253932-149253954 GGGAGTCCTCACAATCATGGTGG + Intronic
999345932 5:150819770-150819792 AGGAGCCCTCAGAATCATGGTGG + Intergenic
999804734 5:155071159-155071181 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1000034690 5:157436323-157436345 GAGAGGCCTCACAATCATGGCGG - Intronic
1000078718 5:157822432-157822454 GGGAGGCCCCAGAATCATGGCGG - Intronic
1000083571 5:157869499-157869521 GAGAGGCCTCACAATCATGGTGG - Intergenic
1000226690 5:159267841-159267863 GGGAGGCCTCAGAATCATGGTGG - Intronic
1000357719 5:160416907-160416929 GAGAGATCACTGAATCATGGCGG + Intronic
1000564735 5:162833994-162834016 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1000565019 5:162835899-162835921 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1000570079 5:162901041-162901063 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1000676187 5:164125935-164125957 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1000750942 5:165096643-165096665 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1000767538 5:165310372-165310394 CAGGGAACTCAGAATCATGGAGG - Intergenic
1000774899 5:165407327-165407349 GAGAGGCCTCACAATCATGGTGG - Intergenic
1001027142 5:168233775-168233797 GGGAGGCCTCAGAATCATGGCGG + Intronic
1001515500 5:172352779-172352801 GGGAGGCCTCAGAATCATGGCGG - Intronic
1001889534 5:175327603-175327625 CAGAGTCCAGAGAACCCTGTGGG + Intergenic
1002198298 5:177512961-177512983 CAGAGTCCCCAGGACCAGGGAGG - Intronic
1002464231 5:179397784-179397806 GGGAGGCCTCAGAATCATGGGGG - Intergenic
1002558821 5:180066332-180066354 AGGAGGCCTCAGAATCATGGTGG - Intronic
1003299512 6:4864749-4864771 GGGAGGCCTCAGAATCATGGTGG - Intronic
1003373130 6:5548012-5548034 GGGAGGCCTCAGAATCATGGCGG + Intronic
1003401880 6:5797324-5797346 GAGAGGCCTCAGAATCATGGTGG + Intergenic
1003659178 6:8044326-8044348 GGGAGGCCTCAGAATCATGGTGG - Intronic
1003856480 6:10281180-10281202 GGGAGACCTCAGAATCATGGTGG + Intergenic
1003945634 6:11072776-11072798 AAGAGGCCTCACAATCATGGTGG - Intergenic
1004559789 6:16738081-16738103 CAGAGTCTACTGAATCATACAGG + Intronic
1004592681 6:17069037-17069059 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1004592950 6:17070959-17070981 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1004895860 6:20147126-20147148 GAGAGGCCTCACAATCATGGTGG - Intronic
1005493131 6:26365306-26365328 CAGAGCCCACAGAATAAAGACGG - Exonic
1005905123 6:30255786-30255808 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1005906541 6:30265974-30265996 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1006067920 6:31475659-31475681 AGGAGGCCTCAGAATCATGGCGG + Intergenic
1006085201 6:31590111-31590133 CAGAGAGCACAGGATCCTGGGGG + Exonic
1006240592 6:32674247-32674269 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1006344304 6:33467428-33467450 AGGAGGCCTCAGAATCATGGTGG - Intergenic
1006388473 6:33745348-33745370 CAGAGGCCACAGGAGCATTGAGG + Intronic
1006697306 6:35941733-35941755 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1007360595 6:41352654-41352676 CAGAGTCCACAGTCTCAGCGAGG + Intergenic
1007984964 6:46198355-46198377 GGGAGTCCTCACAATCATGGTGG + Intergenic
1008297994 6:49801723-49801745 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1008345452 6:50421345-50421367 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1008650255 6:53553889-53553911 GGGAGGCCTCAGAATCATGGTGG - Intronic
1008864673 6:56195094-56195116 GAGAGTCCCCACAAGCATGGAGG + Intronic
1008903051 6:56645050-56645072 GAGAGGCCTCACAATCATGGTGG - Intronic
1008930321 6:56932291-56932313 GGGAGGCCTCAGAATCATGGCGG - Intronic
1009309534 6:62133420-62133442 GAGAGGCCTCACAATCATGGTGG - Intronic
1009315976 6:62222370-62222392 GAGAGGCCTCAAAATCATGGCGG + Intronic
1009457924 6:63878576-63878598 CAGAGTCTACAGAAGCAGGCAGG + Intronic
1009490359 6:64283751-64283773 GGGAGGCCTCAGAATCATGGTGG + Intronic
1009503038 6:64441808-64441830 GAGAGGCCTCATAATCATGGTGG - Intronic
1009538517 6:64923192-64923214 AAGAGGCCTCAGAATCATGATGG + Intronic
1009604955 6:65856390-65856412 GAGAGGCCTCACAATCATGGTGG + Intergenic
1010350824 6:74872155-74872177 AGGAGGCCTCAGAATCATGGTGG - Intergenic
1010494275 6:76514165-76514187 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1010559196 6:77326836-77326858 AAGAGGCCTCACAATCATGGAGG + Intergenic
1010612023 6:77964053-77964075 AGGAGGCCTCAGAATCATGGTGG - Intergenic
1010730625 6:79387011-79387033 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1011122235 6:83965947-83965969 GGGAGGCCTCAGAATCATGGCGG - Exonic
1011236806 6:85227500-85227522 GAGAGGCCTCACAATCATGGTGG + Intergenic
1011284403 6:85707648-85707670 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1011353749 6:86452688-86452710 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1011900653 6:92291634-92291656 AAGAGGCCTCACAATCATGGTGG - Intergenic
1011919140 6:92548631-92548653 GAGAGGCCTTAGAATCATGGTGG - Intergenic
1012301499 6:97594197-97594219 CCAAGTCTACAGAATCATGAGGG - Intergenic
1012365689 6:98436989-98437011 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1012546496 6:100425200-100425222 GGGAGGCCTCAGAATCATGGCGG - Intronic
1013080910 6:106811815-106811837 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1013535717 6:111061483-111061505 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1013687129 6:112598596-112598618 CAGAGGCCACAGAATATTGCAGG - Intergenic
1013935247 6:115586476-115586498 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1014482261 6:121953548-121953570 GGGAGGCCTCAGAATCATGGAGG + Intergenic
1014488778 6:122036076-122036098 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1014670874 6:124302058-124302080 CAGAGATAACTGAATCATGGGGG + Intronic
1014730808 6:125030008-125030030 GGGAGGCCTCAGAATCATGGCGG + Intronic
1014731077 6:125031953-125031975 GGGAGGCCTCAGAATCATGGTGG + Intronic
1014773901 6:125486913-125486935 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1015444349 6:133286108-133286130 CAGAGACCAAAGAATCATTCTGG - Intronic
1015815556 6:137207694-137207716 GAGAGGCCTCAGAATCATGGCGG - Intronic
1015997338 6:139008223-139008245 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1016153328 6:140771624-140771646 GGGAGGCCACACAATCATGGTGG - Intergenic
1016176462 6:141082376-141082398 AGGAGTCCTCAGAATCATGATGG - Intergenic
1016202420 6:141429314-141429336 GAGAGGCCTCAGAATCATGGTGG + Intergenic
1016202696 6:141431237-141431259 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1016215665 6:141599425-141599447 CAGAGGCCACAGATACAAGGAGG + Intergenic
1016361610 6:143273633-143273655 CGGAGGCCTCACAATCATGGTGG + Intronic
1016468642 6:144351640-144351662 CAAAGAGCACAGAATCATAGGGG - Intronic
1016782931 6:147979760-147979782 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1017547389 6:155467318-155467340 AGGAGGCCTCAGAATCATGGTGG + Intergenic
1017559501 6:155611455-155611477 GAGAGGCCTCACAATCATGGTGG - Intergenic
1018074740 6:160201756-160201778 CAGAGTCCTCAGATTCTGGGTGG + Intronic
1018086423 6:160304868-160304890 GGGAGGCCACACAATCATGGTGG + Intergenic
1018188304 6:161286988-161287010 CAGAGACCACAGAGTCACAGGGG + Intergenic
1018441456 6:163817355-163817377 GAGAGGCCTCAGAATCATGGCGG + Intergenic
1018872352 6:167792938-167792960 GGGAGGCCTCAGAATCATGGCGG - Intronic
1019067134 6:169311831-169311853 CGGAGGCCTCAGGATCATGGCGG + Intergenic
1020083209 7:5297342-5297364 AAGAGTACACAGAATAAAGGAGG - Intronic
1020537989 7:9425254-9425276 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1020597691 7:10229368-10229390 CGGAGGCCTCACAATCATGGTGG - Intergenic
1020631683 7:10648517-10648539 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1020631966 7:10650428-10650450 CGGAGGCCTCAGAATCATGGTGG + Intergenic
1020781059 7:12517300-12517322 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1020986905 7:15147344-15147366 GAGAGGCCTCACAATCATGGCGG + Intergenic
1021116410 7:16750589-16750611 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1021280422 7:18710035-18710057 AAGAGGCCTCACAATCATGGTGG + Intronic
1021280436 7:18710192-18710214 GAGAGTTAACTGAATCATGGGGG - Intronic
1021507540 7:21402156-21402178 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1022397297 7:30000741-30000763 GGGAGGCCACAGAATCATGGCGG + Intergenic
1023060795 7:36323863-36323885 GAGAGGCCTCACAATCATGGTGG - Intergenic
1023236106 7:38089762-38089784 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1023784069 7:43688084-43688106 GGGAGACCTCAGAATCATGGCGG - Intronic
1024674926 7:51629860-51629882 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1024771176 7:52725030-52725052 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1025170176 7:56749314-56749336 GAGAGACCTCACAATCATGGAGG - Intergenic
1025701709 7:63826404-63826426 GAGAGACCTCACAATCATGGAGG + Intergenic
1026133670 7:67641049-67641071 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1026228076 7:68460101-68460123 GAGAGGCCTCAGAATCATGGCGG + Intergenic
1026561399 7:71453388-71453410 GAGAGGCCTCACAATCATGGTGG + Intronic
1026571629 7:71536487-71536509 GGGAGGCCTCAGAATCATGGCGG + Intronic
1027834023 7:83218316-83218338 GTGAGGCCTCAGAATCATGGTGG - Intergenic
1027834310 7:83220246-83220268 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1027922731 7:84416340-84416362 GGGAGGCCTCAGAATCATGGCGG - Intronic
1028011090 7:85645362-85645384 GTGAGGCCTCAGAATCATGGTGG - Intergenic
1028011230 7:85647822-85647844 GTGAGGCCTCAGAATCATGGTGG + Intergenic
1028138505 7:87246757-87246779 GTGAGGCCTCAGAATCATGGTGG - Intergenic
1028367336 7:90048985-90049007 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1028581384 7:92413062-92413084 CAGGGTCCAGGGAATAATGGCGG + Intergenic
1028918341 7:96284793-96284815 GAGAGGCCTCACAATCATGGTGG - Intronic
1028922546 7:96323386-96323408 GAGAGACAACGGAATCATGGGGG - Intergenic
1029031805 7:97476154-97476176 CTGACTCCAAAGAATGATGGTGG + Intergenic
1029796906 7:102906006-102906028 GGGAGGCCTCAGAATCATGGCGG + Intronic
1030039746 7:105439084-105439106 GAAAGGCCACAGAAGCATGGAGG - Intergenic
1031145600 7:117994165-117994187 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1031145885 7:117996100-117996122 AGGAGGCCTCAGAATCATGGCGG - Intergenic
1031174925 7:118338207-118338229 GAGAGACCTCAGAATCATGGTGG - Intergenic
1031299337 7:120043641-120043663 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1031365352 7:120894667-120894689 AAGAGGCCTCACAATCATGGCGG - Intergenic
1031473305 7:122192412-122192434 GAGAGACCTCACAATCATGGTGG - Intergenic
1031528738 7:122851631-122851653 GGGAGGCCACACAATCATGGCGG + Intronic
1031561393 7:123243042-123243064 CAAAGTCCTGAGAATCATTGAGG + Intergenic
1032318151 7:130860259-130860281 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1032362895 7:131272671-131272693 GGGAGGCCTCAGAATCATGGTGG + Intronic
1032633679 7:133682466-133682488 GGGAGGCCTCAGAATCATGGTGG - Intronic
1033456549 7:141508626-141508648 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1033580430 7:142727646-142727668 CGGAGGCCTCAGAATCATGGCGG + Intergenic
1033735033 7:144213944-144213966 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1033748023 7:144337025-144337047 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1033816189 7:145076177-145076199 GGGAGTCCTCAGAATCATGGTGG - Intergenic
1033961376 7:146917824-146917846 GAGAGGCCTCACAATCATGGTGG - Intronic
1034011037 7:147530150-147530172 AGGAGGCCTCAGAATCATGGTGG + Intronic
1034011409 7:147532693-147532715 AGGAGGCCTCAGAATCATGGTGG + Intronic
1034122342 7:148639188-148639210 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1034320361 7:150174250-150174272 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1034772381 7:153792971-153792993 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1035097842 7:156370137-156370159 GAGAGGCCTCACAATCATGGCGG - Intergenic
1035150030 7:156862167-156862189 GAGAGGCCTCACAATCATGGTGG + Intronic
1035840844 8:2810677-2810699 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1035943031 8:3925719-3925741 GGGAGGCCTCAGAATCATGGCGG - Intronic
1036000472 8:4596990-4597012 GGGAGGCCTCAGAATCATGGCGG - Intronic
1036059652 8:5301645-5301667 GGGAGTCCTCACAATCATGGCGG + Intergenic
1036457898 8:8925589-8925611 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1036607908 8:10324101-10324123 AAGAGACCACAGCATCATGGCGG - Intronic
1036634500 8:10539749-10539771 GAGAGGCCTCACAATCATGGTGG - Intronic
1036799037 8:11776147-11776169 GGGAGTCCTCATAATCATGGTGG + Intronic
1036814401 8:11890518-11890540 GAGAGGCCTCACAATCATGGTGG - Intergenic
1036978367 8:13440849-13440871 GAGAGGCCTCAGAATCACGGCGG - Intronic
1037031257 8:14108446-14108468 GGGAGCCCTCAGAATCATGGCGG + Intronic
1037117702 8:15246428-15246450 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1037117975 8:15248264-15248286 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1037198857 8:16225126-16225148 GGAAGTCCTCAGAATCATGGCGG + Intronic
1037298553 8:17427465-17427487 GAGAGGTCTCAGAATCATGGTGG - Intergenic
1037381015 8:18285151-18285173 CCAAGTGCAGAGAATCATGGTGG - Intergenic
1037442269 8:18928336-18928358 GAGAGGCCTCACAATCATGGTGG - Intronic
1037733760 8:21550421-21550443 AAGAGGCCTCACAATCATGGGGG - Intergenic
1037747346 8:21657017-21657039 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1038139189 8:24823538-24823560 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1038215937 8:25561845-25561867 CACAGTCCACTGTCTCATGGTGG - Intergenic
1038374980 8:27030937-27030959 AAGAGTCCTCACAATCATGGTGG - Intergenic
1038589239 8:28821266-28821288 GGGAGGCCTCAGAATCATGGTGG + Intronic
1038746478 8:30259332-30259354 GAGAGGCCTCACAATCATGGCGG - Intergenic
1038987312 8:32826324-32826346 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1039350265 8:36756538-36756560 CAGAGATAACTGAATCATGGAGG + Intergenic
1039734467 8:40315832-40315854 AAGAGCCCTCACAATCATGGTGG + Intergenic
1039777684 8:40752738-40752760 AAGAGTCCACTGAATCAGTGTGG - Intronic
1040655074 8:49498482-49498504 GAGAGGCCTCACAATCATGGTGG - Intergenic
1041734650 8:61096958-61096980 CAGCGTTCACAGAATCCTGCAGG - Intronic
1041756962 8:61324394-61324416 GGGAGGCCTCAGAATCATGGTGG - Intronic
1041946890 8:63454964-63454986 AAGAGGCCTCACAATCATGGTGG + Intergenic
1042085235 8:65100130-65100152 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1042412672 8:68482235-68482257 GGGAGGCCCCAGAATCATGGTGG - Intronic
1042504272 8:69542911-69542933 CACATTACACAGAATAATGGGGG + Intronic
1042602398 8:70511657-70511679 AGGAGGCCTCAGAATCATGGCGG - Intergenic
1043141336 8:76593663-76593685 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1043262657 8:78221188-78221210 AAGAGGCCTCATAATCATGGAGG + Intergenic
1043287918 8:78558439-78558461 GGGAGGCCTCAGAATCATGGTGG + Intronic
1043379604 8:79688579-79688601 GGGAGTCCTCACAATCATGGTGG + Intergenic
1043517742 8:81011444-81011466 GAGAGTCCTCACGATCATGGAGG - Intronic
1043788581 8:84433682-84433704 GGGAGGCCTCAGAATCATGGTGG - Intronic
1044045869 8:87431174-87431196 GGGAGTCCTCACAATCATGGCGG - Intronic
1044279864 8:90341938-90341960 AGGAGGCCTCAGAATCATGGTGG - Intergenic
1044303820 8:90615604-90615626 AAGAGACCTCAAAATCATGGTGG - Intergenic
1044518340 8:93166665-93166687 CAGAGTCCTGAGCATCTTGGAGG + Intronic
1044538084 8:93380747-93380769 AGGAGGCCTCAGAATCATGGTGG + Intergenic
1044538357 8:93382650-93382672 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1044784742 8:95781974-95781996 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1045181303 8:99786047-99786069 CAGTGTCCAGAGAATCCTGAGGG - Intronic
1045214009 8:100129248-100129270 AGGAGGCCTCAGAATCATGGTGG + Intronic
1045214310 8:100131147-100131169 GGGAGGCCTCAGAATCATGGTGG + Intronic
1045243560 8:100423195-100423217 AAGAGACCCCACAATCATGGAGG - Intergenic
1045437775 8:102181775-102181797 GAGAGGTCATAGAATCATGGGGG + Intergenic
1045540545 8:103080299-103080321 GAGAGGCCTCACAATCATGGTGG - Intergenic
1045672155 8:104567266-104567288 TGGAGACCTCAGAATCATGGCGG + Intronic
1045715830 8:105044114-105044136 GGGAGCCCTCAGAATCATGGCGG + Intronic
1045732115 8:105254981-105255003 GGGAGGCCTCAGAATCATGGTGG + Intronic
1045786445 8:105926757-105926779 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1045872321 8:106940734-106940756 GGGAGGCCACACAATCATGGTGG + Intergenic
1045906095 8:107346905-107346927 CAGAGTCCACAGACTCAACAAGG - Intronic
1045939919 8:107727536-107727558 GAGAGGCCTCATAATCATGGTGG + Intergenic
1046129141 8:109945789-109945811 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1046405589 8:113768767-113768789 GAGAGGCCTCATAATCATGGTGG - Intergenic
1046452663 8:114414716-114414738 AGGAGGCCTCAGAATCATGGTGG + Intergenic
1046855613 8:119028430-119028452 GGGAGGCCTCAGAATCATGGTGG + Intronic
1047195636 8:122718742-122718764 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1047488053 8:125350741-125350763 GAGAGGCAACTGAATCATGGGGG - Intronic
1047562720 8:126007241-126007263 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1047886925 8:129261558-129261580 GAGAGGCCTCATAATCATGGAGG - Intergenic
1047895883 8:129365758-129365780 GAGAGGCCTCACAATCATGGTGG - Intergenic
1048000985 8:130379527-130379549 CTGAGCCCACAGAATTGTGGGGG + Intronic
1048358312 8:133672192-133672214 GAGAGGCCTCACAATCATGGAGG - Intergenic
1048460588 8:134618073-134618095 GGGAGGCCTCAGAATCATGGCGG - Intronic
1048595769 8:135864113-135864135 GAGAGGCCTCAGAATCATGGTGG + Intergenic
1048648335 8:136447326-136447348 GAGAGGCCTCACAATCATGGCGG - Intergenic
1048655702 8:136533663-136533685 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1048746158 8:137616799-137616821 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1048782840 8:138020932-138020954 GAGAGGTCTCAGAATCATGGCGG - Intergenic
1048783127 8:138022861-138022883 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1048917591 8:139199594-139199616 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1048923496 8:139251225-139251247 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1049343915 8:142128456-142128478 CAGAGGCCACAGAAGCTGGGTGG + Intergenic
1049862782 8:144911480-144911502 GAGAGGCCTCACAATCATGGTGG - Intergenic
1049902999 9:188539-188561 GAGAGGCCTCACAATCATGGCGG + Intergenic
1050524683 9:6535362-6535384 GTGAGTTCACAGAGTCATGGAGG - Intronic
1050593387 9:7182591-7182613 CTGAGGCCTCACAATCATGGTGG - Intergenic
1051015735 9:12474025-12474047 GAGAGGCCTCACAATCATGGTGG - Intergenic
1051384232 9:16490219-16490241 GGGAGGCCTCAGAATCATGGTGG + Intronic
1051450520 9:17192934-17192956 GGGAGGCCTCAGAATCATGGTGG + Intronic
1051493444 9:17692822-17692844 GGGAGGCCCCAGAATCATGGTGG + Intronic
1051619663 9:19037598-19037620 GGGAGGCCTCAGAATCATGGCGG - Intronic
1051902516 9:22058830-22058852 AGGAGGCCTCAGAATCATGGTGG + Intergenic
1052019242 9:23507321-23507343 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1052019517 9:23509233-23509255 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1052024380 9:23558482-23558504 GAGAGACCTCACAATCATGGTGG + Intergenic
1052190867 9:25659762-25659784 CGGAGGCCTCACAATCATGGTGG + Intergenic
1052267289 9:26589684-26589706 GAGAGCCCTCACAATCATGGTGG + Intergenic
1052351610 9:27464729-27464751 GGGAGGCCTCAGAATCATGGCGG + Intronic
1052517904 9:29507407-29507429 CACCCTCCACAGAATCCTGGAGG + Intergenic
1052576177 9:30294130-30294152 GAGAGGCCTCAGAATCATGATGG + Intergenic
1053868638 9:42467631-42467653 GAGAGGCCTCAGGATCATGGCGG + Intergenic
1054583502 9:66941052-66941074 GAGAGGCCTCACAATCATGGCGG - Intergenic
1054992122 9:71340577-71340599 GGGAGTCCTCACAATCATGGTGG - Intronic
1055019805 9:71657531-71657553 GAGAGGCCTCAGAATAATGGTGG - Intergenic
1055363845 9:75523872-75523894 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1055679734 9:78703197-78703219 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1055701210 9:78947780-78947802 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1055843410 9:80532463-80532485 GAGAGGCCTTAGAATCATGGTGG + Intergenic
1055843478 9:80533071-80533093 GAGAGGCCTTAGAATCATGGCGG + Intergenic
1055845336 9:80555491-80555513 CAGAGTCTAAGGAGTCATGGAGG - Intergenic
1055888749 9:81099218-81099240 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1056012294 9:82345136-82345158 GAGAGGCCTCACAATCATGGTGG - Intergenic
1056070854 9:82985236-82985258 GGGAGGCCTCAGAATCATGGGGG + Intronic
1056829122 9:89900094-89900116 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1056924507 9:90821384-90821406 GGGAGGCCCCAGAATCATGGAGG + Intronic
1056945975 9:90997083-90997105 GAGAGGCCTCACAATCATGGTGG - Intergenic
1056953665 9:91065700-91065722 AGCAGTCCACAGAACCATGGCGG + Intergenic
1056962037 9:91133909-91133931 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1057027050 9:91742099-91742121 TGGAGGCCTCAGAATCATGGTGG + Intronic
1057823010 9:98348006-98348028 CAGAGGCTTCACAATCATGGTGG - Intronic
1058376719 9:104330410-104330432 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1058725212 9:107796655-107796677 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1058725284 9:107797404-107797426 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1058831861 9:108824754-108824776 AAGAGGCCTCACAATCATGGTGG + Intergenic
1059587387 9:115620650-115620672 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1059765653 9:117381415-117381437 GGGAGGTCACAGAATCATGGGGG + Intronic
1059903603 9:118956327-118956349 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1059920716 9:119157264-119157286 GGGAGTCCTCAGAATCATGATGG - Intronic
1059968193 9:119637086-119637108 GAGAGGCCTCACAATCATGGCGG - Intergenic
1062129653 9:134885603-134885625 CAGACTCCACAGGATGAAGGAGG - Intronic
1203367533 Un_KI270442v1:271803-271825 AAGAGGCCTCAGAATCATGGTGG + Intergenic
1185743718 X:2554747-2554769 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1185968385 X:4633523-4633545 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1185985057 X:4823483-4823505 CTGAGGCCTCAGAATCATGGCGG - Intergenic
1185986386 X:4839284-4839306 CAGAGGCCTCACAATCATGGTGG + Intergenic
1186018667 X:5228512-5228534 GGGAGTCCTCACAATCATGGTGG + Intergenic
1186114002 X:6286233-6286255 GAGAGGCCTCACAATCATGGTGG + Intergenic
1186138068 X:6540643-6540665 GAGAGGCCTCACAATCATGGTGG - Intergenic
1186335380 X:8581340-8581362 GGGAGGCCTCAGAATCATGGTGG - Intronic
1186485297 X:9929980-9930002 GGGAGGCCTCAGAATCATGGCGG - Intronic
1186655600 X:11608822-11608844 GGGAGGCCTCAGAATCATGGTGG - Intronic
1186809719 X:13176368-13176390 GAGAGATCACTGAATCATGGGGG + Intergenic
1186890868 X:13957900-13957922 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1187283459 X:17880825-17880847 GGGAGTCCTCACAATCATGGTGG + Intergenic
1187527690 X:20068975-20068997 GGGAGGCCTCAGAATCATGGAGG - Intronic
1187645099 X:21338968-21338990 AGGAGTCCTCAGAATCATGGTGG - Intergenic
1187852517 X:23605248-23605270 AGGAGGCCTCAGAATCATGGCGG - Intergenic
1188211281 X:27428195-27428217 CAATGTCCACAGAAGCAGGGAGG + Intergenic
1188428160 X:30073586-30073608 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1188614438 X:32140654-32140676 GGGAGGCCTCAGAATCATGGTGG + Intronic
1188764864 X:34079489-34079511 GAGAGACCTCAAAATCATGGCGG + Intergenic
1189228908 X:39436654-39436676 GGGAGTCCTCAGAATCATGGTGG + Intergenic
1189378271 X:40482814-40482836 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1189561404 X:42194896-42194918 GGGAGACCACTGAATCATGGGGG - Intergenic
1189616328 X:42788443-42788465 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1190798272 X:53764142-53764164 CAGATTCCACATAATCATTGCGG + Intergenic
1191058327 X:56267319-56267341 GGGAGGCCTCAGAATCATGGTGG + Intronic
1191603790 X:63040155-63040177 GGGAGACCTCAGAATCATGGTGG - Intergenic
1192162342 X:68797815-68797837 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1192527588 X:71861155-71861177 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1192581315 X:72284460-72284482 GGGAGGCCTCAGAATCATGGCGG - Intronic
1192846159 X:74908971-74908993 GGGAGGCCTCAGAATCATGGCGG - Intronic
1192846441 X:74910894-74910916 GGGAGGCCTCAGAATCATGGTGG - Intronic
1192934778 X:75848436-75848458 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1192935022 X:75850239-75850261 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1193222519 X:78943659-78943681 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1193278982 X:79625644-79625666 GAGAGGCTGCAGAATCATGGCGG + Intergenic
1193320272 X:80113883-80113905 CAGAGACCTCACAGTCATGGCGG - Intergenic
1193422238 X:81295461-81295483 GGGAGACCTCAGAATCATGGCGG - Intronic
1193498282 X:82239931-82239953 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1193542330 X:82787697-82787719 GAGAGGCCTCACAATCATGGTGG - Intergenic
1193863427 X:86699396-86699418 AAGAGACCTCACAATCATGGTGG + Intronic
1193963002 X:87948253-87948275 GAGAGGCCTCAGAATCATGGTGG - Intergenic
1193969847 X:88037985-88038007 GGGAGTCCTCACAATCATGGTGG - Intergenic
1194145755 X:90260333-90260355 GGGAGTCCTCACAATCATGGTGG + Intergenic
1194215651 X:91127984-91128006 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1194264418 X:91737614-91737636 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1194300472 X:92180808-92180830 GAGAGGCCTCAAAATCATGGCGG - Intronic
1194324450 X:92495709-92495731 AGGAGGCCTCAGAATCATGGTGG + Intronic
1194442789 X:93953786-93953808 CAGAGGCCTTACAATCATGGTGG - Intergenic
1194473843 X:94334671-94334693 GAGAGGCCTCAGAATCATGGCGG - Intergenic
1194566297 X:95493456-95493478 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1194864797 X:99052992-99053014 GAGAGGCCTCATAATCATGGCGG - Intergenic
1195228179 X:102819222-102819244 GGGAGCCCTCAGAATCATGGCGG + Intergenic
1195243251 X:102973565-102973587 GAGAGGCCTCACAATCATGGTGG - Intergenic
1195880589 X:109588839-109588861 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1196036229 X:111148571-111148593 GTGAGACCTCAGAATCATGGTGG + Intronic
1196036501 X:111150498-111150520 GGGAGGCCTCAGAATCATGGTGG + Intronic
1196522083 X:116686218-116686240 GGGAGGCCTCAGAATCATGGCGG - Intergenic
1196545398 X:116958558-116958580 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1196858337 X:120004481-120004503 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1197025855 X:121748966-121748988 GGGAGGCCACACAATCATGGTGG - Intergenic
1197341204 X:125267725-125267747 GAGAGACCTCACAATCATGGTGG + Intergenic
1197400226 X:125980401-125980423 GGGAGGCCTCAGAATCATGGCGG + Intergenic
1197511256 X:127371830-127371852 GGGAGGCCTCAGAATCATGGTGG + Intergenic
1197945913 X:131840129-131840151 CCCAGACCACAGAATCAAGGGGG + Intergenic
1198610921 X:138399488-138399510 CAGAGTCCACAGCATTAGGCTGG - Intergenic
1198707478 X:139464190-139464212 GGGAGGCCTCAGAATCATGGAGG - Intergenic
1198951173 X:142074123-142074145 GAGAGGCCTCACAATCATGGTGG + Intergenic
1199002928 X:142662008-142662030 AAGAGACCTCACAATCATGGTGG - Intergenic
1199020192 X:142869636-142869658 CAAAGGCCTCATAATCATGGTGG - Intergenic
1199043116 X:143138258-143138280 ACGAGGCCACACAATCATGGTGG - Intergenic
1199112008 X:143946360-143946382 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1199191564 X:144977641-144977663 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1199203972 X:145125468-145125490 TAGAGGCCTCACAATCATGGTGG + Intergenic
1199231779 X:145444514-145444536 GAGAGGCCTCACAATCATGGTGG - Intergenic
1199357327 X:146876776-146876798 AAGAGGCCTCACAATCATGGTGG - Intergenic
1199792447 X:151168006-151168028 GGGAGGCCTCAGAATCATGGTGG - Intergenic
1200491506 Y:3829628-3829650 GGGAGTCCTCACAATCATGGTGG + Intergenic
1200615114 Y:5369445-5369467 GAGAAGCCTCAGAATCATGGTGG - Intronic
1200633195 Y:5614918-5614940 AGGAGGCCTCAGAATCATGGTGG + Intronic
1200655885 Y:5901711-5901733 CAGAGTGCAAAGAATGAAGGAGG - Intergenic
1201071157 Y:10148426-10148448 AAGAGGCCTCAGAAACATGGTGG - Intergenic
1201184705 Y:11389064-11389086 AGGAGACCTCAGAATCATGGCGG - Intergenic