ID: 906422261

View in Genome Browser
Species Human (GRCh38)
Location 1:45679481-45679503
Sequence GGACCCCTGGCAGCTAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906422261_906422264 1 Left 906422261 1:45679481-45679503 CCAGCTCTAGCTGCCAGGGGTCC 0: 1
1: 0
2: 0
3: 12
4: 172
Right 906422264 1:45679505-45679527 GCACAGAAAGTTTATCTATATGG 0: 1
1: 0
2: 0
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906422261 Original CRISPR GGACCCCTGGCAGCTAGAGC TGG (reversed) Intronic
900942343 1:5808063-5808085 AGAGCCCTGACAGCTAGAACAGG - Intergenic
900981583 1:6049008-6049030 GGACCTCTGGACGCTAAAGCAGG - Intronic
902454268 1:16520919-16520941 GGGCCCCAGGCAGCTCGGGCTGG - Intergenic
904433281 1:30478918-30478940 GGAACACCGGCAGCCAGAGCTGG + Intergenic
905004512 1:34698899-34698921 GGAGGCATGGCACCTAGAGCAGG + Intergenic
905250175 1:36643327-36643349 AGACCCCTGGAGGCTAGAGATGG - Intergenic
905276067 1:36819039-36819061 TGACTCCTGGCAGTTAGAGCAGG + Intronic
905356787 1:37390432-37390454 GGAACCCAGGCAGCTACAGGTGG - Intergenic
906422261 1:45679481-45679503 GGACCCCTGGCAGCTAGAGCTGG - Intronic
907225672 1:52943970-52943992 GGAACTCTGCCAGCTAGAGGTGG + Intronic
910169844 1:84366275-84366297 GGACCCCAGGCAGAGAGAGGAGG - Intronic
912382154 1:109253555-109253577 GGAACCCTGGCGGCTGGTGCAGG + Intronic
914764091 1:150622742-150622764 TGACCCCTGGCTGCAAAAGCAGG + Exonic
915497867 1:156294155-156294177 AGACACCTGTCAGCTAGAGGTGG - Exonic
915589155 1:156860865-156860887 GGAGGCCTGGCAGCTGCAGCTGG + Intronic
915901952 1:159854172-159854194 AGATCCCTGGCAGTCAGAGCTGG - Intronic
916678189 1:167081841-167081863 AGACACCTGGCAGGTAAAGCCGG - Intronic
917846831 1:179026422-179026444 GGACCTCTGGCAGCCTGAGGCGG - Intronic
920386723 1:205575104-205575126 GACCCCCTGGGAGCTAGGGCAGG - Intronic
921065062 1:211616837-211616859 GCCTCCCTGGCAGCCAGAGCTGG + Intergenic
1062920498 10:1275254-1275276 GGGCCCCTGGCTGGTAGAGATGG + Intronic
1063614427 10:7589856-7589878 GGAGCCGGGGAAGCTAGAGCAGG - Intronic
1065885629 10:30074539-30074561 GGATCGCTGGCAGCTGGAGGTGG - Intronic
1067653491 10:48173951-48173973 GGCCTCCTGGCAGCTTAAGCAGG - Intronic
1070899727 10:80017761-80017783 TGATCCCTGGCAGCTATACCAGG + Intergenic
1071052871 10:81473082-81473104 GGAGGCCAGGCAGCCAGAGCAGG - Intergenic
1074211384 10:111338434-111338456 GGTCCCCTGGTACCTAGAGGTGG - Intergenic
1074773108 10:116745986-116746008 GGAGAGCTGGCAGCTAGAGGGGG - Intergenic
1077435142 11:2535336-2535358 GGAGCCTTGGCAGCTGAAGCTGG - Intronic
1077457622 11:2690420-2690442 GGGGTCCTGGGAGCTAGAGCTGG + Intronic
1077483057 11:2825489-2825511 GGGCCCCTGGCAGCAAGGGCTGG - Intronic
1078639863 11:13084518-13084540 GTACCCCAGGCAGCTAGTCCAGG - Intergenic
1084462092 11:69301894-69301916 GGGCCCCTGGCAGGGAGAGAGGG + Intronic
1085455709 11:76664232-76664254 GGCCCCCAGGCTTCTAGAGCAGG - Intronic
1091622020 12:2096143-2096165 GGACCTCTGGCTGCGAGAGCTGG - Intronic
1097390437 12:59005684-59005706 GGACACTTGCCAGATAGAGCTGG + Intergenic
1098214250 12:68199176-68199198 GGGCCCCCAGCACCTAGAGCAGG - Intergenic
1098595946 12:72273090-72273112 GGACTCCTGGCAGCCCGAGGCGG + Exonic
1100473328 12:94913288-94913310 GGCCCCCAGGCAGGTAGAGGAGG - Intronic
1100702115 12:97160168-97160190 GGACAACTGGAAGCTTGAGCTGG - Intergenic
1100841219 12:98613218-98613240 GGCTCCCTGGCAGCCAGAGAGGG + Intergenic
1104626419 12:130359467-130359489 GGGCTCATGGCAGCAAGAGCAGG - Intronic
1105745502 13:23373927-23373949 GAACCCCTAGCCGCTGGAGCAGG - Intronic
1106592681 13:31110837-31110859 GGGCCCCTGGGAGCGAGAACGGG + Intergenic
1113400606 13:109989257-109989279 GCACCCCAGGGAGCTGGAGCTGG - Intergenic
1114271199 14:21101338-21101360 GGAGCCATGGAAGATAGAGCTGG + Exonic
1117700559 14:58409056-58409078 GAAGCCCTGGCAGCCAAAGCAGG - Exonic
1121717945 14:96089587-96089609 GGACCTGTGGAAGCCAGAGCTGG - Exonic
1121938922 14:98049090-98049112 AGACCCCTGGCAGCCAAAGGTGG + Intergenic
1122113080 14:99515086-99515108 GGACCCATGGCAGCTGGGCCAGG + Exonic
1122920223 14:104876881-104876903 GAACCCCTGGCTGCAAGAGCAGG + Intronic
1127292667 15:57584111-57584133 AGACCCCTGTCAGCTGGAGTGGG + Intergenic
1128218914 15:65953963-65953985 AGACCCCGGGCAGGGAGAGCTGG + Intronic
1132579179 16:677360-677382 GCACGCCTGCCAGGTAGAGCAGG - Exonic
1132673338 16:1111358-1111380 GGACCCCTGGCAACGTGAGAGGG + Intergenic
1132849726 16:2019655-2019677 GGAACCCTGGCAGCTGGCGGGGG - Exonic
1133204361 16:4224107-4224129 GGACCCCGGGCATCTGGAGGAGG + Intronic
1133926896 16:10200576-10200598 GCATCCCTGGCAGCCAGAGAAGG + Intergenic
1134074536 16:11281353-11281375 GGCCCCCTGGCATCTATAACAGG - Intronic
1134084138 16:11345301-11345323 GCACTCCTGGCTGCTAGAGAGGG + Intronic
1135797853 16:25462703-25462725 GGACGCCTGGCTTCTAGGGCTGG + Intergenic
1137609179 16:49807685-49807707 GGACCCCAGGCAGCTCCACCTGG + Intronic
1139643455 16:68310443-68310465 GGACTCCTGGCCGCTCGAGGTGG + Exonic
1141596386 16:85099554-85099576 GGACCCATGGCAGCCACGGCAGG + Intronic
1141658445 16:85428755-85428777 GGACCCCTGGTAACTAGAATGGG - Intergenic
1141706631 16:85668768-85668790 TGAGCCCTGGCAGCTAGGCCTGG + Intronic
1142205550 16:88781309-88781331 GGGACCCTGGCAGCTGGGGCTGG + Intronic
1143862420 17:9900519-9900541 TGACCCCTGGCAGGGAGAGAGGG - Intronic
1146373050 17:32277086-32277108 GGAGACCTGGGATCTAGAGCAGG - Intronic
1147450157 17:40499485-40499507 GGACACCTGGGATCTAGAGAGGG + Intronic
1147609484 17:41793218-41793240 GGACCGGTGGCATCTAGATCGGG + Intergenic
1150268856 17:63849585-63849607 GGCCCCTTGCCAGCAAGAGCTGG + Intergenic
1151819582 17:76490361-76490383 GGAGCCCTGGCAGCCACACCGGG + Intronic
1152034804 17:77865533-77865555 GGAACCCTGGCAGCCAGGGCTGG - Intergenic
1152908736 17:82984852-82984874 CCACCCCGGGTAGCTAGAGCAGG + Intronic
1153018147 18:602869-602891 GGACATCTGGAAGCTAGAGGTGG + Intronic
1153104747 18:1513536-1513558 GGACCCCTGACAGTCAGGGCAGG - Intergenic
1153293795 18:3526441-3526463 GGACCCTTGGCAGCGAATGCGGG - Intronic
1153799366 18:8656026-8656048 GGGCCCCTGGGAGCCACAGCTGG - Intergenic
1153951186 18:10059042-10059064 GGACACCAGGCAGATAGAGAAGG - Intergenic
1156291935 18:35755078-35755100 CAACCCCTGTCAGCTAGACCAGG + Intergenic
1159942944 18:74422583-74422605 GGACCCCTGGAAGCAGCAGCAGG + Intergenic
1160975617 19:1790870-1790892 GGCCCCCAGGCAGCCAGTGCGGG - Intronic
1163413182 19:17169669-17169691 GGACCCCTAGAAGCTGGAGGAGG - Intronic
1163768202 19:19175216-19175238 CGCCCCCTGGCGGCTAGAGTGGG + Intronic
1165160161 19:33811309-33811331 GGAGCGCTGGCAGCAGGAGCAGG + Exonic
1166950167 19:46421942-46421964 GGACCCCTGGCTGATGGGGCAGG - Intergenic
1167791867 19:51688366-51688388 GGAATCCTGGCAGCTGGAGACGG - Intergenic
925342863 2:3148965-3148987 AGACCCCTGGCAGCCAGCCCTGG + Intergenic
926092488 2:10059877-10059899 GGAACCCAGGCAGCAGGAGCAGG - Intronic
934736116 2:96690705-96690727 GGCCCCCTGGCCTCCAGAGCTGG + Intergenic
936402429 2:112175541-112175563 GGCCCCCTGGCAGCTCTTGCGGG + Intronic
937035869 2:118781387-118781409 GGACCCCTGGCAGAATGAGGTGG - Intergenic
938187585 2:129245627-129245649 GCATCCCTTGCAGCTAGGGCTGG - Intergenic
946056883 2:216910373-216910395 GGACCCCTGGCTGAGAGAGGGGG - Intergenic
948608594 2:239152505-239152527 GGGCCTCTGGCAGGAAGAGCTGG + Intronic
1169745073 20:8935304-8935326 GGACCTCCGGAAGCTACAGCTGG - Intronic
1170812750 20:19687347-19687369 GGACTCTTTGCAGCTAGATCAGG + Intronic
1171462157 20:25304230-25304252 GCACTCCTGGCACCTGGAGCAGG + Intronic
1173555701 20:43964142-43964164 TGAACCCTGGCAGCCAGACCAGG + Intronic
1175305091 20:57970421-57970443 GGACCCCTGGGAGATGGTGCAGG - Intergenic
1175851041 20:62093120-62093142 GGACCCCTGCCTGGCAGAGCTGG + Intergenic
1176300570 21:5097086-5097108 AGACACCTGGCAGCTTGGGCTGG - Intergenic
1178318750 21:31588789-31588811 AAACCCCTGGCACATAGAGCCGG + Intergenic
1179856473 21:44164895-44164917 AGACACCTGGCAGCTTGGGCTGG + Intergenic
1180904807 22:19401972-19401994 GAACCCCTGGGAGCTGGGGCGGG - Intronic
1183520500 22:38293842-38293864 GGGCCCCTGGCAGCGAGGACTGG + Intronic
1184566092 22:45293079-45293101 GGATCCCCGGCAGCCAGGGCGGG + Intronic
1184899801 22:47438552-47438574 GAAACCCTGACAGATAGAGCTGG - Intergenic
1185061989 22:48611904-48611926 AGCCCCCTGGCAGCCAGAGGTGG - Intronic
1185276088 22:49950712-49950734 GGACCCCCGGCAGCTCCAGCAGG - Intergenic
1185333109 22:50260450-50260472 GCACCCCTGGCAGAGAGATCGGG + Intronic
950021527 3:9791316-9791338 GGACACCCTGCAGCTGGAGCTGG - Exonic
950194162 3:10997387-10997409 GGCCCCCTGGCTGCTGGGGCTGG + Intronic
950211114 3:11124324-11124346 AGACCCCTGGCATCTCGGGCTGG - Intergenic
950684695 3:14608168-14608190 GCATCCCAGGCACCTAGAGCTGG + Intergenic
953126289 3:40094532-40094554 GGACCCCTGGGCACTAGGGCAGG - Intronic
953788539 3:45929267-45929289 GGCCCCCTGGAAGCTAGAGGAGG + Intronic
953836731 3:46352629-46352651 GGACCTAAAGCAGCTAGAGCAGG - Intergenic
954460472 3:50623868-50623890 GGAGCCCTGGCAGCCCCAGCTGG + Intronic
956490238 3:69763511-69763533 GGATCCTTGGCAGCAGGAGCTGG - Intronic
956906999 3:73776803-73776825 GAAGCCATGACAGCTAGAGCTGG + Intergenic
961393883 3:126572544-126572566 TGACCTCTGGAAGCCAGAGCTGG - Exonic
961940805 3:130635974-130635996 GGTACCCTGGCAGCTAAAACAGG - Intronic
968731408 4:2270974-2270996 CAACCCCTGGCAGCTGGGGCTGG - Intronic
968812262 4:2805373-2805395 GGACCCCTGGCTGCAGGAGGGGG - Intronic
968902086 4:3436606-3436628 GGAACCCTGGCAGGCACAGCGGG - Intronic
968914630 4:3492073-3492095 GGAGCCCTGGAAGGCAGAGCAGG + Intronic
968930715 4:3577152-3577174 GGACCCCAGGGAGGGAGAGCAGG + Intronic
969529427 4:7722500-7722522 GGAGCCCTGGAAGCTGGAGGAGG - Intronic
969639631 4:8389069-8389091 GGACCCTTGGCAGTTCCAGCCGG - Intronic
969722010 4:8897323-8897345 GACCCCCTGGGAGCTGGAGCAGG - Intergenic
975662594 4:76702585-76702607 GGACCCCAGGCAGCTGGCTCCGG + Intronic
984626155 4:182009705-182009727 AGACCCCAGGCAGCCACAGCTGG + Intergenic
985775015 5:1836914-1836936 GGAGCCCTGCCAGCTGCAGCTGG - Intergenic
997239298 5:132294925-132294947 GGACCTGGGGCAGCTGGAGCAGG + Exonic
997248368 5:132370281-132370303 GGACCTGGGGCAGCTGGAGCAGG + Exonic
997284018 5:132665493-132665515 GGACCCCCAGCACCTAGAGCAGG - Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
998871520 5:146557335-146557357 TGACCCCTTGCAGCCACAGCTGG + Intergenic
1006641117 6:35490320-35490342 GGACCGCTGGCAGCTGGTGAGGG + Intronic
1007076064 6:39066881-39066903 GGACACCAGGCAGCAAGAGCAGG + Intronic
1007498834 6:42280262-42280284 GGACCTCTGGCAACTAGGGCTGG + Intronic
1007655297 6:43447905-43447927 GGACACCAGCCAGCTGGAGCTGG + Exonic
1007838495 6:44696598-44696620 AGAGCCCTGACAGCTGGAGCAGG - Intergenic
1009778066 6:68232028-68232050 GGACCCCAGGCATTTAGAGATGG - Intergenic
1011384355 6:86779028-86779050 GGAGCCCTGTGAGCAAGAGCCGG - Intergenic
1012006636 6:93720779-93720801 TTTCCCCTGGCACCTAGAGCAGG + Intergenic
1012489219 6:99761957-99761979 AGAGGCCTGGCATCTAGAGCAGG - Intergenic
1019215981 6:170444152-170444174 TGACACCTGGCAGCTAGGCCTGG + Intergenic
1019287536 7:231233-231255 GGACCCCTGGAGGGCAGAGCAGG + Intronic
1019567147 7:1689941-1689963 GGACACCTGGCATCTGGAGAGGG + Intronic
1019710583 7:2516533-2516555 TGAGCCCTGGCAGTTAGAGGAGG + Intronic
1022207664 7:28179953-28179975 CGAGCCCTGACAGCTCGAGCCGG + Intronic
1023610858 7:41968994-41969016 GGAGCCCTGGGAGCGAGAGGAGG - Intronic
1024311265 7:47971408-47971430 AGTCCCCGGGCAGCAAGAGCAGG - Intronic
1025813738 7:64891048-64891070 GGACCACTGGCAGAAAGAGGAGG - Intronic
1026940020 7:74282352-74282374 GGACACCTGTCAGGTAGTGCAGG - Intergenic
1028401515 7:90430565-90430587 GGACCCCTGTGAGATAAAGCTGG - Intronic
1030291828 7:107880582-107880604 CGGCCTCTAGCAGCTAGAGCAGG - Intergenic
1032512703 7:132484588-132484610 GAACCCATGGCAGCTTGGGCTGG + Intronic
1034142679 7:148836857-148836879 GGACCACTGGGAGCTGGAGAGGG + Intronic
1034467226 7:151237301-151237323 AGAGCCCAGGCAGCTGGAGCTGG + Intronic
1035022638 7:155808476-155808498 GGACCCCGGGCAGGGAGACCCGG + Intronic
1035281139 7:157779236-157779258 GGAAGCCTGGCAGCCAGGGCGGG - Intronic
1035563804 8:628227-628249 GGGCCCCAGGCAGGCAGAGCAGG + Intronic
1035786612 8:2266221-2266243 GGACCACGGGCGGCTGGAGCAGG + Intergenic
1035806195 8:2455495-2455517 GGACCACGGGCGGCTGGAGCAGG - Intergenic
1041157966 8:55007256-55007278 GGACTCCTGGCCTCCAGAGCTGG - Intergenic
1045330748 8:101153887-101153909 GGACCCCTTGCAGCTAGGTGTGG + Intergenic
1048978806 8:139691881-139691903 GGTTCCCTTGCAGCTAGAGTTGG + Intronic
1048980837 8:139702800-139702822 GGACTACCGGCAGCTGGAGCTGG - Exonic
1049720489 8:144113315-144113337 GGAGGCCTGGCAGGCAGAGCTGG + Intronic
1051105259 9:13571867-13571889 GAAACCCAGGAAGCTAGAGCTGG + Intergenic
1051502703 9:17795527-17795549 GGACACCTGGGAGTAAGAGCAGG - Exonic
1054459404 9:65454762-65454784 GGACCCCAGGGAGGGAGAGCAGG - Intergenic
1054966978 9:71040216-71040238 GAGCTCCTAGCAGCTAGAGCTGG + Intronic
1057187601 9:93065624-93065646 GGAGCCCTGGCAGACACAGCAGG - Intronic
1059389491 9:113989884-113989906 GGCCTCCTGGCAGCCAGGGCAGG - Intronic
1061903192 9:133683473-133683495 GGACCCCGGCCTGCTGGAGCTGG + Intronic
1062462084 9:136666277-136666299 GGACCCCTCGCGGCGGGAGCAGG - Intronic
1062583346 9:137237807-137237829 GCACCCCTGGCTCCCAGAGCAGG - Intergenic
1062597852 9:137307132-137307154 GGACCCCTGCCAGCTGCAGCCGG + Exonic
1186685004 X:11916667-11916689 GGGCCGCTGCCATCTAGAGCTGG - Intergenic
1192562093 X:72133986-72134008 TCAGGCCTGGCAGCTAGAGCAGG + Intronic