ID: 906422261

View in Genome Browser
Species Human (GRCh38)
Location 1:45679481-45679503
Sequence GGACCCCTGGCAGCTAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906422261_906422264 1 Left 906422261 1:45679481-45679503 CCAGCTCTAGCTGCCAGGGGTCC 0: 1
1: 0
2: 0
3: 12
4: 172
Right 906422264 1:45679505-45679527 GCACAGAAAGTTTATCTATATGG 0: 1
1: 0
2: 0
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906422261 Original CRISPR GGACCCCTGGCAGCTAGAGC TGG (reversed) Intronic