ID: 906423110

View in Genome Browser
Species Human (GRCh38)
Location 1:45687122-45687144
Sequence CGGAGGCTGCGCGGCTGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906423098_906423110 3 Left 906423098 1:45687096-45687118 CCCCAGCGGGCCACACGGCCTGG 0: 1
1: 1
2: 3
3: 31
4: 153
Right 906423110 1:45687122-45687144 CGGAGGCTGCGCGGCTGCGTCGG 0: 1
1: 1
2: 1
3: 14
4: 147
906423104_906423110 -7 Left 906423104 1:45687106-45687128 CCACACGGCCTGGCCCCGGAGGC 0: 1
1: 0
2: 2
3: 29
4: 287
Right 906423110 1:45687122-45687144 CGGAGGCTGCGCGGCTGCGTCGG 0: 1
1: 1
2: 1
3: 14
4: 147
906423100_906423110 2 Left 906423100 1:45687097-45687119 CCCAGCGGGCCACACGGCCTGGC 0: 1
1: 0
2: 2
3: 12
4: 142
Right 906423110 1:45687122-45687144 CGGAGGCTGCGCGGCTGCGTCGG 0: 1
1: 1
2: 1
3: 14
4: 147
906423096_906423110 8 Left 906423096 1:45687091-45687113 CCAGTCCCCAGCGGGCCACACGG 0: 1
1: 0
2: 1
3: 11
4: 180
Right 906423110 1:45687122-45687144 CGGAGGCTGCGCGGCTGCGTCGG 0: 1
1: 1
2: 1
3: 14
4: 147
906423101_906423110 1 Left 906423101 1:45687098-45687120 CCAGCGGGCCACACGGCCTGGCC 0: 1
1: 0
2: 1
3: 22
4: 196
Right 906423110 1:45687122-45687144 CGGAGGCTGCGCGGCTGCGTCGG 0: 1
1: 1
2: 1
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906423110 Original CRISPR CGGAGGCTGCGCGGCTGCGT CGG Intronic
900092193 1:925339-925361 GGGAGGCTGCGGGGCGGCGCGGG + Intronic
900461878 1:2805590-2805612 CGGAGGCTCCGCGGTTCCCTTGG + Intergenic
901050717 1:6424700-6424722 CGGAGGCTGCGGGGCGGGGCGGG + Intergenic
903777117 1:25800271-25800293 GGGAGGCTGCGCGGCGGGGCCGG - Exonic
904006591 1:27366314-27366336 GGCAGGCTGCGCAGCTGCGGGGG + Exonic
906423110 1:45687122-45687144 CGGAGGCTGCGCGGCTGCGTCGG + Intronic
906722448 1:48018916-48018938 AGGAGGCTGTGCGGCTCCGTAGG + Intergenic
918015951 1:180632457-180632479 CGGCGGCAGCGGGGCTGCGGGGG - Intronic
921167007 1:212514783-212514805 CGGGGGCTGGGAGGCTGCGGGGG - Intergenic
923119588 1:230978368-230978390 AGGAGGGCGCGCGGCGGCGTGGG + Intronic
1067216942 10:44311053-44311075 CGGGGTCTGCGCGGCTGCGGTGG + Intergenic
1067227279 10:44384428-44384450 CGGAGGCTGCGCGGCTGCATCGG + Intronic
1073122597 10:101131718-101131740 CGGGGGCTCCGCGGCCGCGACGG + Exonic
1074756521 10:116627841-116627863 AGGAGGCTGGGGGGCCGCGTGGG + Exonic
1077021106 11:417504-417526 TGGAGGCTGCGCTGCTGCCCGGG + Intergenic
1083617920 11:64035650-64035672 GGGAGGCTGCGCCGCCGCGCGGG - Intronic
1083885752 11:65572730-65572752 CTGAGGCCGCGCGGCAGCGGTGG - Exonic
1084489683 11:69471637-69471659 CGGTGGCTGCCCGGCGGCGCGGG - Intergenic
1085037474 11:73308843-73308865 CGGAGCGGGCGCGGCTGCGCGGG - Exonic
1085050187 11:73376407-73376429 CGCAGGCTGCGCGGCTGTCCGGG + Exonic
1085443949 11:76588605-76588627 CGTATGCTGCGCGGCTGAGCCGG + Intergenic
1088462056 11:110092890-110092912 AGGAAGCGGCGCGGCTGCGGTGG + Intergenic
1091090729 11:132769064-132769086 AGGAGGCTGCGCTGCTGAGGGGG + Intronic
1094682521 12:32679099-32679121 AGGAGGCTGCGCGGCACCGGTGG - Intergenic
1095943735 12:47741762-47741784 CCTGGGCTGCGTGGCTGCGTGGG - Intronic
1097166549 12:57089288-57089310 CGGCGGCTGCTCGGCTGTGGGGG - Exonic
1098275683 12:68808781-68808803 CGGGGGCTGCGGGGCCGCTTCGG + Intronic
1100309245 12:93378503-93378525 CGCAGGCTGCGGGGCTGGGAGGG + Intronic
1102101304 12:110281085-110281107 CGGGGCCTGCGCGGCAGCGTGGG + Intronic
1103980933 12:124736566-124736588 GGGTGGGTGCGCGGGTGCGTGGG - Intergenic
1110860498 13:80341003-80341025 CGGAGGCGGCGCGGGGGCGCGGG + Intergenic
1113665879 13:112142019-112142041 TGGAGGCTGGGTGGCTGGGTGGG - Intergenic
1113665914 13:112142134-112142156 TGGAGGCTGCGAGGCTGGATGGG - Intergenic
1113665935 13:112142232-112142254 TGGAGGCTGCGAGACTGGGTGGG - Intergenic
1113665942 13:112142264-112142286 TGGAGGCTGCGAGACTGGGTGGG - Intergenic
1113816096 13:113172236-113172258 CGGCGGCTCTGCTGCTGCGTGGG - Exonic
1116626394 14:47270060-47270082 CTGAGGCTGCACGGCTGCTGTGG + Intronic
1117424611 14:55580792-55580814 CGGAGGCAGCGCGTCTCCGGCGG + Intronic
1117920790 14:60723760-60723782 CGGGGTCTGCGCGGCGGCGGCGG + Exonic
1119410312 14:74426158-74426180 CGAGGGCTGCGCGGCGGCGGCGG - Intergenic
1121234287 14:92380759-92380781 TGGAGGGTGCCAGGCTGCGTGGG + Intronic
1121329922 14:93043535-93043557 GGGAGGCTGCCCTGCTGCCTTGG - Intronic
1122137915 14:99645301-99645323 CAGAGGCGCAGCGGCTGCGTCGG - Exonic
1122225839 14:100278788-100278810 CGCAGGCTGAGCGCCTGCGCAGG + Exonic
1122371193 14:101229934-101229956 CGGAGGGGGCGAGGCTGCGGAGG - Intergenic
1122371223 14:101230004-101230026 CGGAGGGGGCGAGGCTGCGGGGG - Intergenic
1122371264 14:101230094-101230116 CGGAGGGGGCGAGGCTGCGGGGG - Intergenic
1122371272 14:101230111-101230133 CGGAGGGGGCGAGGCTGCGGAGG - Intergenic
1122371278 14:101230128-101230150 CGGAGGGGGCGAGGCTGCGGAGG - Intergenic
1122371284 14:101230145-101230167 CGGAGGGGGCGAGGCTGCGGAGG - Intergenic
1122878409 14:104679209-104679231 CGGAGTCTGCCCAGCTGGGTGGG - Intergenic
1122905778 14:104800829-104800851 TGGAGGCGGCGCGGAGGCGTGGG + Intronic
1124151548 15:27183400-27183422 CTGAGGTTGCACAGCTGCGTCGG + Intronic
1124892358 15:33744990-33745012 TGGAGGCTGGGAGGCTGCTTAGG + Intronic
1125679802 15:41523545-41523567 GGAAGGCTGAGCTGCTGCGTGGG + Intronic
1125733719 15:41909218-41909240 CGGACGCTGCTGGACTGCGTGGG - Intronic
1126592708 15:50355452-50355474 CGGCGCCTGCGCGGCAGCGGGGG + Intergenic
1126668233 15:51093992-51094014 CGCCGGCTGCGCGGCAGCGATGG + Intronic
1127855820 15:62953075-62953097 CGGAGGCGGTGGGGCTGCTTAGG - Intergenic
1127995783 15:64152444-64152466 CGGGGGCTGACCGGCTGCGCAGG - Intronic
1130335298 15:82952728-82952750 CGGGGGCTGGGCGGCCGCGCTGG + Exonic
1130335342 15:82952872-82952894 CGGCGACTGCGCGGCTGCGCGGG - Intronic
1132365220 15:101251898-101251920 CGGAGGATGTGCAGCTGCGGCGG - Exonic
1133213014 16:4273443-4273465 AGGAGGGGGCGCGGCTGGGTCGG + Intergenic
1133227901 16:4351231-4351253 CGGAGGCAGAGCGGCTGCCATGG - Exonic
1133295369 16:4749233-4749255 CGGAGGCCGCCAGGCTGCGAGGG - Exonic
1135479955 16:22814224-22814246 CGGCGGCGGCGCGGCTGTGCGGG - Exonic
1135611537 16:23871823-23871845 GGGAGGCTGAGAGGCTGAGTTGG - Intronic
1135712571 16:24729978-24730000 CGCAGGCTGCGTTGCTGCGGAGG + Intronic
1142338947 16:89508352-89508374 CGGCGCCTGCGCGGCGGGGTGGG - Intronic
1142393258 16:89816370-89816392 CTGGGGCGGCGCGGCTGCCTCGG - Intronic
1144755218 17:17676037-17676059 AGGAGGCGGGGCGGCAGCGTGGG + Intergenic
1146633054 17:34484419-34484441 CGGAGGCTGGGAGGCTGCACAGG + Intergenic
1148167011 17:45490689-45490711 CGGAGGCTGAGGGGCTGCCGCGG - Exonic
1148493471 17:48037820-48037842 CGGAGGCGGGGCGGCGGCGGCGG - Intronic
1150168330 17:62966132-62966154 CGGAGGGAGCGCGCGTGCGTGGG - Intergenic
1151155649 17:72121834-72121856 CGGGGGCGGCGCGGCAGGGTGGG + Intronic
1152366394 17:79859113-79859135 GGGAGGCTGCTCAGCTGCGATGG - Intergenic
1152635935 17:81430512-81430534 AGGAAGCTGCGGGGCTCCGTTGG - Intronic
1153772178 18:8425064-8425086 CTGAGGCTGCACGGCTGCACAGG + Intergenic
1157610483 18:48952106-48952128 AGGAGGCGGCGCGGCTGCGGCGG - Intergenic
1160790433 19:920436-920458 CGTAGGCGGCGTAGCTGCGTGGG - Exonic
1161053712 19:2179345-2179367 CTGAGGCTGCACGGCTGCCTGGG + Intronic
1161053718 19:2179377-2179399 CTGAGGCTGCACGGCTGCCTGGG + Intronic
1162154915 19:8671157-8671179 CGGAGGCTGCTTGGCTGGGGTGG + Intergenic
1162419811 19:10559675-10559697 CGGAGGACGCGATGCTGCGTGGG + Exonic
1163275821 19:16283636-16283658 CCGAGACTGCGCGGCTCCGGGGG - Intergenic
1165532816 19:36418370-36418392 CGGAGTCTGTGCGGCTGACTTGG - Intronic
1165595297 19:37007718-37007740 CGGTGGCGGCGCGGCGGCCTCGG - Intergenic
1166100387 19:40568102-40568124 AGGAGGCTGCGCGGAGGCGGCGG + Exonic
1166888066 19:45973478-45973500 CGGCGGCTGCGGGGCCGCGGAGG + Exonic
1168275288 19:55274549-55274571 CGGGGGCTGCGGGACTGCGGTGG - Exonic
925438673 2:3865158-3865180 TGGAGGCTGCTCTGCTGTGTAGG - Intergenic
925907291 2:8547078-8547100 CAGAGGCTGCTTGGCAGCGTGGG - Intergenic
926145770 2:10396444-10396466 CGGAGGCTGTGCGTCTGTGATGG + Intronic
934566972 2:95346589-95346611 CGGCGGCGGCGCGGCGGCGGGGG - Intronic
934753330 2:96808583-96808605 GGGAGGCTGAGCGGCTGAGTGGG - Exonic
941583816 2:167331943-167331965 CTGAGCATGCGCAGCTGCGTGGG + Intergenic
942449443 2:176099971-176099993 CGCAGGCTGCGCGGGGGCGCAGG - Exonic
942653808 2:178194620-178194642 CGGCGGCTGCGCGGCTGCGACGG - Exonic
946420213 2:219560672-219560694 TGGAGGCTGGGGGGCTGAGTGGG - Intronic
948865065 2:240771036-240771058 CGGAGGCCGCGCGGCTGGACAGG + Exonic
1172526165 20:35601624-35601646 CGGAGGCTGCGCGTCAGCGGCGG + Intergenic
1173868945 20:46330067-46330089 CGGAGGCTGTGCGGAGGCCTAGG - Intergenic
1173880233 20:46406414-46406436 CGGAGGCTGAGGGGCTGAGAGGG - Intronic
1175997163 20:62817035-62817057 CGGAGTCTGAGCTGCGGCGTCGG - Intronic
1178610207 21:34073413-34073435 CGGCGGGTGCGGGGCTGCGGAGG + Intronic
1179710448 21:43210270-43210292 GGGAGGCAGAGAGGCTGCGTGGG - Intergenic
1180650017 22:17369694-17369716 CGGAGGCTGCGGCGCTGCCGCGG + Exonic
1180922472 22:19528163-19528185 TGGAGGCTGCGAGGCTGCAGGGG + Intergenic
1181024039 22:20117614-20117636 CGGCGGCGGCTCGGCTGGGTCGG - Exonic
1183702519 22:39458029-39458051 CGGGGGCTGGGCGGGTGCGGGGG + Intronic
1185204787 22:49531684-49531706 CGGAGGCTGTGCGGCTGGCAGGG - Intronic
952451775 3:33440106-33440128 CGGGGGCTGGGCGGCGGCGCCGG - Exonic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
958959122 3:100492394-100492416 CGGCGGCTGCGCGGCCGGGACGG - Intergenic
959920116 3:111859960-111859982 CCCAGGCTGCGCAGCTGGGTGGG + Intronic
961405770 3:126678759-126678781 CCGAGGCTGCACGGCTGCTCAGG - Intergenic
963253080 3:143120005-143120027 CGGAGGCTGCGGAGCGGCGGGGG + Exonic
964451511 3:156817062-156817084 CGCAGGCGGCGCGGCGGCCTGGG + Intergenic
968225164 3:196968678-196968700 CGGAGGCCGCGCGGGTGAGTCGG - Exonic
968410569 4:386525-386547 GGGAAGGTGCGCGGCTGCGGGGG - Intergenic
969360295 4:6658915-6658937 CGGAGGCGGCGCGGATGGGCAGG + Intergenic
969362677 4:6674502-6674524 CGGAGGCGGCGCGGATGGGCAGG + Intergenic
969422060 4:7103276-7103298 CGGAAGCTGCCTGGCTGCCTCGG + Intergenic
976297248 4:83484868-83484890 GGGAGGAGGCGCGGCGGCGTCGG + Intronic
983693312 4:170498918-170498940 TGGAGGCTGAGGGGCTGTGTGGG + Intergenic
985073588 4:186191592-186191614 TGGAGGCCGCGGTGCTGCGTAGG + Exonic
986608627 5:9546182-9546204 AGGAGGCGGCGCGGCGGCGGGGG - Intergenic
990492868 5:56319419-56319441 CAGAGGCTGAGCTGCTGCCTGGG - Intergenic
997304196 5:132826158-132826180 CTGAGGCTGGGTGGCTGCGTGGG + Exonic
997990808 5:138543139-138543161 CGGCGGCTCCGCGGCGGCGGCGG + Exonic
1002594327 5:180312221-180312243 GGGAGGCAGCGCGGCAGCGCAGG + Intronic
1007236127 6:40392402-40392424 GGGAGGCTGCGGGGCTGGGACGG - Exonic
1007371281 6:41428192-41428214 CGGAGGCGGCGCGGCGGCCACGG + Intergenic
1013155686 6:107489916-107489938 CGGATGCTGCGCGGCTCCGGGGG - Intergenic
1015376115 6:132512729-132512751 CGGCGGGTGCGTGGCTGGGTAGG + Intronic
1015965472 6:138692720-138692742 TGGAGCCCGCGCGGCTGCGCCGG - Intergenic
1016378719 6:143450814-143450836 CGGCGGCTGCGCGGCGGCAGCGG + Intronic
1016949664 6:149566991-149567013 CCGAGGCTGCGGGGCTCCGCCGG + Intronic
1018610290 6:165641906-165641928 CAGAGGCTGCGGGGCTGCCGTGG - Intronic
1018769023 6:166956284-166956306 CGGAGGGAGCGCGGCGGCGCGGG - Exonic
1019619189 7:1981410-1981432 CGCAGGCTGAGGGGCTACGTAGG + Intronic
1026931304 7:74224364-74224386 TGGAGGCTGGGCGGCTGCCAAGG - Intronic
1028417757 7:90597038-90597060 AAGGGGCTGCGCGGCTGCTTGGG + Intronic
1034223056 7:149460350-149460372 CGGAGCCCGAGCGGCGGCGTCGG + Intronic
1037769541 8:21790223-21790245 CGGGGGATGCCGGGCTGCGTGGG - Intronic
1040038842 8:42896768-42896790 CGGCGGCGGCGCGGCGGCGCGGG + Intronic
1049424229 8:142530941-142530963 CAGAGGCTGAGCTGCTGTGTGGG + Intronic
1049509008 8:143018483-143018505 CCGGGGCCGCGCGGCTGCCTGGG + Intronic
1049659367 8:143812816-143812838 CGGAGGCTGCCCGACGGCATCGG - Exonic
1049989404 9:977309-977331 CGGCGGCTGCGGGGCGGCGACGG - Exonic
1050094245 9:2047310-2047332 GGGCGGCTGCGCGGCTGCGGGGG - Exonic
1052991781 9:34522916-34522938 TGGAGGCTGCGCGGCCGAGGGGG - Exonic
1056170456 9:83980170-83980192 CTGAGGCGGCGCGGCAGCGGAGG - Exonic
1056554572 9:87677871-87677893 CGGTGGCAGCGCGGCAGCATGGG + Intronic
1058866666 9:109167237-109167259 GGGAGGCTCCGCGGCTGCGCGGG - Exonic
1059438342 9:114289385-114289407 CAGAGGCTGCGAGGCAGGGTAGG + Intronic
1060566774 9:124599594-124599616 CGGCGGCCGCTCGGCTGAGTCGG + Intronic
1061065571 9:128275714-128275736 CGGGGGCTGGGCGGCTGAGGGGG + Intronic
1061208510 9:129177629-129177651 CAGGGGCTGCGCGGCGGCGGCGG - Exonic
1061897678 9:133656928-133656950 CGGAGGCAGCGGGGCTGGGGAGG + Intronic
1190567324 X:51743852-51743874 GGGAGGGTGGGCGGCTGAGTCGG - Exonic
1192546460 X:72018598-72018620 CGGAGGCGGCGAGCCTGCGAGGG + Intergenic