ID: 906424447

View in Genome Browser
Species Human (GRCh38)
Location 1:45698465-45698487
Sequence AAGCAGTTTTGTTTGGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 345}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906424447 Original CRISPR AAGCAGTTTTGTTTGGGTCA AGG Intronic
900713070 1:4127306-4127328 AAGGAGGTTTAATTGGGTCATGG - Intergenic
902397431 1:16139992-16140014 TAGCAGGTTTGCTTGGGTCAGGG - Intronic
902610119 1:17592299-17592321 CAGCACTTTTCTGTGGGTCAGGG + Intronic
903164353 1:21509999-21510021 AAGCAGTTTGGTTTGGGAGGAGG + Intronic
905258764 1:36702946-36702968 AAAGAGGTTTGTTTGGCTCATGG + Intergenic
906424447 1:45698465-45698487 AAGCAGTTTTGTTTGGGTCAAGG + Intronic
907083090 1:51642995-51643017 AAGAAGTTTATTTTGGCTCATGG + Intronic
907701575 1:56793254-56793276 AAACAGTTCTGTTTGGTTTAAGG - Intronic
907961275 1:59283842-59283864 AAGCATTTTTGCTGGGGACAGGG - Intergenic
907997171 1:59644622-59644644 AAGCATTTTTCTTTGGGTGGGGG - Intronic
908454525 1:64290008-64290030 ATGAAGTTTAGCTTGGGTCATGG + Intergenic
908642718 1:66243095-66243117 ATGCAGATTTGTTTTGCTCAGGG + Intronic
908690301 1:66772187-66772209 AAACAGGTTTATTTGGCTCATGG + Intronic
909236451 1:73158541-73158563 AAGCAGTTTTTTTAGGTTTAAGG - Intergenic
909861631 1:80612716-80612738 AACTAGTTTTGTTGGGGTAAGGG + Intergenic
910807637 1:91204548-91204570 AAGCAGTTTATTTTGGCTAACGG + Intergenic
912109749 1:106326866-106326888 AAGCAATTTTGTTTTTGACATGG - Intergenic
915640965 1:157225791-157225813 AAGCAGTTTAGTTTTGGGAAGGG + Intergenic
916482182 1:165224288-165224310 AAAGAGTTTTGATTGGCTCATGG - Intronic
916604125 1:166324291-166324313 AAATAGTTTTATTTGGCTCATGG - Intergenic
917522667 1:175760962-175760984 CAGCAGCTGTGCTTGGGTCAAGG - Intergenic
918882775 1:190147057-190147079 AAGGAGTTTTGTTTGCGTATTGG + Intronic
918906076 1:190496531-190496553 ATGCAGTTTTGTTAGTGTTAGGG + Intergenic
918918749 1:190676899-190676921 AAGCAGGTTTATTTGACTCACGG - Intergenic
920858238 1:209681755-209681777 AAGTAGATTTTTTTTGGTCAAGG - Intergenic
921997348 1:221435569-221435591 AAGCAGTCTTGCTTGGATGATGG - Intergenic
922084267 1:222330788-222330810 AAACTGTTTTCTTTTGGTCAAGG - Intergenic
922712077 1:227841875-227841897 AAAGAGGTTTGTTTGGCTCAGGG + Intronic
922925714 1:229345186-229345208 AAACAGGTTTATTTGGCTCATGG - Intergenic
922998049 1:229982546-229982568 AAAGAGGTTTATTTGGGTCACGG + Intergenic
923325399 1:232875988-232876010 AAAGAGGTTTGTTTGGCTCACGG - Intergenic
923325661 1:232877938-232877960 AAAGAGGTTTGTTTGGCTCACGG - Intergenic
924113724 1:240725586-240725608 AGGCAGTTTAGTTTGGGGAAGGG - Intergenic
924357414 1:243196565-243196587 AAGCTGTTTTGTGTGTGACAGGG + Intronic
1062821591 10:538162-538184 GAGGAGTTTTCTTTGGGACAGGG + Intronic
1062878667 10:961293-961315 AAGGAGGTTTATTTGGCTCACGG + Intergenic
1064481369 10:15743920-15743942 AGGGAGGTTTATTTGGGTCATGG + Intergenic
1066242997 10:33555935-33555957 AAGGAGGTTTATTTGGCTCATGG - Intergenic
1066410603 10:35165123-35165145 AAGAAGTTTGTTTTGGCTCACGG + Intronic
1067244842 10:44531329-44531351 AAGCGGTTTATTTTGGTTCATGG + Intergenic
1068224268 10:54086368-54086390 AATGGGATTTGTTTGGGTCATGG - Intronic
1069323716 10:67205104-67205126 AGGCAGTTTAGTTTGGGGGAAGG + Intronic
1070384441 10:75911977-75911999 AACCACTTTTGCTTGGGACAGGG + Intronic
1072030779 10:91520219-91520241 GAGCAGGTTTGTGTGAGTCAGGG - Intergenic
1072545005 10:96430416-96430438 AAGAAGTTTGTTTTGGCTCACGG - Intronic
1073437613 10:103529803-103529825 AATCTATTTTCTTTGGGTCAGGG + Intronic
1073588737 10:104735744-104735766 AAGGATTTTTGTTTGGGATACGG + Intronic
1074697477 10:116063145-116063167 AGGCAGCTTTGATTGGGACATGG - Intronic
1075491776 10:122877650-122877672 AAGCAGTTGAGTTTGGGGGAAGG + Intronic
1077350085 11:2089068-2089090 GAGCAGTGTGGTTTGGGTAACGG + Intergenic
1078051678 11:7970508-7970530 AAGCAGTTGAGTTTGGGGCAAGG + Intronic
1078292655 11:10028535-10028557 AAGCTGTTTTCTTTGGGTGCAGG - Exonic
1078493859 11:11796534-11796556 CAGAAGTTTTGTTTGGTGCATGG - Intergenic
1079569469 11:21924384-21924406 AGGCAGTCTTGTCTGGGTGATGG + Intergenic
1079613501 11:22462354-22462376 CAGGAGTTTAGTTTGGGACAAGG - Intergenic
1079758850 11:24302807-24302829 AAAGAGTTTTGATTGGCTCATGG - Intergenic
1079963537 11:26952996-26953018 AAGGAGTTTTGTTTTTGTCAAGG - Intergenic
1080311261 11:30895508-30895530 TTTCAGTTTTGTTTGAGTCATGG - Intronic
1080759436 11:35233910-35233932 AAGCAGTTTCTTTTCTGTCAAGG - Intergenic
1081261757 11:40970476-40970498 AAGGAGGTTTGATTGGCTCATGG - Intronic
1082103299 11:48192379-48192401 AAACAGGTTTATTTGGGTTATGG + Intergenic
1083095443 11:60246213-60246235 GATCAGTTTTTTTTGGGTTAAGG - Intergenic
1083390905 11:62349293-62349315 AAGCAGTTGCGTTTGGGGCAAGG + Intronic
1084393770 11:68895675-68895697 ATGCAGTTTTTTTTGAGACAGGG + Intronic
1085163966 11:74379093-74379115 AATAAGTTTTATTTGGCTCATGG + Intronic
1085377554 11:76079940-76079962 AAAGAGATTTGTTTGGCTCATGG + Intronic
1085956609 11:81405410-81405432 AAGGAGAGATGTTTGGGTCATGG + Intergenic
1086344250 11:85880138-85880160 AGTAAGTTTTCTTTGGGTCAGGG - Intronic
1086410344 11:86538788-86538810 GAGGAGTTTGGATTGGGTCAGGG - Intronic
1086532934 11:87807500-87807522 AAGTAGTTCTGTTTCAGTCAGGG + Intergenic
1087171390 11:95052939-95052961 GAACAGTTTTATTTGGGTCATGG - Intergenic
1088769007 11:113014465-113014487 TGGCTGTTTTGTTTGTGTCAGGG - Intronic
1089737888 11:120562578-120562600 GAGGATTTGTGTTTGGGTCATGG + Intronic
1090360613 11:126170030-126170052 AAGGAGTTTTGTTTGAGCCCAGG - Intergenic
1090811297 11:130246476-130246498 AATCAGCTTTATATGGGTCAGGG + Intronic
1090929454 11:131282295-131282317 GATCAGGTGTGTTTGGGTCATGG - Intergenic
1091160879 11:133418670-133418692 AGGCAGTTTAGTTTGGGGAAGGG - Intronic
1091193121 11:133710793-133710815 AAGCAGTTTTGGATGGATCTTGG - Intergenic
1091951473 12:4596481-4596503 AGACAGTCTTGTTGGGGTCATGG + Intronic
1094045609 12:26162774-26162796 AAAGAGTTTTGTTTGGTTAAAGG + Intronic
1096467594 12:51855978-51856000 AAGCAGGCTTGTCTGGGGCACGG + Intergenic
1096673843 12:53215804-53215826 AAGCAGTGATGTGAGGGTCAGGG + Intronic
1097512877 12:60565485-60565507 AAGCAGTATTTATGGGGTCATGG + Intergenic
1098194296 12:67983572-67983594 AAAGAGGTTTGTTTGGATCACGG - Intergenic
1099246742 12:80201514-80201536 AGTCAGAATTGTTTGGGTCATGG - Intergenic
1099737794 12:86593261-86593283 AAGTATTTTTTTTTTGGTCAAGG + Intronic
1099963401 12:89418579-89418601 AAGGGGAGTTGTTTGGGTCATGG + Intergenic
1102841156 12:116124569-116124591 AAGCAGTTTTTTTTCTGTCTTGG - Intronic
1103028477 12:117593167-117593189 TAGCATTTTCCTTTGGGTCAAGG - Intronic
1103197658 12:119059121-119059143 AACCACTTCTGTTTGGGTCTTGG + Intronic
1103265556 12:119627399-119627421 AAGGAGGTTTGTTTGGTGCATGG + Intronic
1104884497 12:132098566-132098588 AAACAGTTTTAATTGGCTCACGG + Intronic
1106790518 13:33151257-33151279 AAGAAGTTTAATTTGGTTCATGG + Intronic
1107449066 13:40492337-40492359 AAACAGATTTATTTGGCTCATGG - Intergenic
1107673118 13:42767526-42767548 AAGAGGTTTAGTTTGGCTCATGG + Intergenic
1109423556 13:62144901-62144923 AAAGAGTTTTATTTGGCTCATGG + Intergenic
1109988668 13:70024166-70024188 AAGCTATTTTGTTTGGTTCAAGG - Intronic
1110229879 13:73156922-73156944 AATTAATTTTGTTTGGGGCAAGG + Intergenic
1110604000 13:77409969-77409991 AAAGAGTTTTATTTGGCTCATGG + Intergenic
1110794831 13:79624188-79624210 AAGCACTTTTGTGTGGAGCACGG - Intergenic
1111327562 13:86719169-86719191 AAACAGGTTTATTTGGCTCACGG - Intergenic
1112665003 13:101559709-101559731 AAGTAGTTTGGTTTGGCTCAAGG - Intronic
1116072489 14:40066666-40066688 AAACAGTTTTAATTGGCTCATGG + Intergenic
1116981512 14:51175745-51175767 AAAGAGTTTTATTTGGCTCATGG - Intergenic
1118282608 14:64443142-64443164 AATCAAATTTGTTTTGGTCAGGG + Intronic
1118676515 14:68191260-68191282 AAGCATATGTGTTTGGATCATGG + Intronic
1119282657 14:73423121-73423143 AAGCAGTTTAGTTTGGTGGAAGG - Intronic
1120143582 14:80955453-80955475 AAGCAGACTTGTTTGGGTCAAGG + Intronic
1120241616 14:81956301-81956323 AAGCAGTTAAGTTTGTGTGAAGG - Intergenic
1121658289 14:95614780-95614802 AAGCAGTTTAGTTTGGGGAAGGG + Intergenic
1122327442 14:100891090-100891112 AAGGAGTTTGGGTTGGGTCCTGG + Intergenic
1124044990 15:26140459-26140481 AAGGAGAGGTGTTTGGGTCATGG + Intergenic
1124158105 15:27245880-27245902 AAACAGGTTTATTTGGCTCACGG + Intronic
1124177218 15:27437750-27437772 AAGAAGGTTTATTTGGCTCATGG + Intronic
1124643409 15:31415228-31415250 AAGGAGTTTTATTTAGCTCATGG - Intronic
1124706574 15:31971557-31971579 AAGCAGTGGAGTTTGTGTCAGGG + Intergenic
1125994971 15:44150696-44150718 AAGCAGGATTGTTTGAGTCCAGG + Intronic
1127913122 15:63434798-63434820 AAGCAGTTGAGTTTGGCACAAGG - Intergenic
1128400161 15:67270764-67270786 AAACAGATTTATTTGGCTCATGG - Intronic
1128488388 15:68120109-68120131 ATCCAGCTTTGTTTTGGTCATGG + Intronic
1129598341 15:76982371-76982393 AAGCAGTTTTGTGAGGACCAAGG + Intergenic
1129958736 15:79663979-79664001 AAAGAGGTTTGTTTGGTTCAGGG + Intergenic
1131008696 15:88999559-88999581 AAGCAGTTGAGTTTGGGGCAAGG + Intergenic
1131375304 15:91918179-91918201 AAGCACTTTGGTTTGGGACATGG + Intronic
1132346173 15:101110426-101110448 AAGAAGTTTATTTTGGCTCATGG - Intergenic
1133567673 16:7010262-7010284 AAGCAGTTTTCTCTTGGTCCTGG - Intronic
1133702819 16:8325144-8325166 AAGCAGATTGATTTGGGTCCAGG - Intergenic
1134645525 16:15862221-15862243 AAGCACTTTTGTTTCACTCATGG + Intergenic
1134846310 16:17443783-17443805 AAGCAGTTTGGATTGGATCCTGG - Intronic
1135643393 16:24140863-24140885 AGGCAGTTTAGTTTGGGGGAAGG + Intronic
1135977188 16:27116237-27116259 AAGGAGGTTTATTTGGCTCAAGG + Intergenic
1139907194 16:70374476-70374498 AAGATGTTCAGTTTGGGTCAAGG - Intergenic
1140144704 16:72295330-72295352 AAGCAGTTTTCTCAGGCTCAGGG + Intergenic
1140704589 16:77614902-77614924 AAGAGGTTTTATTTGGCTCACGG + Intergenic
1142652292 17:1362790-1362812 AAGTAGTTTTGCTTGGGATAAGG - Intronic
1143463978 17:7123339-7123361 GCGGAGTTTTGTTTGGGACATGG + Intergenic
1144718562 17:17451554-17451576 AAACAATTTTGTTTAGTTCATGG - Intergenic
1145026111 17:19469075-19469097 AAGCTTTATTCTTTGGGTCATGG - Intergenic
1146091617 17:29884928-29884950 AAGCAGTATTTTTTGTGTCAGGG + Intronic
1147189999 17:38732831-38732853 TAGCAATTTTGTTTGGCTCCAGG - Intronic
1149416035 17:56460942-56460964 GAGCAGTTTTGTATGCATCATGG - Intronic
1151284191 17:73098069-73098091 AAGCAGGTTTGTTTTGGGAAAGG - Intergenic
1151284465 17:73099968-73099990 AAGCAGAGTTGTTTGGGTACAGG - Intergenic
1154039713 18:10842351-10842373 AATCAGGGGTGTTTGGGTCACGG + Intronic
1156488865 18:37484944-37484966 AAGAAGTATTCTTCGGGTCAAGG - Intronic
1156746582 18:40399328-40399350 AAGCAGTTGTATCTTGGTCAAGG - Intergenic
1159168759 18:64735815-64735837 AAGCAGTTTTGTTTCTGTTAGGG + Intergenic
1159326333 18:66924248-66924270 AAGGAGGATTGTTTGGCTCAAGG + Intergenic
1159500357 18:69261335-69261357 AAGAAGTTTTGTTTTAGACATGG - Intergenic
1159951065 18:74484064-74484086 TTGCAGTTTTGCTGGGGTCAGGG + Intergenic
1159967568 18:74610640-74610662 CAGCAGAATTGTTTGGGCCAGGG - Intronic
1160010014 18:75100211-75100233 AAATAGGTTTATTTGGGTCATGG + Intergenic
1160111134 18:76032695-76032717 AGACAGTTTTGTTGGGCTCAAGG + Intergenic
1160290479 18:77589129-77589151 AAGGAGTTTTGTTTGGCTCATGG + Intergenic
1162760012 19:12883304-12883326 AGGCAGTTTAGTTTGGGGAAGGG - Intergenic
1163125759 19:15243369-15243391 GAGCAGGGGTGTTTGGGTCAAGG + Exonic
1164429310 19:28172957-28172979 AAGGAGGTTTATTTGGCTCATGG - Intergenic
1164710691 19:30355096-30355118 AAGCAGGTGTATTTGGCTCATGG + Intronic
1164945550 19:32290237-32290259 AAGGATTTTTTTTTGGGTCGGGG - Intergenic
1166592692 19:44014928-44014950 AGGCAGTTTAGTTTGGGGGAAGG + Intergenic
1167507160 19:49876907-49876929 AAGAAGTTTATTGTGGGTCAGGG - Exonic
925130195 2:1488960-1488982 AAGCAGCTGTGTTTGGGTGCAGG - Intronic
925414213 2:3657989-3658011 AGGCAGCTTTGTTAGGGACAGGG + Intergenic
929353448 2:40990264-40990286 AAGGAGGTTTGTTTTGGTAAAGG - Intergenic
929419482 2:41776224-41776246 AAACAGGTTTATTTGGCTCATGG - Intergenic
929570051 2:43017099-43017121 CAGAAGTTTTGTTTGGGTGGTGG - Intergenic
929665104 2:43827773-43827795 GAGCTGTTTTGTTTGGATGATGG + Intronic
929699478 2:44149532-44149554 AAGGAGATTTATTTGGCTCATGG - Intergenic
929804619 2:45133974-45133996 AAAGAGGTTTGTTTGGCTCATGG + Intergenic
930740021 2:54822738-54822760 AAGCAGTTATCTCTGGGTAATGG + Intronic
932102877 2:68916622-68916644 AAGCAGTTTTGAAAGGGACATGG - Intergenic
933161676 2:79031007-79031029 AAGAAGTTTTTTTTGGGAGAAGG + Intergenic
934871545 2:97871379-97871401 AAGCAGTTTCGTTTTGGGAAAGG - Intronic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937558733 2:123193885-123193907 AAACAGGTTTATTTGGCTCATGG + Intergenic
937575110 2:123410649-123410671 AAGCAGTTTAGTTTTGGGAAGGG - Intergenic
937918158 2:127109822-127109844 AAGCAGATGTGTTAGGGTCCAGG + Intergenic
938041179 2:128077374-128077396 AAGGAGGTTTGTTTGGGGAAAGG + Intergenic
939269474 2:139918870-139918892 AACCAGTTCTGTGTGGCTCAGGG + Intergenic
939599726 2:144174026-144174048 AAAGGGTTTTATTTGGGTCATGG - Intronic
939669951 2:144998266-144998288 AAGCAGTTTCATTTGTCTCATGG - Intergenic
939833579 2:147101492-147101514 AAAGAGTTTTATTTGGCTCATGG + Intergenic
942473867 2:176293719-176293741 AAGAAGTTTATTTTGGCTCATGG - Intronic
942518961 2:176782928-176782950 AAAAAGGTTTGTTTGGCTCATGG - Intergenic
942625948 2:177901030-177901052 AAGGAGGTTTGTTTGGGAAAGGG - Intronic
945872514 2:215243338-215243360 AAGCAGATTTATTTGGCTGATGG - Intergenic
946314278 2:218899170-218899192 ATGTAATTTTGTTTGGGACAGGG + Intronic
946801423 2:223420076-223420098 AAATAGTTTTATTTGGTTCATGG - Intergenic
947173917 2:227341241-227341263 AAGGGGTTTTGTTGGGGTTAGGG + Intronic
947609636 2:231515946-231515968 ATACAGTTTTCTTTAGGTCATGG + Intergenic
948447162 2:238041675-238041697 AACCAATTTTGTTTGGGAAAAGG - Exonic
948911590 2:241007593-241007615 AAGCACTTATTTTTGGGTGATGG - Intronic
948986087 2:241524516-241524538 AAGCAGTGTAGTTTGGGTAAAGG + Intergenic
1169482275 20:5995304-5995326 AAAGAATTTTGTTTGGCTCACGG + Intronic
1169740133 20:8884048-8884070 AAACAGTTTTGTGTAAGTCAAGG - Exonic
1170058199 20:12230278-12230300 AAGCAGTTTTAGTGGTGTCATGG - Intergenic
1170138686 20:13103590-13103612 AAGTAGTTTTTGTGGGGTCATGG + Intronic
1170936092 20:20811021-20811043 AGGCAGTTTAGTTTGGGGAAGGG + Intergenic
1172433268 20:34910416-34910438 AAGCAGTTTTGCTTGAGGCCAGG + Intronic
1172918818 20:38462931-38462953 AGCCTGTTTTGTTTGGGGCAAGG + Intergenic
1174160534 20:48547228-48547250 AAAGAGGTTTGTTTGGCTCATGG - Intergenic
1175622539 20:60461250-60461272 AAGAGGTTTATTTTGGGTCATGG - Intergenic
1176251305 20:64121693-64121715 AAAGAGGTTTGTTTGGCTCACGG + Intergenic
1177188254 21:17821245-17821267 AAACAGGTTTATTTGGCTCATGG + Intergenic
1181389198 22:22567370-22567392 AAAGAGTTTTATTTGGCTCAGGG + Intergenic
1184893156 22:47391692-47391714 AGGCAGCTTTGCCTGGGTCATGG - Intergenic
1185188186 22:49415792-49415814 AAGCAGTTCTGCATGGGCCATGG + Intronic
949171075 3:997992-998014 GATCAGTTTTGTTTGGATCTTGG - Intergenic
949953961 3:9252282-9252304 AAAAAGTTTTATTTGGCTCATGG - Intronic
950170801 3:10837935-10837957 AAGCACATTTGTTTTGGTGATGG + Intronic
951101945 3:18698790-18698812 AAGGAGGTTTATTTGGCTCATGG + Intergenic
951993461 3:28701486-28701508 TAGCAGTTTTGTTCAGGTGATGG + Intergenic
952510487 3:34048822-34048844 AACCATTTTTTTTTGAGTCAGGG + Intergenic
953132011 3:40149121-40149143 AAAGAGGTTTGTTTGGCTCATGG + Intronic
953601946 3:44375272-44375294 AAAGAGGTTTGTTTGGCTCATGG + Intronic
954505907 3:51072710-51072732 AAACATTTTTGTTTGAGACAGGG + Intronic
954559000 3:51539668-51539690 AATCAGCTTTATGTGGGTCATGG + Intergenic
955577368 3:60380414-60380436 AAAGAGGTTTGTTTGGTTCATGG - Intronic
956449454 3:69358976-69358998 AAACAGATTTATTTGGCTCATGG - Intronic
956891237 3:73616244-73616266 AAAGAGGTTTGTTTGGCTCATGG - Intronic
957240748 3:77658417-77658439 AGGCAGTTTAGTTTGGGGAAGGG - Intergenic
957326451 3:78701182-78701204 AAGTCATTTTGTTTAGGTCATGG - Intronic
957751825 3:84429307-84429329 AAGCACTTTTGGTTGTTTCATGG - Intergenic
957928761 3:86849833-86849855 AAAGAGTTTTATTTGGCTCATGG - Intergenic
958085703 3:88803532-88803554 ACCTAGTTTTGTGTGGGTCAGGG + Intergenic
958747478 3:98154440-98154462 TGGCACTTTTGTTTGGGACAAGG + Intergenic
958915843 3:100048923-100048945 AAGCACTTTTGTTTGTGTCATGG + Intronic
959908578 3:111737448-111737470 AACAAGTTTTGGGTGGGTCAGGG - Intronic
959977685 3:112480472-112480494 CAGAAGTTTTATTTGGCTCATGG + Intronic
960113130 3:113865003-113865025 AAGGAGATTTATTTGGCTCATGG + Intronic
960527855 3:118730828-118730850 AAGGAGTTGTCTTTGGGTCAGGG - Intergenic
961338913 3:126204212-126204234 AAGAAGTTTTAATTGGCTCATGG + Intergenic
962047069 3:131771658-131771680 AAACAGGTTTATTTGGTTCATGG - Intronic
962121583 3:132565909-132565931 AAGAGGTTTTGTTTGGCCCATGG - Intronic
962472505 3:135724211-135724233 AAAGAGTTTTGATTGGCTCATGG - Intergenic
963151921 3:142053494-142053516 AAGAAGTTTATTTTGGCTCATGG - Intronic
963265369 3:143234783-143234805 AAGAACTTTTGTTTGGGATAGGG - Intergenic
963491470 3:146007064-146007086 AAGAAGTTTTGTTAGCGACACGG + Intergenic
963818289 3:149858193-149858215 AAGGAGTTTTATTTAGCTCATGG - Intronic
964002566 3:151793978-151794000 TAGGAGTGTTGTTTGGGTTAAGG - Intergenic
964068560 3:152604730-152604752 AAGGAGGTTTGTTTTGGTAAAGG + Intergenic
964352813 3:155819951-155819973 AAGCAGTTGTGTTTGGGTATGGG - Intergenic
964608552 3:158585441-158585463 AAAGAGGTTTATTTGGGTCATGG - Intronic
965468822 3:169065032-169065054 AAGCAGTTTTGCTTGGGGAGAGG + Intergenic
965475391 3:169149285-169149307 AAGCAGTTTTGTAAAGGGCAAGG - Intronic
966711732 3:182979929-182979951 AGGCAGTTTTGCTTGGGGCGGGG - Intronic
966872710 3:184301781-184301803 AAGCACTTCTCTGTGGGTCAAGG - Intronic
967245044 3:187477936-187477958 AAGCAGTTGAGTTTTGGGCAAGG + Intergenic
967672115 3:192249030-192249052 AAGCAGTTTCATTTTAGTCATGG - Intronic
970125625 4:12806828-12806850 AAGAGGTTTCGTTTGGCTCATGG + Intergenic
970334671 4:15023897-15023919 GAGCACTTTTGTTTAAGTCAGGG + Intronic
970383124 4:15528282-15528304 AAGCATGTTTGTCTGGGTCCAGG - Intronic
970396214 4:15669524-15669546 AAGCATTTTTTTTTGAGACAAGG - Intronic
973688321 4:53397877-53397899 TAGTAGTTTTGTTTTGGCCATGG + Intronic
974381006 4:61139906-61139928 AAGCACTTTTGTTTCTGTAAGGG - Intergenic
976468740 4:85402165-85402187 AATAAGGTTTGTTTGGCTCATGG - Intergenic
977383731 4:96310032-96310054 AAGCAGTTTTGTTTGATTATAGG - Intergenic
977470788 4:97438736-97438758 AAGGAGGTTTATTTGGCTCATGG - Intronic
977720437 4:100234104-100234126 AAGAAGGTTTGTTTGGGGAAAGG - Intergenic
979244400 4:118482915-118482937 AAGCTGTTTTGTGTGTGACAGGG - Intergenic
979453232 4:120897528-120897550 AAGCAGTTTTGATGAGGTAATGG - Intronic
979509181 4:121532104-121532126 AAGCATTTTTCTTTGGCTCTAGG - Intergenic
979538586 4:121853380-121853402 AAAGAGTTTTGTTTGGGGTATGG - Intronic
980191488 4:129530450-129530472 AAGCAGGTTTTTGTGGGACAAGG - Intergenic
980537063 4:134139773-134139795 TAGCAATTTTGTTTGGGCCTAGG - Intergenic
981292573 4:143093029-143093051 AAGGAGGTTTGTTTGGGGAAAGG + Intergenic
982500924 4:156153574-156153596 AAGGAGGTTTGTTTGGGGAAAGG + Intergenic
982712738 4:158773588-158773610 AAGCATCTTTTTTTAGGTCATGG + Intronic
983985267 4:174052233-174052255 AAGGAGTTATGAGTGGGTCATGG - Intergenic
984148147 4:176090429-176090451 AAGAGGTTTTATTTGGCTCATGG - Intronic
984245104 4:177265843-177265865 AAGCAGCTTTGTTGGAGGCAAGG + Intergenic
984530912 4:180915209-180915231 AAGGAGGTTTATTTGGCTCATGG + Intergenic
986516963 5:8574453-8574475 AAGAAGGTTTATTTGGCTCATGG + Intergenic
987069763 5:14325294-14325316 AAACAGGTTTATTTGGCTCACGG + Intronic
987476086 5:18393866-18393888 AAGTACTTTTGTGTGTGTCATGG + Intergenic
987535309 5:19179501-19179523 AAGGAGTTTTTTTTGGGAGAAGG + Intergenic
988285646 5:29212838-29212860 AGGCAGTTTAGTTTTGGTGAAGG + Intergenic
991997300 5:72400654-72400676 ATGCAGTTTAGTTTGGGGAAGGG - Intergenic
992547874 5:77832853-77832875 AAGCAGTTTTCTTAGGGGCAGGG - Intronic
993072116 5:83178173-83178195 AAGCAGGTTTTTTTGGGAAATGG + Intronic
993135393 5:83954624-83954646 AAGGAGGTTTATTTGGCTCATGG - Intronic
993577310 5:89618800-89618822 AAAGAGGTTTGTTTGGCTCACGG + Intergenic
995221700 5:109655653-109655675 AAGCAGTTTTAATTGTGACAAGG + Intergenic
996802778 5:127422012-127422034 GAGCTTTTTTGTGTGGGTCAGGG - Intronic
997165938 5:131660227-131660249 AAGCAGTTGAGTTTTGGGCAAGG - Intronic
999091245 5:148938091-148938113 AAGCAGTTTTGTTTGGGAGGAGG - Intronic
1000699483 5:164430490-164430512 AATGAGATTTGTTTGGCTCATGG - Intergenic
1001501769 5:172242199-172242221 AAAGAGTTTTATTTGGCTCATGG - Intronic
1001890958 5:175338075-175338097 AAACAGGTTTATTTGGCTCATGG - Intergenic
1005457729 6:26037406-26037428 AAGTAATTTTTTTTGGCTCACGG + Intergenic
1007738962 6:43999705-43999727 AAGCAGTTGTGTTGGAGTCTGGG - Intergenic
1008365535 6:50674952-50674974 ATGTAGGTTTGTATGGGTCATGG + Intergenic
1009310453 6:62145088-62145110 AAAGAGTTTTATTTGGCTCATGG - Intronic
1009998554 6:70924772-70924794 AAGTAGTTTAGTTTGGGGGAAGG - Intronic
1010928967 6:81777472-81777494 AAGGAGGTTTATTTGGCTCATGG + Intergenic
1013472777 6:110479401-110479423 AAGGAGATTTATTTGGCTCATGG - Intergenic
1014948765 6:127529204-127529226 ATGCTGATTTGTTTTGGTCATGG + Intronic
1015285981 6:131487026-131487048 AAACAGGTTTATTTGGCTCATGG + Intergenic
1016277999 6:142377719-142377741 AATCAGTTTTCTTTGGCTGATGG - Intronic
1016374235 6:143404400-143404422 CAGTAGTTTTGTTCGGGGCATGG - Intergenic
1016878534 6:148887517-148887539 AAGCAGTTTTGTCTGACTTAAGG + Intronic
1017121923 6:151032221-151032243 AAGTAGTTTATTTTGGCTCATGG + Intronic
1017531720 6:155299432-155299454 AATCAGTTTTGTGTTGGGCATGG - Intronic
1018165306 6:161088514-161088536 AAGCAGAGTTGTTGGGGTGAGGG - Intronic
1019862641 7:3674520-3674542 AAGGAGTTTTGGTTTGGTGAGGG + Intronic
1021089180 7:16462169-16462191 AAGGAGTTTTGTTTAGGAGAGGG + Exonic
1021477641 7:21080651-21080673 TACCAGTTTTATTTGGCTCATGG + Intergenic
1022602491 7:31774936-31774958 AAGCACATCTGTTTGGGGCAAGG - Intronic
1026078005 7:67191029-67191051 AAGGAGGTTTGTTTGGTTCATGG + Intronic
1026102554 7:67395052-67395074 AAGGAGGTTTATTTGGCTCATGG + Intergenic
1026482077 7:70787971-70787993 AAGCAGTTTTGGTTTGGTTTTGG + Intronic
1026698870 7:72621264-72621286 AAGGAGGTTTGTTTGGCTCATGG - Intronic
1027402341 7:77822103-77822125 TAGCAGTTTTCTCTGGCTCAAGG + Intronic
1028938777 7:96495693-96495715 AAGCACTTTTGTTTGGAAGAGGG - Intronic
1030004802 7:105107015-105107037 AAGCAGTCTTATTTGGGGAATGG + Intronic
1030911277 7:115252196-115252218 AAGGAGTTTTGATTGGATGATGG - Intergenic
1031523707 7:122798252-122798274 AAGTATTGATGTTTGGGTCAAGG - Intronic
1031840526 7:126732877-126732899 AATCAGTTATGTTTAGGTCACGG + Intronic
1033082758 7:138313498-138313520 AAGGAGGTTTGTTTGGGAAAAGG + Intergenic
1033587093 7:142782059-142782081 AAGGAGGTTTGTTTTGGGCAAGG - Intergenic
1033868545 7:145721436-145721458 AAACAGGTTTATTTGGCTCATGG + Intergenic
1033947441 7:146738587-146738609 AAGCATTTTTATATTGGTCAGGG - Intronic
1035057117 7:156043114-156043136 AAGCAGTTCTGTTTCACTCAAGG - Intergenic
1037134272 8:15443647-15443669 AAGCAGCTTTGTTTTGGGAAAGG - Intronic
1037393760 8:18420767-18420789 AAAGAGGTTTATTTGGGTCATGG - Intergenic
1037979700 8:23243253-23243275 AAGGAGTTTTGTTTTGGGAAAGG + Intergenic
1038489698 8:27961468-27961490 AAACAGGTTTATTTGGCTCATGG - Intronic
1039055483 8:33533087-33533109 AAGCAGTTTTGCTGGATTCATGG - Intergenic
1039499723 8:38006936-38006958 AAACAGTTTTCTTTGCTTCATGG - Intergenic
1039913454 8:41842714-41842736 AGGCAGCTTTGTTTGGGACTGGG + Intronic
1040998038 8:53421529-53421551 AAGAAGTTTTGTTTTGGAAAAGG - Intergenic
1043004973 8:74808073-74808095 AAGCAGTTGAGTTTTGGGCAAGG - Intronic
1043545702 8:81313236-81313258 AAAGAGATTTGTTTGGTTCATGG + Intergenic
1043570707 8:81599558-81599580 AAGGAGGTTTGTTTGGGGAAAGG + Intergenic
1045598468 8:103685189-103685211 AAAGAGTTTTATTTGGCTCATGG + Intronic
1045624098 8:104022240-104022262 AGGCAGTTTTGTTTTGGGGAAGG + Intronic
1045765668 8:105665021-105665043 AAGAAGTTTATTTTGGCTCATGG + Intronic
1045879239 8:107018632-107018654 AAGAAGTTTATTTTGGCTCACGG + Intergenic
1046227777 8:111307656-111307678 AAATAGGTTTGTTTGGTTCATGG + Intergenic
1047304666 8:123643047-123643069 AAACAGGTTTATTTGGTTCATGG + Intergenic
1049347960 8:142148739-142148761 AAATAGTTTTTTTTAGGTCAGGG + Intergenic
1050107101 9:2176886-2176908 GAGTAGACTTGTTTGGGTCATGG - Intronic
1050944486 9:11500261-11500283 AGGCAGTTGAGTTTGGGTGAAGG - Intergenic
1051194224 9:14546148-14546170 AAGAAGGTTTATTTGGCTCATGG + Intergenic
1055998862 9:82193248-82193270 AAGCAGTTGAGTTTGGGGCAAGG - Intergenic
1057202482 9:93149777-93149799 AAGCAAAATTATTTGGGTCAAGG - Intergenic
1057857083 9:98610036-98610058 CAGGAGTTTGGTTTGGGGCATGG - Intronic
1061371505 9:130200295-130200317 AAGCATTTTTGTTTGTTTCATGG + Intronic
1186033857 X:5399437-5399459 AAGGAGTTTGTTTTGGGACAGGG - Intergenic
1186182006 X:6982721-6982743 AAACAGTTTAGTTTGGGGGAAGG + Intergenic
1187511751 X:19925888-19925910 AAGCTGTTCTGTTTGTGCCAGGG - Intronic
1188211604 X:27432100-27432122 AAACAGTTTTATCTGGATCATGG + Intergenic
1189627864 X:42918860-42918882 AGGCAGACTTTTTTGGGTCACGG + Intergenic
1192382041 X:70627124-70627146 AAGCAGTTTTGTTAGAGTGGTGG + Intronic
1192487812 X:71545321-71545343 AAGCTGGTTTGTTTGGGAAATGG + Intronic
1192744154 X:73922084-73922106 AAAGAGGTTTATTTGGGTCATGG + Intergenic
1193046258 X:77058071-77058093 AAACAGGTTTATTTGGCTCATGG - Intergenic
1193632884 X:83911541-83911563 AAACAGGTTTATTTGGCTCATGG + Intergenic
1193993940 X:88342351-88342373 AAGTAGTTGAGTTTGGGGCAAGG + Intergenic
1193995036 X:88355179-88355201 AAAGAGGTTTGTTTGGCTCATGG + Intergenic
1194749241 X:97666097-97666119 AATCGGTGGTGTTTGGGTCATGG + Intergenic
1194808746 X:98364215-98364237 AAGGGGTTTTGTTTTGGTAATGG - Intergenic
1196261108 X:113582822-113582844 AAGTAGTTTATTTTGGCTCATGG + Intergenic
1196495296 X:116317729-116317751 AAGCTGTTTTGTCTGGGCCTGGG - Intergenic
1196780874 X:119383046-119383068 AAAGAGGTTTGTTTGGCTCATGG - Intergenic
1197446819 X:126560929-126560951 AAGAAGTGAGGTTTGGGTCAAGG - Intergenic
1197479542 X:126965764-126965786 AAAGAGGTTTGTTTGGATCATGG + Intergenic
1197981800 X:132225092-132225114 AAGCAGTTTTGTTTCTTTGAAGG + Intergenic
1199904320 X:152208862-152208884 AAAGAGTTTTATTTGGTTCATGG - Intronic
1200367621 X:155684066-155684088 AAGCTGATTTGGTGGGGTCATGG + Intergenic
1201350912 Y:13040285-13040307 AAACAGTTTTATTTGCCTCATGG + Intergenic