ID: 906428568

View in Genome Browser
Species Human (GRCh38)
Location 1:45735395-45735417
Sequence ATGTTGTTTTTGTAGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17544
Summary {0: 1, 1: 3, 2: 80, 3: 1413, 4: 16047}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906428564_906428568 30 Left 906428564 1:45735342-45735364 CCAAAGTGCTGGGATTAAAGGCA 0: 609
1: 102346
2: 241916
3: 242451
4: 213620
Right 906428568 1:45735395-45735417 ATGTTGTTTTTGTAGAAACAAGG 0: 1
1: 3
2: 80
3: 1413
4: 16047
906428565_906428568 0 Left 906428565 1:45735372-45735394 CCACACCCAGCAACTAATTTTAA 0: 1
1: 0
2: 8
3: 92
4: 1056
Right 906428568 1:45735395-45735417 ATGTTGTTTTTGTAGAAACAAGG 0: 1
1: 3
2: 80
3: 1413
4: 16047
906428566_906428568 -5 Left 906428566 1:45735377-45735399 CCCAGCAACTAATTTTAAATGTT 0: 1
1: 2
2: 5
3: 42
4: 536
Right 906428568 1:45735395-45735417 ATGTTGTTTTTGTAGAAACAAGG 0: 1
1: 3
2: 80
3: 1413
4: 16047
906428567_906428568 -6 Left 906428567 1:45735378-45735400 CCAGCAACTAATTTTAAATGTTG 0: 1
1: 0
2: 1
3: 27
4: 304
Right 906428568 1:45735395-45735417 ATGTTGTTTTTGTAGAAACAAGG 0: 1
1: 3
2: 80
3: 1413
4: 16047

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906428568 Original CRISPR ATGTTGTTTTTGTAGAAACA AGG Intronic
Too many off-targets to display for this crispr