ID: 906430517

View in Genome Browser
Species Human (GRCh38)
Location 1:45752036-45752058
Sequence CCGTCCAGCCTTACACTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906430517_906430520 -7 Left 906430517 1:45752036-45752058 CCTTTCAGTGTAAGGCTGGACGG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 906430520 1:45752052-45752074 TGGACGGATTTGCATCCATAGGG 0: 1
1: 0
2: 0
3: 1
4: 48
906430517_906430519 -8 Left 906430517 1:45752036-45752058 CCTTTCAGTGTAAGGCTGGACGG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 906430519 1:45752051-45752073 CTGGACGGATTTGCATCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906430517 Original CRISPR CCGTCCAGCCTTACACTGAA AGG (reversed) Intergenic
901646652 1:10720513-10720535 CCCTCCAGCCTTACAGTCCAGGG - Intronic
902921894 1:19671225-19671247 CCCTCCAGCCTTTCACTTTAGGG - Intronic
906430517 1:45752036-45752058 CCGTCCAGCCTTACACTGAAAGG - Intergenic
908717479 1:67085926-67085948 CTGCCCAGCATTCCACTGAAAGG - Intergenic
913699780 1:121362985-121363007 CCAACCAGCCATACACTAAAGGG + Intronic
914137761 1:144917051-144917073 CCAACCAGCCATACACTAAAGGG - Intronic
920487193 1:206381694-206381716 CCAACCAGCCATACACTAAAGGG + Intronic
921967461 1:221105537-221105559 CTGCCCCGCCTTACACTGATTGG - Intergenic
922325020 1:224520249-224520271 CTCTCAAGCCTTACACAGAAAGG + Intronic
1069724483 10:70568526-70568548 CTGCCCACCCTTACTCTGAAGGG - Intergenic
1076056267 10:127375690-127375712 CTGTCCAGCCATGCAATGAAGGG - Intronic
1090153712 11:124413906-124413928 CCCTCCAACATGACACTGAATGG - Intergenic
1092793004 12:12085669-12085691 CCCTCCAGCCATTCACGGAAAGG - Intronic
1095600289 12:44005483-44005505 CCATCCAGCCTTGCTCTGACTGG + Intronic
1114572530 14:23682897-23682919 CCATCCAGCATCACACTGGAGGG + Intergenic
1121203874 14:92144526-92144548 CCTTCCAGCCTTAAACTCAGTGG + Intronic
1123631695 15:22265452-22265474 GGGACCAGCCTTACACAGAAAGG - Intergenic
1132065593 15:98728279-98728301 CCGGCCAGCCTTTCACAGACAGG - Intronic
1135726098 16:24854869-24854891 GCCTCCACCCTTACCCTGAAAGG + Intronic
1137592792 16:49704002-49704024 CCTTCCTCCCTTGCACTGAATGG - Intronic
1141971299 16:87484967-87484989 GGGACCAGCCTTACACAGAAAGG + Intronic
1142306396 16:89288335-89288357 CCGTCCAGGCTGACCCAGAAGGG + Intronic
1144029745 17:11308831-11308853 CCTTCCAGTCTGACTCTGAAAGG - Intronic
1151579708 17:74971259-74971281 CCCTGCAGCCCTACACTGAGGGG + Intronic
1152443709 17:80327501-80327523 CAGTCCATCCGTATACTGAAGGG + Intronic
1153386736 18:4506585-4506607 CCAACAAGCATTACACTGAATGG + Intergenic
929298497 2:40274364-40274386 CTGTCCAGCCCCACACTGAAGGG + Intronic
930381171 2:50631727-50631749 CAGTCCAGCCAGACACAGAATGG - Intronic
937084983 2:119165667-119165689 CCGTTCTGCCCTACACTGTAGGG - Intergenic
939564123 2:143766518-143766540 CCTTCCACCTTTCCACTGAATGG - Intronic
939940590 2:148345955-148345977 ACGTCCACCCTTAATCTGAATGG - Intronic
948831132 2:240598749-240598771 CCGGCCAGCCTTGCACTGTGGGG + Exonic
1169042922 20:2510601-2510623 CTGTCCTGCCTTTCACAGAAAGG + Intronic
1170051920 20:12155591-12155613 TCAGCCATCCTTACACTGAAGGG - Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1181593463 22:23898253-23898275 CCCACCAGCCCCACACTGAAGGG + Intronic
1182020973 22:27081174-27081196 CCTTCCAGCCCTAGGCTGAAGGG - Intergenic
1183702108 22:39456856-39456878 CCGTCCACGCATACACAGAACGG + Intergenic
1185228498 22:49667504-49667526 CAGCCCAGCCTTACCCGGAATGG + Intergenic
953017186 3:39088704-39088726 CAGTCCAGCCCTTCCCTGAAGGG - Intronic
955888884 3:63629593-63629615 TCGTCAATCCTTACCCTGAATGG - Intergenic
959554986 3:107706419-107706441 CTGTCCTGCCATACACAGAAAGG + Intronic
960489207 3:118291618-118291640 ACAGCCAGCATTACACTGAATGG - Intergenic
961325781 3:126108482-126108504 CCGGCCATCCTTGCACTGCAAGG + Intronic
964481643 3:157144593-157144615 GCTTCCAGCCTTAGAGTGAAAGG + Intergenic
965677188 3:171210249-171210271 AAGTCCAGGCTTCCACTGAATGG + Intronic
966847952 3:184145039-184145061 CCATCCAGGCTGAGACTGAAAGG + Exonic
971346126 4:25813360-25813382 CCATTCAGCCTTAAAATGAAAGG + Intronic
979635572 4:122951732-122951754 CCATCCAGCCATCCACTGACAGG - Intronic
985733985 5:1566623-1566645 CAGTGCAGCCTGACTCTGAAGGG + Intergenic
990569122 5:57060201-57060223 CCTTCCAGCCTTTCACCTAATGG + Intergenic
1006155661 6:32011586-32011608 CTGTACAGCCTGACACTGTATGG - Intergenic
1006161992 6:32044440-32044462 CTGTACAGCCTGACACTGTATGG - Exonic
1008208471 6:48691422-48691444 CCAACCAACATTACACTGAATGG + Intergenic
1019277014 7:181234-181256 CCGTCCAGCCCTTCACAGAGCGG + Intergenic
1021678449 7:23105463-23105485 CCATGAAGCCTTACACTGATGGG + Intergenic
1027056380 7:75052697-75052719 CCGGCCAGCCTTACCCTCCATGG + Exonic
1041768080 8:61441301-61441323 CGGTCCTCCCTTACACTAAAGGG + Intronic
1187480510 X:19650744-19650766 CTTTCCTGCCTCACACTGAATGG - Intronic