ID: 906433119 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:45772228-45772250 |
Sequence | CTTGGGAAGCCCAAGGTGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
906433119_906433124 | -8 | Left | 906433119 | 1:45772228-45772250 | CCATCCACCTTGGGCTTCCCAAG | No data | ||
Right | 906433124 | 1:45772243-45772265 | TTCCCAAGTGCTGGGATTATAGG | 0: 22 1: 1612 2: 42986 3: 339877 4: 251892 |
||||
906433119_906433127 | 11 | Left | 906433119 | 1:45772228-45772250 | CCATCCACCTTGGGCTTCCCAAG | No data | ||
Right | 906433127 | 1:45772262-45772284 | TAGGTATGAGCTACCATGCCTGG | 0: 4 1: 190 2: 3579 3: 26331 4: 82540 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
906433119 | Original CRISPR | CTTGGGAAGCCCAAGGTGGA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |