ID: 906433119

View in Genome Browser
Species Human (GRCh38)
Location 1:45772228-45772250
Sequence CTTGGGAAGCCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906433119_906433124 -8 Left 906433119 1:45772228-45772250 CCATCCACCTTGGGCTTCCCAAG No data
Right 906433124 1:45772243-45772265 TTCCCAAGTGCTGGGATTATAGG 0: 22
1: 1612
2: 42986
3: 339877
4: 251892
906433119_906433127 11 Left 906433119 1:45772228-45772250 CCATCCACCTTGGGCTTCCCAAG No data
Right 906433127 1:45772262-45772284 TAGGTATGAGCTACCATGCCTGG 0: 4
1: 190
2: 3579
3: 26331
4: 82540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906433119 Original CRISPR CTTGGGAAGCCCAAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr