ID: 906436406

View in Genome Browser
Species Human (GRCh38)
Location 1:45800560-45800582
Sequence CTGGGTGCTCAACTGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906436399_906436406 3 Left 906436399 1:45800534-45800556 CCAAGTTGTGTGGGCTGTGTTCC 0: 1
1: 0
2: 0
3: 9
4: 145
Right 906436406 1:45800560-45800582 CTGGGTGCTCAACTGGAGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 238
906436398_906436406 6 Left 906436398 1:45800531-45800553 CCACCAAGTTGTGTGGGCTGTGT 0: 1
1: 0
2: 0
3: 14
4: 108
Right 906436406 1:45800560-45800582 CTGGGTGCTCAACTGGAGAAGGG 0: 1
1: 0
2: 0
3: 15
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906436406 Original CRISPR CTGGGTGCTCAACTGGAGAA GGG Intronic
900422205 1:2560510-2560532 CTGGGTGCTCTACGGGTGATGGG - Intronic
901348735 1:8572341-8572363 CTGTGTGCTAAAATGGAGGAAGG - Intronic
902635090 1:17729715-17729737 CTGGGTGCTCCCCCTGAGAAAGG - Intergenic
903010366 1:20325690-20325712 CAGTGAGCTGAACTGGAGAAGGG - Intronic
904412314 1:30331890-30331912 GGGGCTGCTCAGCTGGAGAAGGG - Intergenic
905907848 1:41631488-41631510 CAGGGTGCCCAAGAGGAGAAAGG - Intronic
906172371 1:43737950-43737972 CAGTTTGCTCAACTGGAAAATGG - Intronic
906436406 1:45800560-45800582 CTGGGTGCTCAACTGGAGAAGGG + Intronic
907981613 1:59487188-59487210 CAGGGAGCTCAACCCGAGAATGG - Intronic
909784417 1:79593228-79593250 TTGGTTGCACAGCTGGAGAAGGG - Intergenic
912572726 1:110636425-110636447 CTGGGTTCTTAACTAGAAAAGGG - Intergenic
913165477 1:116180896-116180918 CCGGTTGGTCAACTGGGGAAAGG + Intergenic
914437663 1:147673967-147673989 ATGGGAGCAAAACTGGAGAAAGG + Intergenic
915553321 1:156647467-156647489 CTGGGTGCTCACCTGGCTCAGGG + Intronic
919779886 1:201215002-201215024 CTGGGTGGTGAGCTGGAGACAGG - Exonic
919861097 1:201739983-201740005 CTGGGTGCCCACCCGGTGAATGG + Intronic
919991739 1:202712069-202712091 CTGGCTGCTCCACAGGTGAAGGG - Intergenic
920288915 1:204902763-204902785 CTGGGTGCTTAAGAGGAAAAGGG + Intronic
920374395 1:205499735-205499757 CTGTTTGCTCACCTAGAGAATGG - Intergenic
921317403 1:213905372-213905394 CCGTGTGCTCAACTGCACAATGG - Intergenic
922222343 1:223618331-223618353 CTGGGTCCTCACCTGGTGCAAGG - Intronic
923083800 1:230686118-230686140 CTGAGTCTTCATCTGGAGAATGG + Intronic
1063428137 10:5965554-5965576 CTGGCTGGTCATCTGGAAAACGG - Intronic
1063624173 10:7673903-7673925 CTGGGTGCTCTATTGGAGGCAGG - Intergenic
1063762250 10:9093087-9093109 CTGTGTCCTCACCTGGAGGAAGG - Intergenic
1065623712 10:27609560-27609582 CTGGGTGCTAAAGTGCTGAATGG + Intergenic
1066704251 10:38160230-38160252 CTGGTTCATTAACTGGAGAATGG + Intergenic
1067906726 10:50298754-50298776 CTGGGTGCTTATCTTTAGAATGG - Intergenic
1068543834 10:58325443-58325465 CTGGGTGCTTTGCTGAAGAATGG + Intergenic
1068563514 10:58544809-58544831 CTGGGAGCTCATTTGGAGATAGG + Intronic
1069934464 10:71905771-71905793 GCTGGTGCTCACCTGGAGAAGGG - Intergenic
1071268360 10:83984245-83984267 CTGGGTAGTCAGCTAGAGAAAGG - Intergenic
1071518831 10:86316495-86316517 CTGGGTCCAGCACTGGAGAAAGG - Intronic
1073048164 10:100652119-100652141 CTGAGTGGTCAACTGGAAGAAGG - Intergenic
1073429288 10:103475979-103476001 CTGCTTCCTCACCTGGAGAATGG + Intronic
1073569651 10:104566918-104566940 CTGTGTGCTCACATGAAGAAAGG - Intergenic
1074896895 10:117784974-117784996 CTGGGTGCTCAAGGGGAGGGTGG - Intergenic
1074979056 10:118604608-118604630 GTGGATGCTCACCAGGAGAAAGG - Intergenic
1075080625 10:119381264-119381286 ATGGGTTCTCAGCTGGAGGAAGG - Intronic
1076206711 10:128609833-128609855 CTGCTGTCTCAACTGGAGAAGGG + Intergenic
1079195584 11:18323526-18323548 CTGGGTCTTCAAATGGACAAAGG - Intronic
1079368971 11:19833747-19833769 CTGGAGGCTTAACTGGGGAAGGG + Intronic
1079384284 11:19965156-19965178 CTGTGTCCTCAACAGGAGAATGG - Intronic
1080233684 11:30045636-30045658 CTGGGTGCTCAACTTGTGCCTGG - Intergenic
1080774143 11:35370207-35370229 CTGTTTCCTCAACTGAAGAATGG - Intronic
1081176135 11:39928841-39928863 CATGGTCCTCAACTGGGGAATGG - Intergenic
1081897385 11:46598345-46598367 CTGGATACTGAACAGGAGAAAGG - Intergenic
1084093590 11:66895237-66895259 CTGGGAGCTCAGTTGGGGAAGGG - Intronic
1084098016 11:66925283-66925305 CTGGGAGCTCTACGGGAGACTGG + Intronic
1084102204 11:66957258-66957280 CTGTTTTCTCAGCTGGAGAACGG + Intronic
1084858503 11:72003693-72003715 CTGGGTGCTCTCCATGAGAATGG + Intronic
1084888952 11:72227264-72227286 CTGTTTCCTCAGCTGGAGAATGG + Intronic
1086154376 11:83649339-83649361 CCTGGTGCTCAAAGGGAGAAAGG + Intronic
1088512214 11:110589422-110589444 CTGGGCACTCAGCTGGAGTAGGG + Intronic
1089388020 11:118080500-118080522 CTGGGTGCTTCCCTGGAGAAGGG + Intronic
1089784487 11:120898386-120898408 CCGGGGGCTGAACTGCAGAAGGG - Intronic
1091370607 11:135055036-135055058 CTGGGAGCTCAGGTGGAGAATGG - Intergenic
1091920075 12:4297028-4297050 CACGGTGCTCAAGTGGAGAAAGG + Intronic
1092296271 12:7201625-7201647 GTAGGTTCTCAACAGGAGAATGG + Intronic
1092491612 12:8950227-8950249 CAAGGTACTCAACTGGAAAAAGG - Intronic
1094091596 12:26655972-26655994 CTGGGTCCTCATCTGTAAAATGG + Intronic
1096668048 12:53180411-53180433 CTGGGTGCTCGATGGGAGGAGGG - Intronic
1096948779 12:55441388-55441410 CTGGGAGCACTACTGGAGACCGG + Intergenic
1100793136 12:98152483-98152505 ATGGGGGTTCAACTGGACAAAGG + Intergenic
1102778034 12:115537940-115537962 CTGAAGGCTCAACTGGGGAAAGG - Intergenic
1103120424 12:118375763-118375785 CTGAGCTCTCAACTGAAGAAGGG - Intergenic
1104414239 12:128584775-128584797 CTGGGTGCTCCACTGGGCGAGGG + Intronic
1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG + Exonic
1106298212 13:28437724-28437746 TTGGGTGCTCAGCAGGAGACAGG + Intronic
1106594555 13:31125313-31125335 CTGGGATCTCACCAGGAGAAGGG - Intergenic
1106690068 13:32105277-32105299 CTGTGTCCTCACATGGAGAAAGG - Intronic
1110281213 13:73696461-73696483 CTGGGAGCTCATTTGGACAATGG - Intronic
1111931308 13:94515796-94515818 CTGGGAGTTCAGCTAGAGAATGG + Intergenic
1112928150 13:104702846-104702868 CTGATTGCTCATCTGGAAAATGG - Intergenic
1114613680 14:24057464-24057486 CAGGGTGCACAGCTGGGGAAGGG - Intronic
1114888757 14:26889023-26889045 CTGGGTCCTCATATGGTGAAAGG + Intergenic
1117155813 14:52939605-52939627 CTGGTTCCTCATCTGGAAAATGG - Intronic
1117714569 14:58567321-58567343 CTGGGTGCTCAAGAGGTGATTGG - Intergenic
1118401033 14:65379877-65379899 CTGGGTCCTCACCTGGAAGAAGG + Intergenic
1118640160 14:67784781-67784803 CTGGGTGCTCAAATTCACAATGG + Intronic
1118667309 14:68085006-68085028 TTTGGTGATTAACTGGAGAAAGG + Intronic
1119210621 14:72828925-72828947 CTGGGTGTCCCACTGGAGATAGG + Intronic
1119221386 14:72910669-72910691 GAGGGGGCTCAGCTGGAGAAAGG - Intergenic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126795836 15:52260004-52260026 CTGGTTTCTTAACAGGAGAAGGG - Intronic
1127498695 15:59536340-59536362 CTGGCTGCTCAACTAGACCATGG + Intergenic
1128598802 15:68977561-68977583 CTGGGAGCGCTACTGGAGACCGG + Intronic
1130541927 15:84826669-84826691 CTGGGAGATGGACTGGAGAAGGG + Intronic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1134183056 16:12062984-12063006 CTGTGTCCTCATCTGGAAAATGG + Intronic
1135565235 16:23506756-23506778 TTGGGTGCTCAAGTGGAACAGGG - Intronic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1136079306 16:27841154-27841176 CTGTGTCCTCAGCTGGAAAATGG - Intronic
1136091274 16:27921793-27921815 CAGGGTCCTCAACTTGAGAAGGG - Intronic
1136394359 16:29985044-29985066 CTGTTTCCTCAACTGGATAATGG - Intronic
1137591209 16:49695052-49695074 CTCGGTGCAGAACTGGGGAATGG - Intronic
1138161994 16:54763034-54763056 CTGGGTGCTCACCTGTAGGCAGG + Intergenic
1140192589 16:72830592-72830614 CTGTGTACTGAACTGGAGAGAGG - Intronic
1142715590 17:1745373-1745395 CTGGTTGCCCAACTTGAGGAGGG - Exonic
1142854773 17:2723651-2723673 CTGGGAGCTCTGCTGGGGAAGGG - Intergenic
1146553628 17:33804067-33804089 CTGGGTGTTCAAATAGGGAAAGG - Intronic
1147991089 17:44333962-44333984 CAGGGGGCCCACCTGGAGAAAGG + Intergenic
1148474078 17:47915766-47915788 CTGATTGCTCAACTGAGGAAAGG - Intronic
1148896936 17:50844344-50844366 CTGGGGGCTGATCTGGAGACAGG - Intergenic
1152698066 17:81806129-81806151 ATGGGTGCTCAGCTGGAAATTGG + Intronic
1153000830 18:454073-454095 CAGAGGGCTCAACTAGAGAACGG - Intronic
1153243738 18:3053874-3053896 CTGGGTGCTTAGTTGGAGAATGG - Intergenic
1159031267 18:63234623-63234645 CTGTGTGCTCATCTGTAAAATGG + Intronic
1159280141 18:66274500-66274522 CTGGGAGCTCTACGGGAGACCGG - Intergenic
1159611821 18:70534043-70534065 CTGGGATGACAACTGGAGAAAGG - Intergenic
1160077494 18:75692187-75692209 CTGTGTTCTCATCTGTAGAATGG + Intergenic
1161326873 19:3668272-3668294 TGGGGTCCTCATCTGGAGAACGG + Intronic
1161814583 19:6492014-6492036 CTGGGGGCTCAGCAGGAGTAAGG - Intergenic
1162732830 19:12729222-12729244 CTGTGTGCTCCACTGGGGGAAGG - Intergenic
1163152691 19:15424498-15424520 ATGGGTAAGCAACTGGAGAAAGG + Intronic
1163218536 19:15897923-15897945 CTGGGTGCTGGCCTGGAGGATGG - Intronic
1164674605 19:30092994-30093016 TTGGGTCCTCATCTGGAAAATGG + Intergenic
1166197688 19:41217805-41217827 CTGGTTGCTAAATGGGAGAAAGG + Intergenic
1167735286 19:51290792-51290814 CTGGGTCCTCATGTGGTGAAAGG - Intergenic
1167740692 19:51323459-51323481 CTGTGAGCCCAACTGCAGAACGG - Intronic
1168721067 19:58555304-58555326 CTGGGTCCTCAAGTGGAGGTTGG - Intergenic
925025739 2:605938-605960 CTGGGGGCTCACCTGCAGCATGG - Intergenic
925072694 2:983604-983626 CTGAGTGCAGAACAGGAGAAGGG - Intronic
925442882 2:3903605-3903627 CTCTGTGCACAACTAGAGAAAGG - Intergenic
925568108 2:5279046-5279068 CTGGGTGTTCAGCTTGAGAAAGG - Intergenic
926400911 2:12495506-12495528 CTGGGGGTTCAACTAAAGAAGGG + Intergenic
926425554 2:12735962-12735984 CTGGGTGCTCATCTTGAGGTAGG + Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929796098 2:45059312-45059334 CTTGGTACCCATCTGGAGAAAGG + Intergenic
930053206 2:47232972-47232994 CTGTTTGCTCAACTGCAAAATGG + Intergenic
931314201 2:61111713-61111735 CTGAGAGCAGAACTGGAGAAAGG - Intronic
934946416 2:98545733-98545755 CTGGGTGCTCAGGTGGTGAATGG - Intronic
935825826 2:106948265-106948287 CTGAGTCCTCAAATGGTGAAAGG + Intergenic
936097621 2:109544540-109544562 CAGGGTTCTCAAGTGGAGCAGGG + Intronic
936244833 2:110817452-110817474 CTGGAGGCTGCACTGGAGAAGGG + Intronic
936537376 2:113322883-113322905 CAGGTTTCTCAACTGGAAAATGG - Intergenic
939089920 2:137768190-137768212 CTGTGTCCTCACCTGGTGAAAGG + Intergenic
939392736 2:141589862-141589884 TAGGGTGCACATCTGGAGAAAGG + Intronic
940736341 2:157457061-157457083 CTGTGTGCTCATCTGTAAAATGG + Intronic
940936880 2:159505952-159505974 CTGAGTGCTCATCTGGACACCGG - Intronic
942590537 2:177541295-177541317 CTGGGTGCTAACATGCAGAAAGG - Exonic
943551497 2:189345712-189345734 CTGGTTGTTCAAATAGAGAAGGG + Intergenic
944912875 2:204327463-204327485 CTGGCTGCAGACCTGGAGAAAGG + Intergenic
945924683 2:215791208-215791230 CTGTGTTCTCAACTTTAGAATGG - Intergenic
946615045 2:221500163-221500185 CTGTTTCCTCACCTGGAGAATGG - Intronic
1169909003 20:10631945-10631967 CTGGATGCTCAACCAGGGAAAGG + Intronic
1171116554 20:22529798-22529820 CTGGCTTCTCAACTGGAGCTGGG + Intergenic
1172879800 20:38192494-38192516 CTGCGTGCTCATCTGTAAAATGG + Intergenic
1173951608 20:46997865-46997887 CTTGGAGCTCATCTGAAGAATGG + Intronic
1176031796 20:63016386-63016408 CTGGGTGCAGGACTAGAGAAGGG - Intergenic
1176200645 20:63858773-63858795 CTGGGGGCTCTTCTGGAGAGGGG + Intergenic
1177440134 21:21111831-21111853 CTAGGAGCTCAAATGGACAAGGG + Intronic
1177588846 21:23135454-23135476 CTGGGAGCACTACTGGAGAGTGG + Intergenic
1179645880 21:42775830-42775852 CTGGGTGCTCATGTGGAGGAAGG + Intergenic
1181489957 22:23255538-23255560 CTAAGTGCTGAACTTGAGAAAGG + Intronic
1182103849 22:27675126-27675148 TGGGGTGAACAACTGGAGAACGG - Intergenic
1182792806 22:32967024-32967046 CAGGTTCCTCATCTGGAGAATGG + Intronic
1182977640 22:34638238-34638260 CTGGGTGCTCATCTGTAGGTGGG - Intergenic
1184306487 22:43606416-43606438 CTGGGTGAACAAATGAAGAAAGG + Intronic
1184785099 22:46667871-46667893 CTGGGTGCACAACAGGAGTGGGG - Intronic
1185258238 22:49848453-49848475 CTGGGTGCTGAGCTGGAGTCTGG - Intergenic
949485155 3:4531076-4531098 CAGGGTGCCCAACTGTAAAATGG - Intronic
950220352 3:11190797-11190819 CTGGCTGCTCAACGTGAGCAGGG - Intronic
950560423 3:13718271-13718293 CTATGTGCTCACCTGGAAAATGG + Intergenic
951308747 3:21098563-21098585 CTGTGTGCTCATCTGTGGAATGG - Intergenic
951924095 3:27888108-27888130 CTGGAGGCTGAACCGGAGAATGG - Intergenic
953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG + Intergenic
955167875 3:56532677-56532699 CTGGATGCATGACTGGAGAAAGG + Intergenic
956742938 3:72289174-72289196 CTGGGGGCTCAAGGGGAGATGGG + Intergenic
957168926 3:76711892-76711914 CAAGGCACTCAACTGGAGAAAGG - Intronic
958625266 3:96614903-96614925 CTGGGAGCGCTACTGGAGACCGG + Intergenic
958970696 3:100607083-100607105 CTGTGTGGTCATCTGCAGAATGG - Intergenic
959651743 3:108757126-108757148 CGGGTTGATCAGCTGGAGAAGGG + Exonic
960971666 3:123144145-123144167 CCGGGTGCTCAGCTGGAGGCAGG + Intronic
963043738 3:141087611-141087633 CTGTTTGCTCATCTGGAAAATGG - Intronic
963749081 3:149156390-149156412 CTGGGTCTTGAACTGGAGAAGGG - Intronic
964159412 3:153628792-153628814 CTGTGTTCTAAACTTGAGAATGG - Intergenic
965400731 3:168209540-168209562 CTGGGAGCGCAACAGGAGACTGG + Intergenic
967815375 3:193794030-193794052 CTGGGTCTTCAACTGGAAAATGG - Intergenic
969607122 4:8207849-8207871 CTGGCTTTTCAACTGGAGGATGG + Intronic
969856071 4:10000850-10000872 TTGGCTGAGCAACTGGAGAATGG - Intronic
971963397 4:33518636-33518658 CTGGAAGCTAATCTGGAGAAAGG - Intergenic
972619311 4:40731790-40731812 CTGGGAGCCCAAGTGGAGACCGG + Intergenic
973959636 4:56096972-56096994 GTGGTTGCTTAAGTGGAGAAAGG + Intergenic
977180866 4:93872178-93872200 TTAGTTGCTCAACAGGAGAAAGG - Intergenic
977309823 4:95372172-95372194 CAGGATGCTCCACTGGAGAAGGG - Intronic
977577192 4:98687678-98687700 CTGGGCGATGAACAGGAGAATGG - Intergenic
979005093 4:115284325-115284347 CTGGGTAGTGGACTGGAGAAAGG + Intergenic
982126704 4:152189976-152189998 ATCTGTTCTCAACTGGAGAAGGG - Intergenic
982292070 4:153790678-153790700 CCGGGTGCTCTGCTGGGGAAGGG + Intergenic
985379475 4:189377201-189377223 CTGGATGCTCAGCTGGAGGTAGG + Intergenic
986300260 5:6472922-6472944 CTGGCAGCTCACATGGAGAAGGG - Intronic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
987571933 5:19675365-19675387 CTGGGAGCGCTACTGGAGACCGG + Intronic
990711379 5:58583716-58583738 CTGGGAGCCTAACTGAAGAAAGG - Intronic
996049321 5:118914312-118914334 CTTTGTCCTCAACTGGTGAAAGG - Intronic
996796479 5:127353622-127353644 ATGGGAGCTGGACTGGAGAAGGG - Intronic
998629735 5:143884723-143884745 CTGGGTGTTACACTGGAGAAAGG - Intergenic
999202353 5:149825314-149825336 CTGTGTCCTCAACTGCAAAATGG + Intronic
1001511431 5:172325583-172325605 CTGGGTCCTCACGTGGTGAAAGG + Intronic
1001882663 5:175258114-175258136 GTGGGTGCTCACCAGGTGAAAGG - Intergenic
1002602549 5:180362219-180362241 GGGGGTGCCCAGCTGGAGAAAGG - Intergenic
1003001784 6:2342373-2342395 TTGGGTAGTCAACTGAAGAAGGG + Intergenic
1003747311 6:9017168-9017190 CTGGGTGCTGACTGGGAGAAAGG - Intergenic
1005353525 6:24960341-24960363 CTGTGTCCTCACATGGAGAAGGG + Intronic
1005501620 6:26433896-26433918 CTGGGAGCGCAACGGGAGACCGG - Intergenic
1008251245 6:49242573-49242595 CTGGGAGCGCTACTGGAGACAGG + Intergenic
1009572330 6:65402664-65402686 ATGGGTTCTTACCTGGAGAAGGG + Intronic
1009815362 6:68726335-68726357 CTGTGTGCACATCTTGAGAAAGG - Intronic
1013795908 6:113888590-113888612 ATGTGTGCTCAACTGCAGACAGG + Intergenic
1016031898 6:139346363-139346385 CTGGGAGATCAATTGGAAAAAGG + Intergenic
1018042828 6:159940303-159940325 GTGGGTGCTCAGCTAGAGGAAGG - Intergenic
1018350838 6:162957170-162957192 CAGGGTCCTCACCTGGAGAATGG + Intronic
1019609956 7:1931319-1931341 CTTGCTCCTCATCTGGAGAATGG + Intronic
1019643760 7:2118266-2118288 CTGGGGGCTCCTCTGCAGAACGG + Intronic
1019702568 7:2480998-2481020 CTGGGTGCTCAACTCTGGGAGGG + Intergenic
1022203160 7:28137498-28137520 CTGGGTGGGGAACTGGAAAAGGG - Intronic
1024538160 7:50455472-50455494 GTAGGTGCTCAAATGGAGATAGG - Intronic
1028584645 7:92440551-92440573 CTGGGGGGTCAAATGGGGAAGGG - Intergenic
1030240876 7:107322809-107322831 CTTGTTTCTCAACTGCAGAATGG + Intronic
1030626342 7:111849723-111849745 CTAGGTGTTCCACTGGAGCAGGG + Intronic
1032269288 7:130388908-130388930 CTGTGGTCTCAACAGGAGAATGG - Intergenic
1032499972 7:132392914-132392936 CTGGGTGCTCAGATGGACACAGG - Intronic
1034840956 7:154396248-154396270 CTGGTTTCTCATCTGTAGAATGG - Intronic
1034873271 7:154702513-154702535 CTGGTTGCTGATATGGAGAAAGG + Intronic
1036545954 8:9770141-9770163 CATGGTGCTAAACTGCAGAAAGG - Exonic
1036643993 8:10600994-10601016 CTGGGTGCTCCACAGGGCAAAGG + Intergenic
1036782418 8:11658783-11658805 CTGTTTTCTCATCTGGAGAATGG - Intergenic
1037831230 8:22190832-22190854 CTGGGTTCTCTGCTAGAGAAGGG - Intronic
1039496027 8:37980872-37980894 CTAGATGCTCTCCTGGAGAATGG + Intergenic
1040472115 8:47742466-47742488 TTGGGTGGCCATCTGGAGAATGG - Intergenic
1040665061 8:49621727-49621749 GTGAGTGCACACCTGGAGAAGGG - Intergenic
1044265045 8:90172231-90172253 CTGAATGCTCATCTGTAGAATGG + Intergenic
1044990569 8:97791817-97791839 CTGAGTCCTCATCTGTAGAATGG + Intronic
1048317001 8:133369962-133369984 CTGGGTGCTCAGGTGGCCAAAGG - Intergenic
1050023775 9:1311831-1311853 CTGCATGCTCAACTTGAGTAAGG + Intergenic
1052426465 9:28311428-28311450 CTGGGAGCGCTACTGGAGACTGG + Intronic
1052795094 9:32916120-32916142 CTGGGTGCTGAAATGGAGACTGG - Intergenic
1055284253 9:74711645-74711667 CTTGGTTTTCAACTTGAGAAAGG - Intergenic
1056062303 9:82896414-82896436 TTGTGTGCTCAACTGATGAATGG - Intergenic
1056886565 9:90448962-90448984 CTTGTTGCCCAACTGGAGCAAGG + Intergenic
1057794377 9:98145084-98145106 CTGGGTGCTCATAAGGAGAGGGG - Intronic
1058478788 9:105369741-105369763 CTGGGTCCTTCACTAGAGAAAGG + Intronic
1059323435 9:113487049-113487071 CTGGGTGCTGACCTGGAGCCAGG + Intronic
1061677762 9:132228018-132228040 CAGTCTGCTCATCTGGAGAAGGG - Intronic
1061745134 9:132733966-132733988 CAGGGTGCCCACCTGGAGCAGGG - Intronic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1186226522 X:7404865-7404887 TTGGGTGCTGGAATGGAGAAGGG - Intergenic
1188979419 X:36713725-36713747 CTGGGAGCTCTACGGGAGACTGG + Intergenic
1192149862 X:68705576-68705598 CTGGGGGCTGAAGTGAAGAATGG - Intronic
1195473452 X:105259513-105259535 CTGGGAGCTCCACTCGAGAGAGG + Intronic
1197086500 X:122482804-122482826 CTGGGAGCACTACAGGAGAATGG - Intergenic
1199577021 X:149322179-149322201 CTGGTGGCACAACTGCAGAAAGG - Intergenic