ID: 906443614

View in Genome Browser
Species Human (GRCh38)
Location 1:45873740-45873762
Sequence AACAGCTTGATGATATTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906443614_906443615 21 Left 906443614 1:45873740-45873762 CCTGTTAATATCATCAAGCTGTT 0: 1
1: 0
2: 2
3: 8
4: 140
Right 906443615 1:45873784-45873806 ACACATTATTTATAGAATAAAGG 0: 1
1: 0
2: 2
3: 74
4: 644

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906443614 Original CRISPR AACAGCTTGATGATATTAAC AGG (reversed) Intronic
900390074 1:2429967-2429989 CACAGCTTGATGAAATTTAAAGG - Intronic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
906300682 1:44679295-44679317 ACCAGCTTGATCATAAGAACTGG - Intronic
906443614 1:45873740-45873762 AACAGCTTGATGATATTAACAGG - Intronic
906809236 1:48809347-48809369 GACAGCTTGATATTATAAACAGG + Intronic
908796889 1:67838993-67839015 TAAAGCTAGATGAAATTAACAGG - Intergenic
909318200 1:74249862-74249884 AACTGCTTGATGATATTTTGGGG - Intronic
910724023 1:90319495-90319517 AATAACATGATGATATCAACTGG - Intergenic
910796332 1:91101252-91101274 TAGAGCAGGATGATATTAACAGG - Intergenic
912981978 1:114382918-114382940 AACAGATTGATGAAAGTAAAAGG - Intergenic
913193911 1:116438072-116438094 ACCAGCTTGATGAAATAAATTGG + Intergenic
919487935 1:198167447-198167469 AACATGATGATGATAATAACAGG + Intronic
920616020 1:207493488-207493510 AACAGTATAATTATATTAACAGG + Intergenic
922407072 1:225325517-225325539 AACAGGGTAATGATATAAACAGG - Intronic
923100763 1:230814833-230814855 CAAAGCTTGATGATATTTATAGG - Intergenic
1063018141 10:2098772-2098794 TAAAGCTTGATGATATTATTTGG + Intergenic
1063872610 10:10434944-10434966 AAGAGCTTGTGGATATCAACAGG - Intergenic
1068525767 10:58127697-58127719 AACAGTTTGAAGGTATTAGCAGG + Intergenic
1068601588 10:58962851-58962873 AACAGTTTGTTGATGTTCACTGG - Intergenic
1069461706 10:68600858-68600880 AACATGTTGATGATTTTAAATGG + Intronic
1078324350 11:10367407-10367429 AACCACTAGATGATATTAAATGG - Intronic
1082206985 11:49449031-49449053 AACAGATTGATTAGAATAACTGG - Intergenic
1084649077 11:70477846-70477868 ATCACATTGATGATATTCACTGG + Intronic
1086648288 11:89252710-89252732 AACAGATTGATTAGAATAACTGG + Intronic
1086761073 11:90632081-90632103 AACAGATGGGTGATATCAACAGG - Intergenic
1087884175 11:103458866-103458888 ACCAGCTTGAAGTTTTTAACTGG - Intronic
1089279679 11:117364930-117364952 ATCAGCTTGATAATAAAAACGGG - Intronic
1090571531 11:128052499-128052521 TACAGCTTGAGGATTTCAACAGG - Intergenic
1091698059 12:2641299-2641321 AACAGCTTGCTCATTTTCACAGG + Intronic
1092782323 12:11998771-11998793 AACACCTTGCTGATAAAAACAGG - Intergenic
1097444327 12:59649588-59649610 AAGATTTGGATGATATTAACTGG + Intronic
1097775872 12:63645143-63645165 AACAAGTTTATGATATTAGCTGG + Intronic
1099138233 12:78935905-78935927 CACAGCTTGATCATATAATCTGG + Intronic
1099589400 12:84568111-84568133 AACAGTTTTATTATATTTACAGG + Intergenic
1099887437 12:88548944-88548966 AACAGCTTGAAATTTTTAACAGG + Intronic
1108504995 13:51104876-51104898 TGCAGCTTGAAGAAATTAACAGG + Intergenic
1108779579 13:53812881-53812903 AGCAGCAGGATGAAATTAACTGG - Intergenic
1109490130 13:63086981-63087003 AACATATTAATGATATTGACAGG - Intergenic
1109785538 13:67170099-67170121 AACAGCTTTATATTATTCACAGG + Intronic
1109828162 13:67750968-67750990 AACAGCTTGAACATAAAAACAGG + Intergenic
1110082294 13:71330722-71330744 AACAGCTTCATGACATAACCAGG + Intergenic
1112637695 13:101233812-101233834 ATCATCCTGATGATATTGACTGG - Intronic
1113134823 13:107077770-107077792 AACAGCTTGATAAAAATAACAGG - Intergenic
1116760673 14:49009497-49009519 AACATCTTGATGATAATAATAGG - Intergenic
1118114442 14:62759528-62759550 ACCAGCTTTATGATATCAAATGG - Intronic
1121674039 14:95737890-95737912 AATAGGTTGATGATTATAACTGG + Intergenic
1123971404 15:25511275-25511297 AAGAGCTTGATCATCTTAGCAGG - Intergenic
1128154951 15:65386218-65386240 AACAGCCTGATGCTGTAAACAGG + Intronic
1139438702 16:66952748-66952770 TACAGATTGATGTTATAAACTGG + Intergenic
1148015127 17:44516399-44516421 AACAGCTCGATGTTATAAACTGG + Intergenic
1151043751 17:70895243-70895265 ATCATCCTGAAGATATTAACAGG + Intergenic
1152612081 17:81320473-81320495 AACAGCTCTATGTTATGAACTGG - Intronic
1160280651 18:77486859-77486881 AACAGATTGCTCATATTGACTGG + Intergenic
1164149483 19:22538405-22538427 AACAGCTTGTGGATTTTAAAAGG - Intergenic
930609398 2:53524410-53524432 GACATTTTGATGATATTATCTGG + Intergenic
931401808 2:61938202-61938224 AACAGTTTGATGATGTTAACAGG - Intronic
933188791 2:79309646-79309668 TACAGATTGATGATTTAAACTGG + Intronic
933557630 2:83850445-83850467 AACAACTTGATTACATTGACAGG - Intergenic
937516963 2:122666002-122666024 AGCAGCTTTGTGATATAAACAGG - Intergenic
939191815 2:138925224-138925246 ATGAGCTTAATGATATTATCTGG - Intergenic
939336348 2:140833660-140833682 AACATGTTGATGATGTTAAGTGG + Intronic
942550029 2:177106032-177106054 AGCAGCATGATGATATACACTGG + Intergenic
943922435 2:193726155-193726177 AAAAGCTTGATGGAAGTAACTGG + Intergenic
947133635 2:226955164-226955186 AACATCTTGATGATATCGTCAGG + Intronic
1169540779 20:6597244-6597266 AAGAGCTTTATTAGATTAACTGG + Intergenic
1174781533 20:53393558-53393580 AACAGAATAATGATATTAACAGG - Intronic
1176949128 21:15023107-15023129 AACAGTTTCATGATCTTAAAAGG - Intronic
1177083989 21:16678858-16678880 AAATGATTGATGATATTAAAAGG + Intergenic
1183595978 22:38812019-38812041 AATTTCTTGAAGATATTAACTGG + Intergenic
1185180006 22:49354179-49354201 AAAAGATTGATGAAATTCACTGG - Intergenic
950647055 3:14383499-14383521 AACAGCTTGATGCTTTGAGCGGG - Intergenic
952276305 3:31880506-31880528 AATAGCTTGAGAAAATTAACAGG - Intronic
954773303 3:52994108-52994130 AACAGTTTGAACTTATTAACAGG - Intronic
957105216 3:75878300-75878322 AACAAATTGATGATATTTGCTGG + Intergenic
957461608 3:80528710-80528732 GACAGCTTGATGGTATTATAAGG - Intergenic
965987096 3:174767475-174767497 TACAGCATGATGATATTTAATGG - Intronic
967351017 3:188514030-188514052 AACTGCTTGATAATATCAGCGGG + Intronic
967438445 3:189478128-189478150 AAGAGCTTGACCATATTTACAGG - Intergenic
970658831 4:18261740-18261762 AAAATCTTGAGGATATTTACAGG + Intergenic
974411847 4:61552148-61552170 AACTGCTTAATGACAATAACAGG + Intronic
982976931 4:162075550-162075572 AACAGCTTCCTGATGTTAAGTGG + Intronic
984537753 4:180997717-180997739 AACTGAGTCATGATATTAACAGG - Intergenic
985357239 4:189134645-189134667 AACAGCTTAATATTTTTAACAGG + Intergenic
987696134 5:21334998-21335020 AATAGCTTGAGGAAATGAACAGG - Intergenic
988756007 5:34251238-34251260 AATAGCTTGAGGAAATGAACAGG + Intergenic
989071556 5:37517138-37517160 ATCAGATTGATGCTATTAAGTGG + Intronic
989411884 5:41128869-41128891 AACAGCATTATGATTTTACCTGG - Intergenic
990296170 5:54403697-54403719 GACAGCTTGATGATAATCTCGGG + Intergenic
991744273 5:69717092-69717114 AATAGCTTGAGGAAATGAACAGG + Intergenic
991753433 5:69838144-69838166 AATAGCTTGAGGAAATGAACAGG - Intergenic
991795845 5:70296816-70296838 AATAGCTTGAGGAAATGAACAGG + Intergenic
991803050 5:70394871-70394893 AATAGCTTGAGGAAATGAACAGG - Intergenic
991823647 5:70592360-70592382 AATAGCTTGAGGAAATGAACAGG + Intergenic
991832752 5:70713269-70713291 AATAGCTTGAGGAAATGAACAGG - Intergenic
991888215 5:71296335-71296357 AATAGCTTGAGGAAATGAACAGG + Intergenic
994113106 5:96030708-96030730 AAGAGCTAGATGCTATTACCTGG + Intergenic
995483628 5:112617019-112617041 AACAGCTGGGTGAAATTAAATGG + Intergenic
997412980 5:133704291-133704313 AACAGCTTCATGGAATTGACTGG + Intergenic
1001351671 5:170973943-170973965 CCCAGCATGATGATATTAAGAGG - Intronic
1003003304 6:2357736-2357758 AACAGATTAATGATGTTAAGTGG + Intergenic
1003456798 6:6290974-6290996 ATCAGCATGATGATTTTACCTGG + Intronic
1003463712 6:6356675-6356697 CACAGCTTAATGAGAATAACAGG - Intergenic
1005554655 6:26963033-26963055 AATAGCTTGAGGAAATGAACAGG + Intergenic
1008818062 6:55593229-55593251 AGCAGCTTTATGATATTCATGGG - Intergenic
1012592557 6:101000543-101000565 AACAGCTGCATGATATTTCCTGG - Intergenic
1012707460 6:102550251-102550273 AACAGCTTGATAATTTGAAAAGG + Intergenic
1014400434 6:120982729-120982751 AACAGCTTGAGAATATATACAGG - Intergenic
1014447553 6:121546426-121546448 AACAGCATGTTAATATTAACAGG - Intergenic
1014499674 6:122170394-122170416 AACAACTGGATTGTATTAACTGG - Intergenic
1014659039 6:124144072-124144094 AACATCTTTATAATATTAAATGG - Intronic
1014712320 6:124821395-124821417 TACAGCTTGATCATATTTATTGG - Intronic
1016220086 6:141656981-141657003 AACACTTTGATGAAATTAAGTGG + Intergenic
1016561896 6:145404975-145404997 AACTGCATGATGATTTTCACAGG + Intergenic
1017651937 6:156591610-156591632 AGCTGATTGCTGATATTAACTGG + Intergenic
1021610319 7:22451508-22451530 AACAGCTATATTATATTAAATGG - Intronic
1022602234 7:31772284-31772306 CACAGCTTAATAATATTAACAGG - Intronic
1022934773 7:35162738-35162760 AACAAGTTTATGATATTAGCTGG + Intergenic
1023205982 7:37750204-37750226 AACTGCTTGGTGATTTAAACAGG + Intronic
1023681825 7:42695199-42695221 AACAGCGTCATGATATTCCCTGG + Intergenic
1023767004 7:43521168-43521190 ACCAACGTGATGATATTAAGAGG + Intronic
1024951870 7:54870149-54870171 ATCAGGTTTATGATATTTACTGG + Intergenic
1025257161 7:57392178-57392200 AACAGATTGATTGTATTCACTGG + Intergenic
1026518647 7:71095289-71095311 AACAACTTGAGGATGTAAACAGG + Intergenic
1027622891 7:80513814-80513836 ATCAACTTGATGAGATTATCAGG + Intronic
1029005205 7:97202044-97202066 AGCAGGTTGAGGATAGTAACAGG + Intergenic
1029830713 7:103255502-103255524 AACAAGTTTATGATATTAGCTGG + Intergenic
1031659236 7:124399652-124399674 AAAAGCTTGATGATATAAGCAGG + Intergenic
1032345530 7:131113112-131113134 AACAGTGAGATGATATCAACAGG + Intronic
1032967971 7:137123518-137123540 AACAGCATGAAGAAAATAACGGG + Intergenic
1034718857 7:153269377-153269399 AAGAACTTGATAATATTAAATGG + Intergenic
1035425960 7:158773379-158773401 AACAGCTTTTAGAAATTAACTGG - Exonic
1036149851 8:6287140-6287162 AAGAGCTTGAAGATATTAATGGG - Intergenic
1037221329 8:16526086-16526108 ATCAGCATGATGTTATTAATAGG - Intronic
1040676961 8:49761977-49761999 AACAGCTATATGAAATTATCTGG - Intergenic
1043783422 8:84366046-84366068 AACAACTGGATGATATCATCTGG - Intronic
1047066113 8:121284948-121284970 AACAACTTGATGAAACTCACTGG + Intergenic
1049628466 8:143637345-143637367 TACAGCCTGAAGAAATTAACAGG - Intronic
1049915575 9:314658-314680 AACAGCTTCAAAATATTAAAGGG - Intronic
1051159914 9:14195948-14195970 AATTGCTGGATGATATTAATAGG - Intronic
1052390642 9:27875337-27875359 AACATCTTGATGTTATTCAAAGG + Intergenic
1053228734 9:36386640-36386662 AAGACCTTCCTGATATTAACAGG + Intronic
1055422175 9:76155459-76155481 AACTGCTTGATGACAGCAACTGG - Intronic
1055613379 9:78045625-78045647 AACAGCTGAATGATATCAAAAGG + Intergenic
1056255801 9:84798289-84798311 CCCAGTGTGATGATATTAACAGG - Intronic
1057060360 9:91998680-91998702 AACAGCCTGGAGATTTTAACTGG - Intergenic
1059834270 9:118132597-118132619 AAAAGTTTGAAGATACTAACAGG - Intergenic
1186052249 X:5610191-5610213 AATAGCATTATGATCTTAACTGG + Intergenic
1187664852 X:21595374-21595396 AACATCTTGATGATATGAACAGG + Exonic
1189980117 X:46501547-46501569 AACAGCTTGAGGATTTGAAGGGG + Intronic
1191773139 X:64784168-64784190 AATTACTGGATGATATTAACTGG - Intergenic
1194032042 X:88829273-88829295 GACAATTTGATAATATTAACAGG + Intergenic