ID: 906445175

View in Genome Browser
Species Human (GRCh38)
Location 1:45890058-45890080
Sequence AGGAACTAGATTGGTATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906445175_906445181 23 Left 906445175 1:45890058-45890080 CCATCTATACCAATCTAGTTCCT 0: 1
1: 0
2: 2
3: 11
4: 103
Right 906445181 1:45890104-45890126 ACACCTCACTTCCTTATGAAAGG 0: 1
1: 0
2: 1
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906445175 Original CRISPR AGGAACTAGATTGGTATAGA TGG (reversed) Intronic
902154831 1:14476879-14476901 AGGAACAAGCTTGGTATAGTCGG - Intergenic
904767473 1:32861534-32861556 TGGCACTAGATGGGTACAGAGGG + Intergenic
906007313 1:42486973-42486995 AGGAAGTAGATTGGCATAGCTGG + Intronic
906445175 1:45890058-45890080 AGGAACTAGATTGGTATAGATGG - Intronic
907894410 1:58672058-58672080 AGAGACTAAATTGATATAGATGG + Intronic
909011773 1:70342799-70342821 GGGAACTAGATAGGTAGAGATGG + Intronic
913339068 1:117739149-117739171 AGGATCTAGATTGGCAAAGATGG + Intergenic
914422258 1:147540291-147540313 AGGAATTTGATTGGTGTGGAGGG - Intergenic
919307692 1:195864097-195864119 AGCAGCTAGAATGGTAAAGATGG + Intergenic
919421996 1:197381133-197381155 AGGCCCTAGAGTGGTATTGAAGG - Intronic
921904266 1:220479718-220479740 AGGAAATAGATTGCTGTTGAAGG - Intergenic
922944236 1:229497246-229497268 AATAACTAGTTTGCTATAGAAGG + Intronic
923168215 1:231387861-231387883 AGGCAGAAGAGTGGTATAGATGG - Intronic
1069338721 10:67385758-67385780 AGGAACTACATTCCTACAGAGGG + Intronic
1072141495 10:92592782-92592804 AGTAAATAGATTGGAATATATGG - Intergenic
1073803667 10:107071614-107071636 AGGAAGTAGATTAATCTAGAGGG - Intronic
1078652214 11:13206390-13206412 AGTTACTAGAATGGGATAGAAGG - Intergenic
1088592956 11:111419026-111419048 AGGACACAGATAGGTATAGAGGG - Intronic
1088695742 11:112364442-112364464 AGGAACTGGATTGATTTAGGAGG + Intergenic
1090457518 11:126862728-126862750 AGGACCTATTGTGGTATAGATGG - Intronic
1091935219 12:4429617-4429639 AGGAAAAACATTGGGATAGAAGG + Intronic
1092550365 12:9492419-9492441 AGATACTAGAATGGGATAGATGG + Intergenic
1092726719 12:11493797-11493819 TGGTACTAGATTGGGATTGAAGG - Intronic
1092757759 12:11779769-11779791 AGAAAATTGGTTGGTATAGACGG + Intronic
1094524799 12:31224512-31224534 AGGCACAAGGTTGGTGTAGAAGG + Intergenic
1095750541 12:45705666-45705688 AGAAACTAGATTGCAAGAGATGG - Intergenic
1099030252 12:77517444-77517466 AGGAAGTAGAGTGATATAGCTGG + Intergenic
1099330333 12:81276806-81276828 ATGAACTAGTTTGGTTTATAGGG + Intronic
1105713030 13:23031612-23031634 AGGAATTGGATAAGTATAGAGGG + Intergenic
1106165634 13:27243408-27243430 AGGAACACAATTGGTTTAGAGGG + Intergenic
1110620318 13:77587213-77587235 AAGAACTAGATGAGTATAGCTGG - Intronic
1111249760 13:85587890-85587912 AGGAACAGAATTAGTATAGAGGG + Intergenic
1116200339 14:41785780-41785802 AGGCATTAGATTTGTATAAAAGG + Intronic
1118129874 14:62951048-62951070 AGGAAATACTTTGGTATATATGG + Intronic
1119046006 14:71319917-71319939 AGGAATTAGATTGAAAGAGAAGG + Intergenic
1119860924 14:77935527-77935549 AGGAAGTAGATGGGTAAAGAAGG + Intergenic
1123975669 15:25552195-25552217 AGGAAACAGATTGGTAGTGAGGG + Intergenic
1126171514 15:45699193-45699215 AGGACCTAGAATAGTATATATGG + Intergenic
1126939540 15:53751816-53751838 AGGACATAGATTGGTAGAGTTGG - Intronic
1130106234 15:80930725-80930747 AGGAACCATATTGGAATGGAAGG + Intronic
1132734037 16:1376746-1376768 AGGAAAAAGCTTGGTATATAGGG - Intronic
1136022064 16:27446649-27446671 AGGAACCAGACTGGGATAGGGGG + Intronic
1138545909 16:57719458-57719480 AGGACATAGATTTGTACAGAGGG - Intronic
1140602540 16:76494840-76494862 AGGAATTATATTGGGAGAGAAGG + Intronic
1147847772 17:43417129-43417151 AGGAATTAGATTGGTATAAATGG - Intergenic
1153555821 18:6312203-6312225 CGGAACTCGTTTGGTATTGATGG - Intronic
1155372539 18:25117186-25117208 AGGAAAGAGCTTGGTAGAGATGG - Intronic
1156100709 18:33591540-33591562 AGTAACTAAATAGGAATAGATGG + Intronic
1156591307 18:38491770-38491792 AGTTACTTGATTGCTATAGATGG - Intergenic
1167019537 19:46863092-46863114 AGGAACTAAATGGGAAGAGAAGG - Intergenic
1167732412 19:51268217-51268239 AGCAACTAGACTGGTCGAGAAGG + Intronic
926687775 2:15711168-15711190 AGAACCTAGAATGGAATAGATGG - Intronic
928504340 2:31934343-31934365 AGGAACAGGATTGGTAGAAATGG - Intronic
928739129 2:34329007-34329029 AGTAACTAGATGGCTACAGAAGG - Intergenic
930314700 2:49783813-49783835 AGGTAATAGATTGGGATAAAAGG + Intergenic
931586661 2:63837389-63837411 AGGATTTAGATGGGTACAGATGG + Intergenic
933402442 2:81816093-81816115 AGGAGGTAGAGTGGGATAGAAGG - Intergenic
933682272 2:85112666-85112688 AGGAACAAGATTGGAATACTGGG + Intergenic
938815108 2:134894766-134894788 AGCATCTAGATTGGAAGAGAAGG + Intronic
940406176 2:153305085-153305107 AGGCACTAGCTTGGAATAGTAGG + Intergenic
941368813 2:164638744-164638766 AGGAACTAAGTTGGTAAATATGG + Intergenic
945658228 2:212651959-212651981 ATGAACTGGTTTGGTAAAGATGG + Intergenic
947696015 2:232189911-232189933 AGGAACCAGATTAATAAAGATGG + Intronic
947922279 2:233887718-233887740 AGAAAACAGAGTGGTATAGAAGG - Intergenic
1168985415 20:2044151-2044173 AGGAAATAGATCTGTAAAGATGG + Intergenic
1174141910 20:48420988-48421010 ATGAACTAAAATGGAATAGAAGG - Intergenic
1174692199 20:52517263-52517285 AGGTGCCAGATTGGAATAGATGG - Intergenic
1177278210 21:18943802-18943824 AGTAACTAGATTTGTGTAAAGGG + Intergenic
1177425171 21:20913890-20913912 AGGAAGTAGATTGTTATAAATGG + Intergenic
949668233 3:6366471-6366493 AGGGAATAGATAGGCATAGATGG + Intergenic
953591739 3:44263194-44263216 AAGAATTAAATTGGCATAGAAGG + Intronic
956190670 3:66605073-66605095 AGGAAGCAGAGTTGTATAGATGG + Intergenic
956582226 3:70826698-70826720 AGGAACTAGAGTGTAATAGTAGG + Intergenic
961977263 3:131039558-131039580 AGGAACCAGATCGGTTTAGAAGG - Intronic
964960859 3:162423417-162423439 AGGAAGAAGAATGGGATAGAAGG - Intergenic
967672608 3:192256337-192256359 GGGAAGTAGATTTGCATAGAGGG - Intronic
975172087 4:71244013-71244035 TGGAATTACATTGTTATAGATGG + Intronic
977121987 4:93113756-93113778 AGGAAGGAGCTTGTTATAGATGG + Intronic
980174213 4:129325198-129325220 AGGAAATAGACTGGGGTAGAAGG - Intergenic
981535745 4:145797596-145797618 AGGAACTAGAAAGGGAGAGAAGG - Intronic
987680058 5:21123991-21124013 TGGAAAAAAATTGGTATAGAAGG + Intergenic
987860475 5:23480526-23480548 ATAAATTAGATTGGTATATAAGG + Intergenic
987886592 5:23821272-23821294 GGGGACTAGTTTGGTATAGGAGG + Intergenic
990112781 5:52348362-52348384 AGGAATTAGATGGGTACAGGTGG + Intergenic
992774857 5:80080281-80080303 AGGACCAAGATGGGGATAGAAGG + Intronic
997085906 5:130798316-130798338 TTAAACTAGATTGGAATAGATGG + Intergenic
997278194 5:132616727-132616749 AGGCACTAGACTGGTATAAAAGG + Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
999284679 5:150387340-150387362 AGAAACTGAATTGGTATAGCTGG + Intronic
1002990399 6:2233061-2233083 TGGAACTAGAGTGGTAAAGAAGG + Intronic
1005347266 6:24902938-24902960 AATAACTAGATTGGTTTATACGG - Intronic
1005498596 6:26410665-26410687 CGAAATTAGATTGATATAGAAGG + Intronic
1007476389 6:42122516-42122538 AGGAACCAGGTGGGTAGAGAAGG + Intronic
1010297396 6:74215864-74215886 CAGACCTAGATTGCTATAGAGGG - Intergenic
1010911986 6:81569864-81569886 AGGAACTAAACAGGTATAAAGGG - Intronic
1011196303 6:84783114-84783136 AGGATCTAGAATGGTGTTGAAGG + Intergenic
1012113735 6:95266866-95266888 AGGAACAAGATTGGAACACATGG - Intergenic
1012306574 6:97665887-97665909 AGGAAGAGGATTGGTATACATGG + Intergenic
1012915352 6:105164390-105164412 ACGAAGTAGATTAGTAAAGATGG - Intronic
1014708841 6:124782352-124782374 AGGTACTAGATTGGAAGATAAGG - Intronic
1030663266 7:112246076-112246098 AGGAACTACATTGGTATAAAAGG + Intronic
1030961822 7:115932350-115932372 AAGAGCTAGCTTGGTACAGAGGG - Intergenic
1031952825 7:127909932-127909954 AAGAAATAGATTGGTAGACAGGG + Intronic
1039023974 8:33237863-33237885 AGGAACTAGAATTGTTTAGCAGG + Intergenic
1039249769 8:35650023-35650045 GGAAACTAGATTGGTATATGAGG + Intronic
1046088256 8:109465754-109465776 AGGATTTAGATTGGAATAAAAGG - Intronic
1046221554 8:111223419-111223441 AGTAACAACACTGGTATAGAAGG - Intergenic
1048393802 8:133993751-133993773 AGGAACTAGAATGGTAGTTAGGG - Intergenic
1051291666 9:15552028-15552050 AGGACCCAGTTTAGTATAGAAGG + Intergenic
1052602758 9:30658583-30658605 AGAAACTATATTCCTATAGATGG + Intergenic
1054867889 9:70021345-70021367 AGGAACTGGAATGGTAGTGATGG - Intergenic
1057110659 9:92467527-92467549 ATGACCTGGATTGGTAAAGAGGG - Intronic
1187777952 X:22784875-22784897 AGGATCAAGCTTGGTATAGTGGG - Intergenic
1187989599 X:24855046-24855068 AGGAAACAGATTAGTATATAAGG + Intronic
1195388100 X:104332710-104332732 AGAAGCTAGATTGGGATAGAAGG + Intergenic
1198452750 X:136784219-136784241 AGAAATTAGAGTGGTGTAGAAGG - Intergenic
1199363427 X:146948850-146948872 AGTAAGTAGATTGGAATAGAGGG - Intergenic